Rapid PCR detection method and kit for klebsiella pneumoniae, acinetobacter baumannii and pseudomonas aeruginosa

Abstract

The invention discloses a rapid PCR (polymerase chain reaction) detection method and kit for klebsiella pneumoniae, acinetobacter baumannii and pseudomonas aeruginosa, and belongs to the technical field of microbiological detection. The kit comprises a primer probe combination which is specifically designed for an rpsD gene of klebsiella pneumoniae, an acinetobacter baumannii recA gene and a pseudomonas aeruginosa ecfx gene, and the combined probe is subjected to Spacer linker blocking modification, so that the detection specificity of a system is remarkably improved. The method is simple, convenient and rapid to operate, the detection sensitivity of the klebsiella pneumoniae, the acinetobacter baumannii and the pseudomonas aeruginosa can reach 0.5 copies / mu L, the specificity is good, and an effective tool is provided for early and rapid diagnosis of lower respiratory tract infection caused by the klebsiella pneumoniae, the acinetobacter baumannii and the pseudomonas aeruginosa clinically.

Description

Technical Field

[0001] This invention relates to a rapid PCR detection method and kit for Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, belonging to the field of microbial detection technology. Background Technology

[0002] Klebsiella pneumoniae is a Gram-negative bacillus and one of the most common pathogens in clinical infections. It is commonly found in the human respiratory and intestinal tracts. When the body's resistance is reduced, it enters the lungs through the respiratory tract and causes confluent consolidation of the lobules, which in turn leads to infections of the respiratory, urinary, hematopoietic, and wound systems. It is characterized by its high infectivity and high mortality rate.

[0003] Acinetobacter baumannii is a non-fermenting Gram-negative bacillus. It is widely distributed in hospital environments and can survive for a long time, making it highly susceptible to infection in critically ill patients. It can cause hospital-acquired pneumonia, bloodstream infections, abdominal infections, central nervous system infections, urinary tract infections, and other diseases. According to data from the China CHINET Antimicrobial Resistance Surveillance Network, its clinical isolation rate is second only to Klebsiella pneumoniae.

[0004] Pseudomonas aeruginosa (PA) is a Gram-negative bacillus and an important opportunistic pathogen causing hospital-acquired infections. It is characterized by its easy colonization, high mutation rate, and multidrug resistance. The lower respiratory tract is the most common site of nosocomial bacterial infection, with infections primarily including bronchiectasis complicated by infection, chronic obstructive pulmonary disease complicated by infection, and pneumonia.

[0005] Lower respiratory tract infections are among the deadliest infectious diseases in the world, ranking fourth as the leading cause of death. Hospital-acquired pneumonia (HAP) and ventilator-associated pneumonia (VAP) are the most common hospital-acquired infections in my country. Domestic and international studies show that lower respiratory tract infections, including HAP / VAP, constitute the largest proportion of hospital-acquired infections. The top three common pathogens causing HAP / VAP in my country are Acinetobacter baumannii, Pseudomonas aeruginosa, and Klebsiella pneumoniae, often accompanied by mixed infections of two of these bacteria. Patients with lower respiratory tract bacterial infections typically receive empirical broad-spectrum antibiotic treatment while awaiting etiological testing results. However, due to the slow processing time and the fact that many test results are negative or lack clear clinical significance, de-escalation therapy is difficult to implement in clinical practice.

[0006] Currently, the main bacteriological methods for detecting Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa are culture, immunoassay, Gram staining, and biochemical tests. Quantitative bacterial culture of respiratory specimens provides important clinical reference value; however, these tests are time-consuming, typically requiring 2-3 days for results, which is detrimental to early diagnosis and treatment. Immunoassay relies on antigen-antibody reactions, which can lead to false positives and low sensitivity. Gram staining of blood cultures is difficult to decolorize, easily resulting in false positives. Traditional biochemical tests struggle to differentiate between similar bacterial phenotypes. This significantly limits the clinical diagnosis of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. The lack of simple, rapid, and sensitive detection methods causes a large number of patients infected with these bacteria to miss the golden period for treatment, leading to more severe bacterial infections and even death. Therefore, there is an urgent need for a detection method that reduces testing costs, is highly efficient, systematic, and economical and convenient, so as to detect and treat bacterial infections caused by Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa at an early stage. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides a rapid PCR detection kit and method for Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa using direct amplification without nucleic acid extraction. By digesting and homogenizing the collected sputum samples before releasing the nucleic acids, and utilizing spacer linker blocking modification of the probe, the specificity of PCR amplification is greatly improved. Finally, the identification and detection of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa are achieved through complete synchronization of PCR product formation and fluorescence signal accumulation. The aim is to solve the problems of long time consumption and high cost associated with existing methods for simultaneously detecting Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa.

[0008] The first technical solution provided by this invention is a composition for detecting Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. The composition comprises three sets of primers and probes: a first set of primers and probes for specific detection of Klebsiella pneumoniae, including a first forward primer, a first reverse primer, and a first probe, wherein the sequence of the first forward primer is shown in SEQ ID NO.1, the sequence of the first reverse primer is shown in SEQ ID NO.2, and the sequence of the first probe is shown in SEQ ID NO.3; a second set of primers and probes for detecting Acinetobacter baumannii, including a second forward primer, a second reverse primer, and a second probe, wherein the sequence of the second forward primer is shown in SEQ ID NO.4, the sequence of the second reverse primer is shown in SEQ ID NO.5, and the sequence of the second probe is shown in SEQ ID NO.6; and a third set of primers and probes for detecting Pseudomonas aeruginosa, including a third forward primer, a third reverse primer, and a third probe, wherein the sequence of the third forward primer is shown in SEQ ID NO.7, the sequence of the third reverse primer is shown in SEQ ID NO.8, and the sequence of the third probe is shown in SEQ ID NO.9.

[0009] In some embodiments, the 5' end of the first probe, the second probe, and the third probe are all labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0010] In some embodiments, the fluorescent reporter group is selected from any one of FAM, VIC, HEX, CY5, CY3, JOE, and ROX; the fluorescent quencher group is selected from any one of BHQ1, BHQ2, BHQ3, and TAMRA.

[0011] In some implementations, the first, second, and third probes are modified with acer linker blocking technology.

[0012] In some implementations, a spacer linker blocking modification is added between the 5' ends of the first, second, and third probes (1-2 bases).

[0013] The second technical solution provided by the present invention is a kit for simultaneously detecting Klebsiella pneumoniae, Acinetobacter baumannii and Pseudomonas aeruginosa, wherein the kit includes the composition described in the first technical solution.

[0014] In some embodiments, the kit further includes a fourth set of primers and probes for amplifying an internal standard, the fourth set of primers and probes including a fourth forward primer, a fourth reverse primer and a fourth probe, the sequence of the fourth forward primer being shown in SEQ ID NO. 10, the sequence of the fourth reverse primer being shown in SEQ ID NO. 11, and the sequence of the fourth probe being shown in SEQ ID NO. 12.

[0015] In some embodiments, the 5' end of the fourth probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0016] In some embodiments, the kit further includes PCR amplification solution and PCR enzyme solution.

[0017] Furthermore, the PCR amplification solution also includes PCR buffer and primer / probe solution; the PCR enzyme solution includes Taq DNA polymerase.

[0018] In some embodiments, the PCR buffer is 5-20 mM Tris-HCl, 5-15 mM MgCl2, 20-50 mM NaCl, and 15-25 mM... dNTPs.

[0019] Furthermore, the concentration of the Taq DNA polymerase is 1U to 3U; In some embodiments, the kit may also include, but is not limited to, 0.1%-1% DMSO, 1%-5% Betaine, 1%-5% Hepes, etc.

[0020] In some embodiments, the kit further includes a positive control and a negative control; Positive controls included pUC57 plasmid containing the synthetic Klebsiella pneumoniae rpsD gene sequence at a concentration of 1×10⁻⁶. 3 ~1×10 6 pUC57 plasmid containing the artificially synthesized Acinetobacter baumannii recA gene sequence at a concentration of 1×10⁻¹mL. 3 ~1×10 6 The pUC57 plasmid containing the artificially synthesized *Pseudomonas aeruginosa* ecfx gene sequence, at a concentration of 1×10⁻¹mL, contains copies / mL of 1×10⁻¹⁰. 3 ~1×10 6 The sample contained copies / mL of pUC57 plasmid with a synthetic GAPDH gene sequence at a concentration of 1×10⁻⁶. 3 ~1×10 5 copies / mL.

[0021] The negative control was a pUC57 plasmid containing a synthetic GAPDH gene sequence at a concentration of 1×10⁻⁶. 3 ~1×10 5 copies / mL.

[0022] The third technical solution provided by the present invention is a method for simultaneously detecting Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa for non-disease diagnosis purposes. The method involves using the kit described in the second technical solution to detect Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa via PCR reaction.

[0023] In some embodiments, the method includes the following steps: (1) Sputum sample pretreatment: Add sputum sample to a 50mL test tube with a screw cap. Depending on the viscosity of the sputum, add 1-2 times the volume (1 volume is about 3-5mL) of 4% NaOH digestion solution to the sputum tube, tighten the screw cap, vortex for 1 minute, and place in a biosafety cabinet at room temperature for 15-20 minutes to allow the sputum to liquefy fully. (2) Nucleic acid extraction: Take no more than 200uL (adjust according to the kit instructions) of the sample to be tested, and use the Tiangen Bacterial Genomic DNA Extraction Kit (catalog number DP302) or other commercially available bacterial extraction kits to extract DNA from the sample to be tested according to the instructions.

[0024] (3) Prepare PCR reaction solution using the composition described in the first technical solution, perform PCR reaction using the extracted nucleic acid as a template and collect fluorescence.

[0025] More preferably, the final concentration of primers in the PCR reaction solution is 0.3 μM, and the final concentration of probes is 0.15 μM.

[0026] More preferably, the PCR reaction procedure is as follows: pre-denaturation at 95°C for 1 min, followed by denaturation at 95°C for 1 s, annealing at 60°C for 20 s, 45 cycles, and then fluorescence collection.

[0027] The fourth technical solution provided by the present invention is the application of the composition described in the first technical solution or the kit described in the second technical solution in the in vitro simultaneous detection of Klebsiella pneumoniae, Acinetobacter baumannii and / or Pseudomonas aeruginosa.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows: Using the primer combination of this invention, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa can be detected simultaneously at 2 copies / μL; it has high sensitivity and good accuracy, providing strong support for the clinical detection of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa infections.

[0029] The primer-probe combination of this invention artificially modifies the 5' end of the probes for Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa by a spacer linker, which can effectively block non-targeted amplification caused by the primer's own dimer structure and CrossDimer structure, significantly improving the detection specificity of the system. At the same time, an enhancer is added to the reaction system to further improve the anti-interference ability of the PCR reaction system.

[0030] The Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa detection kit of this invention requires only one step of lysis to obtain nucleic acid, eliminating the need for complicated extraction and purification processes and completely freeing up the hands of testing personnel. Furthermore, the entire detection process is conducted under closed conditions, avoiding problems such as false positives and environmental contamination. The PCR reaction can be completed in just 30 minutes, the operation is simple, and the results are easy to read, which helps in the early diagnosis of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, facilitating timely control of the disease. Attached Figure Description

[0031] Figure 1 The results of detecting Klebsiella pneumoniae in this embodiment of the invention are shown.

[0032] Figure 2 The results of detecting Acinetobacter baumannii in this embodiment of the invention are shown.

[0033] Figure 3 The results of detecting Pseudomonas aeruginosa are shown in this embodiment of the invention.

[0034] Figure 4 This refers to the detection results of negative samples in this embodiment of the invention.

[0035] Figure 5 This is the detection result of the negative sample in the comparative example of this invention. Detailed Implementation

[0036] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0037] Raw materials used in the examples: Klebsiella pneumoniae (KP, NO. ATCC 51504), Acinetobacter baumannii (Ab, NO. ATCC 19606), Pseudomonas aeruginosa (PA, NO. ATCC 10145), Candida albicans (CA, NO. ATCC 10231DQ), Chlamydia trachomatis (CT, NO. ATCC VR-878), Neisseriagonorrhoeae (NG, NO. ATCC 35541), Ureaplasma urealyticum (UU, NO. ATCC 27816), Staphylococcus aureus (SA, NO. ATCC 25923), Escherichia coli (Escherichia coli) *Clostridium perfringens* (Ec., NO. ATCC 43892), *Neisseria meningitidis* (N. meningitidis, Nm., NO. ATCC 13102), *Streptococcus pneumoniae* (SP., NO. ATCC 49619DQ), *Haemophilus influenzae* (HI., NO. ATCC 51907DQ), *Salmonella enterica* (Se., NO. ATCC 13314), *Mycoplasma pneumoniae* (MP., NO. ATCC 15531), *Bordetella pertussis* (Bp., NO. ATCC 12743), *Enterococcus* (NO. ATCC 14025), *Aspergillus fumigatus* (AF., NO. ATCC 14025). Cryptococcus neoformans (CN, NO. ATCC 32045), Pneumocystis jiroveci (PJ, MYA-5006SD), Neisseria meningitidis (Nm, NO. ATCC 35562), and Moraxella catarrhalis (NO. ATCC 43627) were purchased from the ATCC Collection Center in the United States.

[0038] Example 1 In this embodiment, the rpsD gene of Klebsiella pneumoniae, the recA gene of Acinetobacter baumannii, and the ecfx gene of Pseudomonas aeruginosa were selected as target regions for primer and probe design. All DNA nucleotide sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The relevant sequences with fluorescent group modification and spacer linker blocking modification were purified by HPLC, and other unlabeled DNA nucleic acid chains were purified by ULTRAPAGE.

[0039] The final nucleotide sequences of the primers are shown in Table 1 below.

[0040] Table 1 Primer base sequence listing

[0041] SEQ ID NO.3 has a 5' end labeled with a FAM group and a 3' end labeled with a BHQ1 group; SEQ ID NO.6 has a 5' end labeled with a ROX group and a 3' end labeled with a BHQ2 group; SEQ ID NO.9 has a 5' end labeled with a CY5 group and a 3' end labeled with a BHQ2 group; SEQ ID NO.12 has a 5' end labeled with a VIC group and a 3' end labeled with a BHQ1 group; where / iSpC3 / is a Spacer linker blocking modification.

[0042] Example 2 The only difference from Example 1 is that a spacer linker blocking modification is added between the 5th and 6th bases at the 5' end of primers KP-P1, Ab-P1, and PA-P1.

[0043] Example 3 The only difference from Example 1 is that a spacer linker blocking modification is added between the 9-10 bases at the 5' end of primers KP-P1, Ab-P1, and PA-P1.

[0044] Example 4 The kit components include: PCR amplification solution of primer combination from Example 1 and PCR enzyme solution; The PCR amplification solution contains: 5 μL 5× Buffer, 1.6 μL dNTP (25 mM), and 0.5% DMSO; the PCR enzyme solution contains 1 μL Taq DNA polymerase (1000 U / mL).

[0045] The 5×Buffer consists of Tris-HCl, MgCl2, NaCl, dNTPs The composition of the reaction system is as follows: Primer KP F1: 0.3 μmol; Primer KP R1: 0.3 μmol; Probe KP P1: 0.15 μmol; Primer Ab F1: 0.3 μmol; Primer Ab R1: 0.3 μmol; Probe Ab P1: 0.15 μmol; Primer PA F1: 0.3 μmol; Primer PAR1: 0.3 μmol; Probe PA P1: 0.15 μmol; Primer ICF: 0.3 μmol; Primer ICR: 0.3 μmol; Primer ICP: 0.15 μmol; Tris-HCl: 20mM; MgCl2: 12mM; NaCl: 12.5 mM; dNTPs: 0.8mM.

[0046] Example 5 1. Sputum sample pretreatment: Add 2-3 mL of sputum sample to a 50 mL test tube with a screw cap. Depending on the viscosity of the sputum, add 4 times the volume of sputum digestion solution to the sputum tube. Tighten the screw cap, vortex for 1 minute, and digest at 37°C for 10-15 minutes to fully liquefy the sputum.

[0047] 2. Nucleic acid extraction: Take no more than 200uL of the sample to be tested (adjust according to the kit instructions) and use the Tiangen Bacterial Genomic DNA Extraction Kit (catalog number DP302) to extract DNA from the sample to be tested according to the instructions.

[0048] 3. Reagent preparation: Prepare PCR reaction solution according to the concentration ratio of each material in Example 4.

[0049] 4. Sample addition: Transfer 5 μL / tube of nucleic acid extracted from the sample to be tested, positive control, and negative control to each PCR reaction tube, and centrifuge briefly before use.

[0050] 5. PCR amplification a) Place the PCR reaction tube into the sample slot of the amplification instrument for testing and set the sample name.

[0051] b) Instrument fluorescence channel selection: Select the FAM channel to detect the rpsD gene of Klebsiella pneumoniae; select the VIC / HEX channel to detect the internal control; select the ROX channel to detect the recA gene of Acinetobacter baumannii; select the CY5 channel to detect the ecfx gene of Pseudomonas aeruginosa.

[0052] Table 2 PCR amplification conditions settings

[0053] c) After setting up, press the "Run" button to start the test.

[0054] 7. Quality Control: Positive control samples: FAM, ROX, CY5 and IC (internal standard) channels: Ct≤40; Negative control samples: FAM, ROX, and CY5 channels have no Ct value; VIC (internal standard) channel Ct < 40. All of the above requirements must be met simultaneously in an experiment. Otherwise, the experiment is considered invalid and needs to be retested.

[0055] 8. Result determination: The FAM channel detection showed a clear amplification curve, and the detection Ct value was ≤40, indicating a positive result for Klebsiella pneumoniae. The ROX channel showed a clear amplification curve, and the detection Ct value was ≤40, indicating a positive result for Acinetobacter baumannii. The CY5 channel showed a clear amplification curve, and the detection Ct value was ≤40, indicating a positive result for Pseudomonas aeruginosa. If no obvious amplification curve or no value is detected in the FAM, ROX, and CY5 channels, and an obvious amplification curve is detected in the VIC (internal standard) channel with a Ct value ≤40, then Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa are considered negative or the concentration is below the detection limit of the kit. If no significant amplification curve or numerical value is found in the FAM, ROX, and CY5 channels, or if no significant amplification curve is found in the VIC (internal standard) channel or if the Ct value is >40, the test is invalid. It is recommended that the clinician resample and repeat the test. The specific result interpretation criteria are shown in Table 3.

[0056] Table 3 Criteria for Judging Test Results

[0057] Example 6 The only difference from Example 4 is that the final concentration of primers in the reaction system is replaced with 0.24 μmol.

[0058] Example 7 The only difference from Example 4 is that the final concentration of primers in the reaction system is replaced with 0.36 μmol.

[0059] Example 8 The only difference from Example 6 is that the final concentration of the probe in the reaction system is replaced with 0.12 μmol.

[0060] Example 9 The only difference from Example 6 is that the final concentration of the probe in the reaction system is replaced with 0.18 μmol.

[0061] Example 10 The only difference from Example 8 is that 0.5% of DMSO in the reaction system is replaced with 3% Betaine.

[0062] Example 11 The only difference from Example 8 is that 0.5% of DMSO in the reaction system is replaced with 3% Hepes.

[0063] Comparative Example 1 The only difference from Example 1 is that primers KP-P1, Ab-P1, and PA-P1 are not modified with spacer linker blocking.

[0064] Comparative Example 2 The following candidate primers were designed for this comparative example (all sequences are 5' to 3'): The specific primer combinations for Klebsiella pneumoniae (KP) are as follows: The KP F2 primer sequence is: CTGATTCATGTTATTCATCCT, as shown in SEQ NO.13; The KP R2 primer sequence is: TTGAAGCGGATTTCTCACAAAG, as shown in SEQ NO.14; The KP P2 probe sequence is: A / iSpC3 / CGTTCCCTACCGCTTTATCTT, as shown in SEQ NO.15; The specific primer combinations for Acinetobacter baumannii (Ab) are as follows: The Ab F2 primer sequence is: CTAAAGCAGAAATCGAA, as shown in SEQ NO.16; The Ab R2 primer sequence is: AACCATACAGTTTGAACGT, as shown in SEQ NO.17; The Ab P2 probe sequence is: C / iSpC3 / ACGTCTTATGAGCCAGGCAC, as shown in SEQ NO.18; The specific primer combinations for Pseudomonas aeruginosa (PA) are as follows: The Ab F2 primer sequence is: AAGGTAAGGAAGTGCGACGGA, as shown in SEQ NO.19; The Ab R2 primer sequence is: GAACGCATTTCCCAGTC, as shown in SEQ NO.20; The Ab P2 probe sequence is: C / iSpC3 / AGGTAGTCCTCCCAGTCGTCCT, as shown in SEQ NO.21; The final concentration of each candidate primer was 0.3 μmol, and the final concentration of each probe was 0.15 μmol; the other components and concentrations in the reaction system were the same as in Example 4. SEQ ID NO.15 has a 5' end labeled with a FAM group and a 3' end labeled with a BHQ1 group; SEQ ID NO.18 has a 5' end labeled with a ROX group and a 3' end labeled with a BHQ2 group; SEQ ID NO.21 has a 5' end labeled with a CY5 group and a 3' end labeled with a BHQ2 group; where / iSpC3 / is a Spacer linker blocking modification.

[0065] Test Example 1: Comparison of different primer sets Primer combinations (nucleotide sequences and modification methods) are key factors affecting the detection capability of nucleic acid detection platforms. High specificity and sensitivity are required in the primer combinations used, making optimal primer combinations particularly important. The primers used in Examples 1-3 and Comparative Examples 1 and 2 are compared.

[0066] The standard strains of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, as well as negative samples, were used as test substances for detection. The results are shown in Tables 4-6.

[0067] Table 4. Detection results of different primer sets for Klebsiella pneumoniae

[0068] Table 5. Detection results of Acinetobacter baumannii using different primer sets

[0069] Table 6. Detection results of Pseudomonas aeruginosa using different primer sets.

[0070] Using the Klebsiella pneumoniae primers and probes (SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3), Acinetobacter baumannii (SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6), and Pseudomonas aeruginosa (SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9) designed in this invention, different concentrations of Klebsiella pneumoniae (51504), Acinetobacter baumannii (19606), and Pseudomonas aeruginosa (10145) were detected. According to the results in Tables 4 / 5 / 6, the kit demonstrates high sensitivity in detecting Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, and the results are as expected. Based on the above table and... Figure 4 , 5 The results showed that primer combinations without spacer linker blocking modification exhibited a certain degree of non-specific amplification in the detection of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, failing to meet normal detection requirements. The primer combinations with spacer linker blocking modification, specially designed in this invention, showed no Ct values ​​in negative samples, and the sensitivity to the detection targets remained unaffected, consistent with primer combinations without spacer linker modification. This indicates that the composition of this invention can accurately identify Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa with good specificity.

[0071] Test Example 2: Comparison of different primer concentrations Given that the concentration of primers and probes in the reaction system has a significant impact on the detection sensitivity, a comparative experiment was conducted on the primer set of the present invention with different concentrations in order to obtain the optimal reaction concentration. The primer concentrations were adjusted based on Example 4, as shown in Table 7 below.

[0072] Table 7 Experimental groups with different primer concentrations

[0073] In summary, the above combination of standard strains of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, as well as negative samples, were used as analytes for detection. The detection method was the same as in Example 5, and the results are shown in Tables 8-10: Table 8. Detection results of Klebsiella pneumoniae with different primer concentration combinations.

[0074] Table 9. Detection results of Acinetobacter baumannii with different primer concentration combinations

[0075] Table 10. Detection results of Pseudomonas aeruginosa with different primer concentration combinations.

[0076] Tables 8-10 show that when the primer concentration in the reaction system is too high, it will inhibit the amplification efficiency of Klebsiella pneumoniae, Acinetobacter baumannii and Pseudomonas aeruginosa. Therefore, based on the multiple reaction inhibition and the primer's own reaction efficiency, the primer concentration was selected as 0.24 μmol and the probe concentration as 0.12 μmol.

[0077] Test Example 3: Comparison of Different Anti-interference Inhibitors Considering the rapid lysis of nucleic acid release agents, some impurities in the extraction reagents could affect the detection results. To further enhance the anti-interference ability of the reaction system, some enhancers were artificially added, such as 0.1%-1% DMSO, 1%-5% Betaine, and 1%-5% Hepes, and two low-to-medium concentration culture samples were tested. The results showed that adding 3% Betaine had the best effect, providing stronger anti-interference ability without affecting PCR amplification efficiency.

[0078] Table 11 Detection results of different anti-interference inhibitors

[0079] The optimal reaction system in this test case is: The PCR amplification solution contains: 5 μL 5× Buffer, 1.6 μL dNTP (25 mM), and 3% Betaine; the PCR enzyme solution contains 1 μL Taq DNA polymerase (1000 U / mL).

[0080] 5×Buffer consists of Tris-HCl, MgCl2, NaCl, dNTPs The composition of the reaction system is as follows: Primer KP F1: 0.24 μmol; Primer KP R1: 0.24 μmol; Probe KP P1: 0.12 μmol; Primer Ab F1: 0.24 μmol; Primer Ab R1: 0.24 μmol; Probe Ab P1: 0.12 μmol; Primer PA F1: 0.24 μmol; Primer PAR1: 0.24 μmol; Probe PA P1: 0.12 μmol; Primer ICF: 0.24 μmol; Primer ICR: 0.24 μmol; Primer ICP: 0.12 μmol; Tris-HCl: 20mM; MgCl2: 12mM; NaCl: 12.5 mM; dNTPs: 0.8mM.

[0081] Test Example 4: Specificity Test of the Reagent Kit The following bacteria were selected from the American Type Culture Collection (ATCC): Klebsiella pneumoniae (KP, NO. ATCC 51504), Acinetobacter baumannii (Ab, NO. ATCC 19606), Pseudomonas aeruginosa (PA, NO. ATCC 10145), Candida albicans (CA, NO. ATCC 10231DQ), Chlamydia trachomatis (CT, NO. ATCC VR-878), Neisseria gonorrhoeae (NG, NO. ATCC 35541), Ureaplasma urealyticum (UU, NO. ATCC 27816), and Staphylococcus aureus. *Aspergillus aureus*, SA, NO. ATCC 25923; *Escherichia coli*, Ec, NO. ATCC 43892; *Neisseria meningitidis*, Nm, NO. ATCC 13102; *Streptococcus pneumoniae*, SP, NO. ATCC 49619DQ; *Haemophilus influenzae*, HI, NO. ATCC 51907DQ; *Salmonella enterica*, Se, NO. ATCC 13314; *Mycoplasma pneumoniae*, MP, NO. ATCC 15531; *Bordetella pertussis*, Bp, NO. ATCC 12743; *Enterococcus*, NO. ATCC 14025; *Aspergillus fumigatus*, AF, NO. ATCC Cryptococcus neoformans (CN, NO. ATCC 32045), Pneumocystis jiroveci (PJ, MYA-5006SD), Neisseria meningitidis (Nm, NO. ATCC 35562), and Moraxella catarrhalis (NO. 1022DQ).The kit (ATCC 43627) was used to specifically test 21 pathogens that are homologous to and cause similar or identical clinical symptoms as Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. The detection was performed according to the method in Example 4. The results are shown in Table 12. Of the 21 samples, only Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa were positive; the rest were negative. This demonstrates that the combination of the present invention can eliminate interference from different pathogens and accurately detect Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa.

[0082] Table 12 Results of Cross-Reactivity Sample Detection

[0083] As can be seen from the test results in Table 12, the cross-reactivity specificity for the 21 pathogens was negative after testing with the three batches of test reagents of this invention, and no false positive results were found.

[0084] Test Example 5: Reagent Kit Detection Sensitivity Test The primers and probes shown in Example 1 were used to screen and detect standard strains from the American Type Culture Collection (ATCC) by serial dilution to 10 copies / μL, 5 copies / μL, 2 copies / μL, 1 copy / μL, 0.5 copies / μL, and 0.25 copies / μL, following the method described in Example 4.

[0085] The Klebsiella pneumoniae KP primer-probe combination (SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3), Acinetobacter baumannii Ab primer-probe combination (SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6), and Pseudomonas aeruginosa PA primer-probe combination (SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9) designed in this invention were used to detect serially diluted Klebsiella pneumoniae (51504), Acinetobacter baumannii (19606), and Pseudomonas aeruginosa (10145). Each gradient was tested 10 times (number of positives / total number of tests), and the results were recorded. The detection limit was the sample concentration at which all samples were detected. The specific detection results are shown in Table 13.

[0086] Table 13 Statistical Analysis of Sensitivity Detection Results

[0087] The results show that the detection rates of samples with concentrations of 10 copies / μL, 5 copies / μL, 2 copies / μL, 1 copies / μL, and 0.5 copies / μL were all ≥100%, while the detection rate of samples with a concentration of 0.25 copies / μL was less than 95%. This indicates that the detection limit of the combined reagent of this invention for Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa is 0.5 copies / μL, which is higher than the detection limit of 10 copies / μL for similar reagent kits on the market, and can be used for nucleic acid detection of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa.

[0088] Test Example 6 Repeatability Verification The primers shown in Example 1 were used to validate and detect standard strains of Klebsiella pneumoniae (KP, NO. ATCC 51504), Acinetobacter baumannii (Ab, NO. ATCC 19606), and Pseudomonas aeruginosa (PA, NO. ATCC 10145) and negative samples from the American Type Culture Collection (ATCC) according to the method described in Example 5. The standard strains were diluted to 5 copies / μL, and each test was repeated 10 times. The results are shown in Table 14, and the amplification patterns are as follows. Figures 1-3 As shown.

[0089] Table 14 Repeatability Test Results

[0090] The results in summary show that the coefficient of variation (CV) for the combined detection of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa of the present invention is less than 2%, indicating excellent detection repeatability.

[0091] Comparative Example 3 The primer and probe combination of this application was compared and evaluated with commercially available products in terms of PCR reaction time and detection limit. The application is simple and convenient, and the PCR reaction time is only 30 minutes, significantly reducing patient waiting time. This provides a powerful tool for detecting bacterial infections caused by Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. Finally, the accuracy, repeatability, and specificity of this invention and commercially available products were evaluated using low-to-medium concentrations of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa reference samples and cross-samples. The detection results are shown in Table 15.

[0092] Table 15 Comparison of repeatability and specificity of the combined and comparative kits of the present invention

[0093] Table 16. Sensitivity Comparison of the Combined and Comparative Reagent Kits of the Present Invention

[0094] As shown in Table 15, when the template concentration is 20 copies / μL, the Ct value of the primer and probe combination of this application is smaller than that of commercially available products. The coefficients of variation (CV) for precision of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa are all less than 2.0%, indicating excellent repeatability. As shown in Table 16, when the template concentration is 0.5 copies / μL, the primer and probe combination of this application can effectively detect the bacteria, but the detection rate of commercially available products is less than 30%. Therefore, the primer and probe combination of this invention can effectively avoid missed detection when detecting low-concentration samples.

[0095] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A composition for detecting Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, characterized in that, The composition comprises three sets of primers and probes; The first set of primers and probes is used for the specific detection of Klebsiella pneumoniae, including a first forward primer, a first reverse primer and a first probe. The sequence of the first forward primer is shown in SEQ ID NO.1, the sequence of the first reverse primer is shown in SEQ ID NO.2, and the sequence of the first probe is shown in SEQ ID NO.

3. The second set of primers and probes is used to detect Acinetobacter baumannii, including a second forward primer, a second reverse primer, and a second probe. The sequence of the second forward primer is shown in SEQ ID NO.4, the sequence of the second reverse primer is shown in SEQ ID NO.5, and the sequence of the second probe is shown in SEQ ID NO.

6. The third set of primers and probes is used to detect Pseudomonas aeruginosa, including a third forward primer, a third reverse primer, and a third probe. The sequence of the third forward primer is shown in SEQ ID NO.7, the sequence of the third reverse primer is shown in SEQ ID NO.8, and the sequence of the third probe is shown in SEQ ID NO.

9.

2. The composition according to claim 1, characterized in that, The first, second, and third probes are all labeled with fluorescent reporter groups at their 5' ends and fluorescent quencher groups at their 3' ends; The first, second, and third probes are modified with Spacer linker blocking.

3. The composition according to claim 1 or 2, characterized in that, Spacer linker blocking modification is added between 1-2 bases at the 5' end of the first, second, and third probes.

4. A kit for simultaneous detection of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa, characterized in that, The kit includes the composition according to any one of claims 1 to 3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes a fourth set of primers and probes for amplifying the internal standard. The fourth set of probes includes a fourth forward primer, a fourth reverse primer, and a fourth probe. The sequence of the fourth forward primer is shown in SEQ ID NO.10, the sequence of the fourth reverse primer is shown in SEQ ID NO.11, and the sequence of the fourth probe is shown in SEQ ID NO.

12.

6. The reagent kit according to claim 5, characterized in that, The fourth probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

7. The reagent kit according to any one of claims 4 to 6, characterized in that, The kit also includes a PCR reaction solution, which further includes PCR buffer and Taq DNA polymerase.

8. The reagent kit according to claim 7, characterized in that, The PCR buffer consisted of 5-20 mM Tris-HCl, 5-15 mM MgCl2, 20-50 mM NaCl, and 15-25 mM... dNTPs ; The concentration of the Taq DNA polymerase is 1U to 3U.

9. The kit according to claim 4 or 5, characterized in that, The kit also includes 0.1%-1% DMSO, 1%-5% Betaine, and 1%-5% Hepes.

10. The reagent kit according to claim 5, characterized in that, The kit also includes a positive control and a negative control; Positive controls included pUC57 plasmid containing the synthetic Klebsiella pneumoniae rpsD gene sequence at a concentration of 1×10⁻⁶. 3 ~1×10 6 pUC57 plasmid containing the artificially synthesized Acinetobacter baumannii recA gene sequence at a concentration of 1×10⁻¹mL. 3 ~1×10 6 The pUC57 plasmid containing the artificially synthesized *Pseudomonas aeruginosa* ecfx gene sequence, at a concentration of 1×10⁻¹mL, contains copies / mL of 1×10⁻¹⁰. 3 ~1×10 6 The sample contained copies / mL of pUC57 plasmid with a synthetic GAPDH gene sequence at a concentration of 1×10⁻⁶. 3 ~1×10 5 copies / mL; The negative control was a pUC57 plasmid containing a synthetic GAPDH gene sequence at a concentration of 1×10⁻⁶. 3 ~1×10 5 copies / mL.

11. A method for simultaneously detecting Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa for non-disease diagnostic purposes, characterized in that, The method involves using the kit described in any one of claims 4 to 10 to detect Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa via PCR reaction.

12. The method according to claim 11, characterized in that, The final concentration of primers in the PCR reaction solution was 0.3 μM, and the final concentration of probes was 0.15 μM. The PCR reaction program was as follows: pre-denaturation at 95 °C for 1 min, followed by denaturation at 95 °C for 1 s, annealing at 60 °C for 20 s, for 45 cycles, and fluorescence was collected.

13. The use of the composition according to claims 1 to 3 or the kit according to any one of claims 4 to 10 in the in vitro simultaneous detection of Klebsiella pneumoniae, Acinetobacter baumannii and / or Pseudomonas aeruginosa.

Images