Application of specific target sgRNA for knocking out NSD2 and method for constructing anti-streptococcus rolofish strain
By knocking out the NSD2 gene in tilapia using CRISPR/Cas9 technology and designing specific target sgRNAs, the problem of tilapia's resistance to Streptococcus agalactiae infection was solved, and a high resistance of tilapia mutants to Streptococcus agalactiae was achieved, providing a new disease-resistant germplasm.
Patent Information
- Application Number
- CN202511714405.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-21
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2045-11-21
AI Technical Summary
There is a lack of effective methods for treating tilapia against Streptococcus agalactiae infection in existing technologies, and the application of CRISPR/Cas9 gene editing technology in fish has not yet involved research on the NSD2 gene.
Using CRISPR/Cas9 gene editing technology, a specific target sgRNA was designed to knock out the NSD2 gene in tilapia. By knocking out the NSD2 gene in tilapia using CRISPR/Cas9 technology, NSD2 gene-deficient tilapia were obtained, especially tilapia strains resistant to Streptococcus agalactiae infection.
By knocking out the NSD2 gene, the resulting tilapia mutant significantly improved resistance to Streptococcus agalactiae, providing excellent antibacterial tilapia germplasm and offering new disease-resistant germplasm for the tilapia aquaculture industry.
Smart Images

Figure CN121160808B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of life sciences and biotechnology, in particular to a method for knocking out NSD2 gene in tilapia based on CRISPR / Cas9 technology, and obtaining NSD2 gene knockout anti-streptococcus tilapia excellent germplasm. BACKGROUND
[0002] NSD2 is a member of the histone methyltransferase family. NSD2 can not only catalyze the dimethylation and trimethylation of histone H3K36, but also catalyze the methylation of histone H3K4, histone H3K27 and histone H4K20. Studies have shown that in embryonic stem cells, NSD2 regulates the expression of H3K36me3 along the chromatin by combining with specific transcription factors, thereby regulating the expression of its target genes. Studies have shown that NSD2 is highly expressed in myocardial cells, regulates Nkx-2.5 gene through H3K36me3, thereby regulating the development and differentiation of heart; another study has shown that NSD2 is associated with the promoter of key glucose metabolism enzyme genes, and methylates H3K36me2 on the promoter of metabolism enzyme genes. NSD2 affects the expression of genes such as hexokinase 2 (HK2), glucose 6-phosphate dehydrogenase (G6PD) and TIGAR on the glycolysis pathway. Studies have shown that inhibiting the expression of NSD2 significantly reduces the dimethylation level (H3K36me) of H3K36 and inhibits the autophagy of pulmonary artery. In summary, the current research on NSD2 mainly focuses on the research field of human diseases.
[0003] Studies have reported that some methyltransferases are negative regulatory genes of animal stress resistance; by knocking out specific methyltransferases, animals can obtain stress resistance phenotype. However, there is no research on the relationship between NSD2 gene and fish antibacterial infection.
[0004] Tilapia is an important aquaculture species, and it is also the largest freshwater aquaculture variety exported in China. In the process of tilapia breeding, it is easy to be infected by streptococcus agalactiae. Streptococcus agalactiae is one of the main causes of great economic losses in tilapia breeding industry. Therefore, obtaining anti-streptococcus agalactiae tilapia excellent germplasm is an important direction in tilapia breeding industry.
[0005] With the generation and development of CRISP / Cas9 gene editing technology, it has been gradually applied in the improvement of aquatic species, which makes it possible to quickly obtain anti-streptococcus agalactiae tilapia excellent germplasm by using gene editing means. SUMMARY
[0006] The present application aims to provide the application of NSD2 gene and its mutant, and the specific target sgRNA and its application.
[0007] The application also realizes NSD2 gene knockout of tilapia through CRISP / Cas9 gene editing technology, and obtains NSD2 gene deletion tilapia to obtain a kind of antibacterial, especially anti-streptococcus infection tilapia strain.
[0008] To achieve the above object, the technical scheme of the present application is as follows.
[0009] A specific target sgRNA for NSD2 gene contains a nucleotide sequence as shown in SEQ ID No.5.
[0010] SEQ ID No.5: GGACAUCAUCUGGGUCAAACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
[0011] Further, the nucleotide sequence of the specific target sgRNA for NSD2 gene is as shown in SEQ ID No.5.
[0012] The specific target sgRNA takes the sequence as shown in SEQ ID No.2 in the thirteenth exon of NSD2 gene as a target, i.e. the 125-144th base in SEQ ID No.1. The sequence of SEQ ID No.1 includes the thirteenth exon sequence and part of the fourteenth exon sequence of NSD2 gene, and the 125-144th base in SEQ ID No.1 (including the whole sequence of the thirteenth exon and part of the fourteenth exon sequence of NSD2 gene) is the position of the target.
[0013] SEQ ID No.1: GGGGGCAGCTGTTGTGCTGTGAGTCCTGCCCGGCAGCTTTTCACCCTGACTGCCTGAATATCGCTATGCCGGATGGGAGCTGGTTCTGCAACGACTGCCGAGCCGGAAAGAAACCCAAGTACAGGGACATCATCTGGGTCAAACTGGGAACATACCGGTAAGGGAACTGGATGCAAGGGTATCTTTTTACCTTCCATATCTTTGAGCTAAATCAGTAAGTTATACATTTGTTGTTTCTATCTTTCTCTCGTCCTCCTGAGATGGTGGCCAGCAGAGATCCACCACCCAAGAAACATTCCCACCAACATCCAGCATCTTCGACACGAGA.
[0014] SEQ ID No. 2: GGACATCATCTGGGTCAAAC.
[0015] More preferably, the sgRNA nucleotide sequence for the specific target point of NSD2 gene is shown as SEQ ID No. 5. The sgRNA for the specific target point of NSD2 gene described above can knock out the nucleotides within and / or near the target sequence. In some embodiments, mutations can be induced on the thirteenth exon of NSD2 gene.
[0016] A mutated NSD2 gene, which has a base deletion mutation on the thirteenth exon, specifically, 10 bases are deleted between positions 139-148. Compared with the wild-type NSD2 gene, the mutated NSD2 gene has 10 bases deleted between positions 139-148 of SEQ ID No. 1.
[0017] Further, by using the sgRNA for the specific target point described above, the NSD2 gene is knocked out to obtain the mutated NSD2 gene.
[0018] The NSD2 mutant tilapia obtained after the NSD2 gene is knocked out has stronger resistance to S. uberis. Compared with the wild type, the survival rate of the mutant is significantly improved when infected.
[0019] The sgRNA for the specific target point of NSD2 gene and the mutated NSD2 gene described above can be used to breed antibiotic-resistant tilapia strains, especially tilapia strains resistant to S. uberis infection.
[0020] Another technical solution of the present application is a method for breeding S. uberis-resistant tilapia strains, comprising the following steps:
[0021] (1) Knocking out the NSD2 gene of tilapia by using CRISPR / Cas9 technology, and identifying and screening to obtain F0 generation heterozygous mutant tilapia;
[0022] (2) Crossing the F0 generation heterozygous mutant with wild-type tilapia, and identifying and screening to obtain F1 generation heterozygous mutant.
[0023] Step (1) specifically injects Cas9 protein and the sgRNA for the specific target point of NSD2 gene into tilapia embryos. Preferably, the mass ratio of Cas9 protein to sgRNA is 3-4:1, and in a preferred embodiment of the present application, it is 3.2:1; the injection amount of sgRNA for each embryo is 0.2-0.4 ng, and in a preferred embodiment of the present application, it is 0.25 ng.
[0024] Further, the method further comprises step (3) of obtaining F2 generation of the tilapia by hybridization of the F1 generation of the heterozygous mutant, and identifying and screening homozygous tilapia of the NSD2 gene mutation in the F2 generation. In step (3), the tilapia with the same number of deleted bases and the same deletion position of the NSD2 gene in the F1 generation are hybridized to obtain homozygous tilapia of the NSD2 gene mutation in the F2 generation.
[0025] In steps (1)-(3), the F0 generation of the heterozygous mutant, the F1 generation of the heterozygous mutant, and the F2 generation of the homozygous tilapia of the NSD2 gene mutation are identified and screened by PCR amplification and gene sequencing.
[0026] In each step, the F0 generation of the heterozygous mutant, the F1 generation of the heterozygous mutant, and the F2 generation of the homozygous tilapia of the NSD2 gene mutation are subjected to PCR amplification and gene sequencing. In some embodiments of the present application, the number of deleted bases is 10.
[0027] Further, the streptococcus is Streptococcus agalactiae.
[0028] The present application has the beneficial effect that, for the first time, the NSD2 gene is knocked out in the tilapia, and the possibility of obtaining new germplasm of the tilapia is studied.
[0029] The NSD2 gene of the tilapia is knocked out by the CRISP / Cas9 gene editing technology, and the tilapia with the NSD2 gene deletion is obtained. It is found by the activated Streptococcus agalactiae infection experiment that the NSD2 mutant tilapia has stronger antibacterial ability, especially against Streptococcus agalactiae, compared with the wild type, which provides an important model for the breeding of good strains of the tilapia, and obtains good germplasm of the tilapia against Streptococcus agalactiae, and provides a new target for obtaining new germplasm of the fish against diseases. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 The figure is a schematic diagram of the NSD2 knockout target and primer design on the sequence of SEQ ID No. 1;
[0031] Figure 2 is a sequence comparison diagram of the wild type (WT) tilapia and the NSD2 knockout type (KO) tilapia;
[0032] Figure 3 is a sequence diagram of the F1 generation of the heterozygous mutant of the NSD2 gene edited tilapia;
[0033] Figure 4 is an electrophoresis diagram of the genomic DNA amplification of the F1 generation of the heterozygous mutant of the NSD2 gene edited tilapia, and the two bands appearing are the heterozygotes;
[0034] Figure 5 This is a comparison of sequencing results between the NSD2 gene-edited F2 generation homozygous mutant and the wild-type tilapia;
[0035] Figure 6 This is a sequence diagram of the base deletion in the NSD2 gene-edited tilapia F2 generation homozygous mutant;
[0036] Figure 7 This is a survival curve of NSD2 gene-edited tilapia F1 generation heterozygous mutants infected with Streptococcus agalactiae. Detailed Implementation
[0037] Example 1
[0038] (I) Design of tilapia NSD2 gene knockout target sites, gRNA target sites, and primer screening
[0039] First, the tilapia NSD2 gene sequence (GeneID: 100690380\Ensembl: ENSONIG00000012377) was located on NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov / ). Knockout targets were designed online using Primer Blast on the NCBI website, including upstream and downstream gRNA targets TS-ms-NSD2 (targetsite sequences). Oligo and SgRNA-scaffold were then biosynthesized. A PCR template was used to obtain an in vitro transcription template for gRNA, followed by in vitro transcription of the T7 promoter using this template.
[0040] NSD2 gene sequence fragment (GeneID: 100690380\Ensembl: ENSONIG00000012377, SEQ ID No. 1, containing exon 13) as follows Figure 1 As shown, the full-length sequence of SEQ ID No. 1 is 328 bp, including the complete sequence of exon 13 (yellow region) and a partial sequence of exon 14. The sequences marked in blue are the identified upstream and downstream primer sequences. The target site is designed in exon 13, and the sequence marked in red is the target sequence (SEQ ID No. 2), located at positions 125-144 of SEQ ID No. 1. The upstream and downstream gRNA targets for this gene are designed as TS-ms-NSD2 (Targetsite sequences).
[0041] The designed target site sequence (SEQ ID NO.2) is as follows, which is a positive target:
[0042] TS-ms-NSD2: 5'-GGACATCATCTGGGTCAAAC-3'.
[0043] The sgRNA (SEQ ID No. 5) sequence for the specific target of NSD2 gene is as follows:
[0044] 5' GGACAUCAUCUGGGUCAAACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 3'
[0045] The identification primer is designed online by using Primer blast in the NCBI website, and the selection conditions are as follows: (1) the distance between the upstream and downstream primers is 100 bp from the target; (2) the length of the upstream and downstream primers is 20-23 bp; (3) the amplified fragment is between 300 bp and 800 bp; (4) the designed primer has high specificity (i.e. only the desired band can be amplified). The designed identification primer is as follows:
[0046] its-ms-NSD2-F: 5 '-GCTGTTGTGCTGTGAGTCCT-3' (SEQ ID NO. 3);
[0047] its-ms-NSD2-R: 5 '-TCTCGTGTCGAAGATGCTGG-3' (SEQ ID NO. 4).
[0048] And the above-mentioned primer Oligo and SgRNA-scaffold are biosynthesized.
[0049] (2) Synthesis and purification of gRNA in vitro transcription template:
[0050] The present application utilizes T7 promoter for in vitro transcription. The specific operation steps refer to using the T7 in vitro transcription kit of Shanghai Shengong Biological Engineering Company to complete the operation according to the instruction manual.
[0051] The reaction system is: the synthesized Oligo, SgRNA-scaffold and identification primer are dissolved in sterilized ddH2O to 10 µM; 40 µL system: Oligo (10 µM) 3 µL, SgRNA-scaffold (10 µM) 3 µL, 2x EasyTaq PCR SuperMix (+dye) 20 µL, add water to 40 µL. In addition, the PCR reaction is 94°C for 3 min, 94°C for 30 s, 65°C for 30 s, 72°C for 1 min, 34 cycles, 72°C for 5 min final extension, 4°C long-term preservation. 4 tubes of 160 µL are synthesized into one tube, and then column purification is carried out.
[0052] The sequence of Oligo is shown in SEQ ID No. 6, which includes a T7 promoter sequence and a target sequence.
[0053] SEQ ID No. 6: GATCACTAATACGACTCACTATAGGACATCATCTGGGTCAAACGTTTTAGAGCTAGAAATAGC.
[0054] Among them, GGACATCATCTGGGTCAAAC is the target sequence.
[0055] The specific steps of purifying gRNA can refer to the QIAquick PCR pruification kit instruction book of QIAGEN company: first add 1 µL TURBO DNase to the above transcription product, incubate at 37°C for 15 min to remove excess untranscribed template DNA, and then add 1 µL 0.5M EDTA to terminate the reaction. Subsequently, 30 µL LiCl and 30 µL nuclease-free water are added and mixed thoroughly, and then placed at -80°C overnight. The next day, centrifuge at 4°C 12000 rpm for 15 min, discard the supernatant, and then add 1 mL of 70% ice ethanol for washing. Finally, add Nuclease-free water to resuspend the RNA.
[0056] The concentration of purified gRNA is determined by NanoDrop (Thermo, USA), and the size and quality are detected by electrophoresis (150V / 25min).
[0057] Example 2 Knockout of NDS2 gene of tilapia
[0058] The specific steps of gene knockout are as follows:
[0059] (I) Microinjection
[0060] Cas9 protein and gRNA mixed injection dose: 800ng / μL: 250ng / μL; injection volume: 1nL / embryo. Cas9 protein and target gRNA were placed on ice, mixed immediately before use, and the mixture was injected into cell stage of tilapia embryos, and the surviving embryos after injection were cultured to obtain NSD2 gene knockout tilapia.
[0061] Wherein, the target point TS-ms-NSD2 is as SEQ ID NO. 2; the primers used in gene sequencing are its-ms-NSD2-F and its-ms-NSD2-R, as SEQ ID NO. 3, 4.
[0062] (II) Effectiveness detection and identification screening:
[0063] After microinjection, the tilapia embryos were developed to 24h~48h, and 8 groups (1 embryo / group) were randomly selected. The genomic DNA was coarsely extracted by alkaline lysis method, and the main operation steps were as follows:
[0064] (1) 40µL 50mM NaoH solution was added to each tube of tilapia embryos, and incubated at 95℃ for 10min;
[0065] (2) Centrifuge briefly to make the liquid to the bottom of the tube, vortex for 1min or so, and incubate at 95℃ for 10min again;
[0066] (3) After brief centrifugation, place on ice for 1~2min, add 5µL Tri-HCl (PH=8.0), vortex, centrifuge at 12000rpm for 10min at room temperature, store briefly at 4℃, and store long-term at -20℃;
[0067] (4) Finally, the extracted tilapia genomic DNA was used as a template for PCR reaction to identify the effectiveness of tilapia knockout.
[0068] The system (20µL) of PCR reaction was: its-ms-NSD2-F (10µM) 1µL, its-ms-NSD2-R (10µM) 1µL, 2xEasyTaq PCR SuperMix(+dye) 10µL, extracted genomic DNA 1µL, and finally add water to 20µL. In addition, the PCR reaction was 94℃ for 3min, 94℃ for 30s, 60℃ for 30s, 72℃ for 1min, 34 cycles, 72℃ for 5min final extension, and 4℃ long-term storage.
[0069] The primers used in the gene sequencing were its-ms-NSD2-F: 5'-GCTGTTGTGCTGTGAGTCCT-3' (SEQ ID NO. 3) and its-ms-NSD2-R: 5'-TCTCGTGTCGAAGATGCTGG-3' (SEQ ID NO. 4). The effectiveness of the knockout was detected by electrophoresis, and the PCR product of the possible mutant was single-direction sequenced. The peak diagram was viewed by using the software Chrome, and the sequence was compared by using the blastn of the NCBI website. It was found that, compared with the wild type, the mutant had double peaks in the peak diagram near the target point, indicating the effectiveness of the knockout, as shown in Figure 2 .
[0070] Subsequently, for the mutant with double peaks in the PCR product sequencing, TA cloning, transformation of competent cells, and bacterial liquid delivery were further used to determine the number of bases deleted in the F0 generation mutant. The results, as shown in Figure 3 , the F0 generation mutant edited by the NSD2 gene deleted 10 bp, located at the 139-148th position of the thirteenth exon, i.e., the 139-148th position of the original SEQ ID No. 1 sequence.
[0071] Example 3 Construction of F1 generation hybrid tilapia and identification of the phenotype of resistance to Streptococcus agalactiae
[0072] The F1 generation tilapia was obtained by mating the F0 generation mutant hybrid (10 bp deletion in the NSD2 gene) obtained after identification in Example 1 with the wild type tilapia.
[0073] When the F1 generation tilapia reached 2 months old, the genomic DNA was extracted after tail clipping, PCR amplification, and electrophoresis to identify the genotype. The electrophoresis was run at 120 V for 180 min on a 4% agarose gel. The hybrid was identified by the presence of two bands, as shown in Figure 4 .
[0074] The F1 generation hybrid was further subjected to TA cloning, transformation of competent cells, and bacterial liquid delivery to determine the number of bases deleted in the F1 generation mutant. The NSD2 hybrid mutant all deleted 10 bp, as shown in Figure 5 .
[0075] The F1 generation hybrid tilapia and the wild type tilapia were injected intraperitoneally with 1x10 8 cfu / ml of activated Streptococcus agalactiae, with an injection volume of 100 μL. The survival rates of the wild type tilapia without injection of Streptococcus agalactiae (gray), the hybrid mutant tilapia without injection of Streptococcus agalactiae (green), the wild type tilapia injected with Streptococcus agalactiae (blue), and the hybrid tilapia injected with Streptococcus agalactiae (red) were statistically plotted over 7 days, with the results shown in Figure 7 .
[0076] By Figure 7 As shown in the survival curve graph of NSD2, the survival rate of NDS2 hybrid mutants is significantly higher than that of wild-type tilapia (blue) when infected with Streptococcus agalactiae (red). The above experiments show that NSD2 hybrid mutant tilapia has stronger resistance to Streptococcus agalactiae.
[0077] Example 4 Screening and identification of F2 generation mutants
[0078] The F1 generation mutants screened (all NSD2 genes are all 10 bp deletion and the deletion position is the same) are crossed with one male and one female to obtain F2 generation tilapia. When the F2 generation tilapia is 2 months old, the tail is cut and the genomic DNA is extracted, PCR amplified, and Sanger sequenced to identify the genotype. The sequencing results are normal peaks and the deletion bases compared with WT are F2 (as shown in Figure 5 ). The F2 generation homozygotes are further determined by TA cloning, transformation of competent cells, and bacterial liquid delivery for sequencing to determine the number of deletion bases of the F2 generation hybrid mutants. NSD2 homozygous mutants all lack 10 bp (as shown in Figure 6 ).
[0079] The above screening process to obtain NSD2 gene knockout tilapia with stable inheritance is as follows: (1) sequencing the NSD2 gene knockout tilapia F0 generation obtained by microinjection; (2) crossing F0 generation with wild tilapia to obtain F1 generation, and obtaining "-10 bp" (decrease 10 bp) hybrid tilapia by gene sequencing; (3) crossing the F1 generation mutants screened (all NSD2 genes are all 10 bp deletion and the deletion position is the same) with one male and one female to obtain "-10 bp" (decrease 10 bp) F2 generation homozygous mutant tilapia.
Claims
1. The application of specific target sgRNA for knocking out the NSD2 gene in constructing tilapia strains resistant to Streptococcus agalactiae, characterized in that, The specific target sgRNA nucleotide sequence is as follows: GGACAUCAUCUGGGUCAAACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU.
2. A method for constructing an agalactia-resistant, streptococcal tilapia strain, characterized in that, Includes the following steps: (1) Specific sgRNA and Cas9 protein were microinjected into tilapia embryos to knock out the NSD2 gene in tilapia, resulting in F0 generation NSD2 gene mutant tilapia; the specific sgRNA sequence was: GGACAUCAUCUGGGUCAAACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU; (2) F0 generation NSD2 gene mutant tilapia were mated with wild-type tilapia, and F1 generation NSD2 gene mutant heterozygous tilapia were identified and screened. (3) F1 generation NSD2 gene mutation heterozygous tilapia were hybridized to obtain F2 generation tilapia, which were then identified and screened to obtain F2 generation NSD2 gene mutation homozygous tilapia.
Citation Information
Patent Citations
All-male sterile nile tilapia strain and construction method thereof
CN116144708A
Systems and methods for modulating a target gene
CN118475734A