Primer probe combination for detecting porcine parvovirus type 8 and application of primer probe combination

By designing a highly specific Taq Man fluorescent quantitative PCR primer-probe combination, the sensitivity and cross-reactivity issues of PPV8 detection were resolved, achieving efficient and accurate PPV8 detection and meeting the quality control requirements of biopharmaceutical production.

CN121160918APending Publication Date: 2025-12-19CANVEST WUHAN BIOTECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410785137.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-06-18
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the effective detection and control of the novel porcine parvovirus type 8 (PPV8), and common detection methods exhibit cross-reactivity with other porcine parvovirus subtypes, resulting in insufficient sensitivity and failing to meet the quality control requirements for biopharmaceutical production.

Method used

A primer-probe combo based on TaqMan real-time PCR technology was designed, including forward primers, reverse primers, and detection probes. It has high specificity, can specifically detect PPV8, and has no cross-reactivity with other porcine parvovirus subtypes. It also has high sensitivity, capable of detecting 100 copies/reaction.

Benefits of technology

It enables rapid and accurate detection of PPV8 contamination, is highly durable, and can effectively identify PPV8 in complex matrices, meeting the quality control requirements for biopharmaceutical production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121160918A_ABST
    Figure CN121160918A_ABST
Patent Text Reader

Abstract

The invention discloses a primer probe combination for detecting porcine parvovirus type 8 and application of the primer probe combination, and relates to the technical field of porcine parvovirus detection. The primer probe combination comprises a forward primer, a reverse primer and a detection probe, the nucleotide sequence of the forward primer is as shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the detection probe is as shown in SEQ ID NO.3. The primer probe combination disclosed by the invention is high in specificity when being used for detecting PPV8, and has no cross reaction with a non-PPV8 genome; the sensitivity is high, and the detection limit of a PPV8 plasmid standard substance is 100 copies / reaction (5copies / microliter); the durability and matrix interference resistance are high, and detection can also be performed after a 293T / CHO / Vero cell genome is introduced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of porcine parvovirus detection, in particular to a primer probe combination for detecting porcine parvovirus type 8. BACKGROUND

[0002] Porcine parvovirus (PPV) is a small non-enveloped virus, and the virus genome is a single-stranded DNA molecule. PPV has strong resistance to high temperature and is very stable at 40 DEG C. PPV cannot be inactivated by dry heat for a short time at 90 DEG C. PPV has strong resistance to acid and alkali. 0.05% quaternary ammonium salt, 2500 ug / L sodium hypochlorite and other disinfectants cannot inactivate PPV. High-concentration sodium hypochlorite, acetaldehyde, 7.5% hydrogen peroxide and other disinfectants can kill PPV. Even if inactivated vaccine is inoculated, more than 80% of pig farms can still monitor the existence of PPV. The main replication of PPV occurs in lymphoid tissues and can be distributed throughout the body through viremia. Infection with porcine parvovirus can cause the occurrence of porcine reproductive disorder disease, resulting in abortion of sows, production of abnormal fetuses or stillbirths and the like.

[0003] According to the homology of the NS1 gene encoding protein, porcine parvovirus is divided into seven subtypes, namely PPV1-7. In 2021, a new type of porcine parvovirus, porcine parvovirus type 8 (PPV8), was identified in Guangdong Province, China. At present, it is classified as a protoparvovirus of the parvovirus family, and has 16.23-44.18% homology with porcine parvovirus 1-7 subtypes, and has the relatively highest homology with PPV1. At present, the pathogenesis and disease caused by PPV8 are not reported, but PPV8 is more detected in Asian pig-derived clinical samples. The emergence of the new genotype brings great challenges to the prevention and control of porcine parvovirus disease and has potential threats to the breeding farm. At the same time, pancreatin is widely used in cell culture and biological product production processes. The current edition of the Chinese Pharmacopoeia (Volume III) “Animal cell substrate for biological product production test preparation and quality control” clearly states that if pancreatin is used in the establishment or passage of the cell substrate, the established MCB / WCB / production terminal cell should be detected for porcine viruses. Real-time fluorescent quantitative PCR (TaqMan probe method) has the advantages of strong specificity, high sensitivity and good repeatability, and is widely used for virus detection. Therefore, it is of great significance to develop a PCR system that can specifically and sensitively detect PPV8 for the disease prevention and control of pigs and the safety quality control of biological products. SUMMARY

[0004] The application provides a primer probe combination for detecting porcine parvovirus type 8 and application thereof, the primer probe combination is based on Taq Man fluorescent quantitative PCR technology, can quickly and accurately determine whether the sample is contaminated by porcine parvovirus type 8, makes up the detection blank of the new subtype of porcine parvovirus; and the specificity is strong, and there is no cross reaction with other common cell products of non-PPV8 genome; the detection sensitivity is high, and the durability and the anti-matrix interference ability are strong. The technical scheme of the application can be specifically realized by the following technologies.

[0005] The first aspect of the technical scheme of the application provides a primer probe combination for detecting porcine parvovirus type 8, which comprises a forward primer, a reverse primer and a detection probe, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 1, the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 3.

[0006] The second aspect of the technical scheme of the application provides a system for detecting porcine parvovirus type 8, which comprises a forward primer shown as SEQ ID NO. 1, a reverse primer shown as SEQ ID NO. 2 and a detection probe shown as SEQ ID NO. 3.

[0007] Further, the system further comprises a PPV8 standard plasmid, a PPV8 pseudovirus, a basic buffer and RNase-free water.

[0008] The third aspect of the technical scheme of the application provides a product for detecting porcine parvovirus type 8, which comprises the primer probe combination or the system.

[0009] Further, the product is a detection kit, a detection test strip or a detection chip.

[0010] The fourth aspect of the technical scheme of the application provides a method for detecting porcine parvovirus type 8, which is not for the purpose of disease diagnosis and treatment, and adopts the primer probe, the system or the product.

[0011] It should be noted that the claimed "not for the purpose of disease diagnosis and treatment" of the application refers to the detection of the virus condition of porcine parvovirus type 8 in non-animal bodies, including but not limited to the pollution of porcine parvovirus type 8 in air, water, soil, biological products, article / instrument surface, waste liquid, laboratory and other environments / scenes. That is, as long as it is not directly used for diagnosing or treating diseases / symptoms related to porcine parvovirus type 8 in human or animal bodies, the above technical means provided by the application can be used.

[0012] Of course, the technical means of the present application can also be considered for diagnosing or treating diseases / symptoms associated with porcine parvovirus type 8 in human or animal bodies.

[0013] Further, the method for detecting porcine parvovirus type 8 comprises the following steps: Prepare a sample to be tested, a positive control (PC), a suitability control, a sensitivity control, a no template control (NTC), and a negative control (NCS); Extract DNA from the sample to be tested, the negative control, the positive control, and the suitability control; then perform qPCR detection on the DNA of the sample to be tested, the positive control, the suitability control, the sensitivity control, the no template control, and the negative control, respectively; Determine the effectiveness of the test and the detection result according to the qPCR reaction amplification curve and the Ct value; The method for determining the effectiveness of the test is that: the no template control has no Ct value and no obvious amplification curve; the sensitivity control has an obvious amplification curve and a Ct value ≤ 38; the negative control has no Ct value and no obvious amplification curve; the positive control has an obvious amplification curve and a Ct value ≤ 35; and the suitability control has an obvious amplification curve, and if the Ct value is larger, the difference with the Ct value of the positive control is not more than 3 cycles; then it is determined that the test is effective.

[0014] That is, the detection results of the no template control, the sensitivity control, the negative control, the positive control, and the suitability control must simultaneously meet the above requirements to determine that the test is effective. If any one does not meet the requirement, it is determined that the test is invalid.

[0015] The method for determining the detection result is that: when the Ct value is ≤ 38 and there is an obvious amplification curve, it is determined that the detection result is positive; when the Ct value is > 38 and there is an obvious amplification curve, it is determined that the detection result is invalid; and when there is no Ct value and no obvious amplification curve, it is determined that the detection result is negative.

[0016] It should be noted that the preparation of the positive control (PC), the suitability control, the sensitivity control, the no template control (NTC), and the negative control (NCS) provided by the present application can be obtained by using methods known in the art.

[0017] In some embodiments of the present application: (1) Positive control: take 200 μL of PPV8 pseudovirus diluted to 10 3 PFU / mL with PBS; (2) Suitability control: add the same PPV8 pseudovirus virus liquid as the positive control to the sample to be tested; (3) Negative control: take 200 μL of PBS as the negative control; (4) No template control: RNase-free water; (5) Sensitivity control: 100 copies / reaction of PPV8 plasmid standard.

[0018] It should be further pointed out that the PBS, RNase-free water and the like are commercially available and commonly used reagents in the art.

[0019] It should be further pointed out that the PPV8 pseudovirus selected in the positive control and the suitability control can be synthesized by a known method or entrusted to a third party for synthesis.

[0020] It should be further pointed out that the PPV8 plasmid standard selected in the sensitivity control is a recombinant plasmid, which can be obtained by recombination on a basic plasmid according to the target fragment shown in SEQ ID NO. 4.

[0021] It should be known to those skilled in the art that the basic plasmid can be selected from the commonly used plasmids disclosed in the existing patents or documents or commercially available. It should also be known to those skilled in the art that a more suitable basic plasmid can be further selected for use in the present application according to the characteristics of the commonly used plasmids at present.

[0022] Compared with the prior art, the present application has the following advantages: 1. The primer probe combination provided by the present application is used for Taq Man fluorescent quantitative PCR, and whether the sample is contaminated with porcine parvovirus 8 can be quickly judged according to the CT value and the fluorescent signal, which fills the detection blank of the new subtype of porcine parvovirus.

[0023] 2. The primer probe combination of the present application has strong specificity and has no cross reaction with the genomes of PK-15 / 293T / CHO / Vero cells, porcine circovirus PCV-2, porcine parvovirus 1-7 subtypes and the like; the sensitivity is high, the detection limit of the PPV8 plasmid standard is 100 copies / reaction (5 copies / μl); the durability and the anti-matrix interference ability are strong, and the 293T / CHO / Vero cell genome can also be detected after being introduced. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 The detection results of the primer probe with different concentration gradients of the standard plasmid for sensitivity detection; Figure 2 The standard curve of the Taq Man fluorescent quantitative PCR of PPV8 drawn by the primer probe with different concentration gradients of the standard plasmid; Figure 3 and 4The specificity verification results of the primer probe in qPCR with human, pig, monkey, hamster cell, PPV1-7 subtype and PCV-2 virus full-length plasmid as templates; Figure 5 The durability detection results of the primer probe; Figure 6 The detection results of the primer probe of the application in the detection of PPV8 pollution in 293T cells in practical application. DETAILED DESCRIPTION

[0025] The technical solutions of the application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the application, but not all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the application.

[0026] The terms provided by the application are defined as known or well-known by those skilled in the art.

[0027] The term "detection" means testing or detecting whether a substance or material exists, such as, but not limited to, a chemical substance, an organic compound, an inorganic compound, a metabolic product, a drug or a drug metabolite, an organic tissue or a metabolite of an organic tissue, a nucleic acid, a protein or a polymer. In addition, detection means testing the quantity of a substance or material. Further, testing also means immunological detection, chemical detection, enzyme detection, etc.

[0028] The term "sample (i.e. sample to be detected)" means that the sample that can be detected by the detection reagent or method of the application includes biological liquid (e.g. case liquid or clinical sample). The liquid sample or fluid sample can be derived from solid or semi-solid sample, including excretion, biological tissue and food sample. The solid or semi-solid sample can be converted into liquid sample by any appropriate method, such as mixing, crushing, macerating, incubating, dissolving or digesting the solid sample in a suitable solution (e.g. water, PBS or other buffer) by enzymatic digestion.

[0029] The term "biological sample" includes samples derived from animals, plants and food samples, such as including urine, saliva, blood and its components, spinal fluid, vaginal secretion, sperm, feces, sweat, secretion, tissue, organ, tumor, tissue and organ culture, cell culture and medium derived from human or animal. Preferably, the biological sample is urine or swab. The food sample includes food processing material, final product, meat, cheese, wine, milk and drinking water.

[0030] The term "plant sample" includes samples derived from any plant, plant tissue, plant cell culture and medium.

[0031] The term "environmental sample" is derived from the environment (e.g., a liquid sample from a lake or other body of water, a sewage sample, a soil sample, ground water, sea water, and a waste fluid sample). Any analyte can be detected using the present application and a suitable detection element.

[0032] The terms "nucleic acid," "oligonucleotide," and "polynucleotide" are used interchangeably and refer to single- and / or double-stranded polymers of nucleotide monomers, including, but not limited to, 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) that are linked by internucleotide phosphodiester bonds or analogs thereof. The nucleotide monomers in a nucleic acid can be referred to as "nucleotide residues." A nucleic acid can consist of deoxyribonucleotides exclusively, ribonucleotides exclusively, or a chimeric mixture thereof, and can include nucleotide analogs. The nucleotide monomer units can comprise any of the nucleotides described herein, including, but not limited to, nucleotides and / or nucleotide analogs. Nucleic acids can vary in size from a few nucleotide residues to several thousand nucleotide residues. "Oligonucleotide" generally refers to a relatively short nucleotide polymer, e.g., 1-80, among others. Whenever a nucleic acid sequence is presented herein, it will be understood that the nucleotides are presented in 5' to 3' order, unless otherwise indicated. Unless otherwise indicated, "A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes deoxyguanosine, "T" denotes deoxythymidine, and "U" denotes deoxyuridine, unless otherwise indicated.

[0033] The length of a nucleic acid can be expressed in terms of base, base pairs (abbreviated "bp"), nucleotides / nucleotide residues (abbreviated "nt"), or kilobases ("kb"), according to the conventions of the art. The terms "base," "nucleotide," "nucleotide residue" can describe a polynucleotide that is single-stranded or double-stranded, as the context permits. When the term is applied to a double-stranded molecule, it is used to refer to the entire length, and is understood to be equivalent to the term "base pairs."

[0034] The term "primer" and variants thereof generally refer to an oligonucleotide that serves as a point of initiation for DNA synthesis in a PCR reaction. Primers are typically about 15 to about 35 nucleotides in length and hybridize to a region of complementarity to a target sequence.

[0035] The term "forward primer" refers to an oligonucleotide that anneals to a particular strand of a target DNA, which particular strand is typically the antisense strand. The term "reverse primer" refers to an oligonucleotide that anneals to the opposite strand of a target DNA, which opposite strand is typically the sense strand. It will be understood that the corresponding forward and reverse primer designations can be interchanged when the designation of the sense and antisense strands is interchanged.

[0036] The term "probe" and variants thereof (e.g., detection probe) refer to an oligonucleotide that hybridizes to a target nucleic acid in a PCR reaction.

[0037] The terms "target sequence," "target nucleic acid," or "target" are used interchangeably and mean a portion of a nucleic acid sequence to be amplified, detected, or both, which can anneal or hybridize to a probe or primer under hybridization, annealing, or amplification conditions. The term "hybridization" refers to the base pairing interaction between two nucleic acids that results in the formation of a duplex. Hybridization is not required to be 100% complementary over the entire length of the two nucleic acids to occur.

[0038] It should be noted that the "not for the purpose of disease diagnosis and treatment" claimed by the present application refers to the detection of the virus condition of porcine parvovirus type 8 in non-animal bodies, including but not limited to the contamination of porcine parvovirus type 8 in the environment / scenes such as air, water, soil, biological products, surface of articles / instruments, waste liquid, laboratory, etc. That is, as long as it is not directly used for diagnosing or treating diseases / symptoms related to porcine parvovirus type 8 in human or animal bodies, the above technical means provided by the present application can be used.

[0039] Of course, the technical means of the present application can also be considered for diagnosing or treating diseases / symptoms related to porcine parvovirus type 8 in human or animal bodies.

[0040] The reagents and instruments used in the following specific embodiments, if not specially specified, can be purchased through conventional channels. If not specially specified, the reagents or reaction raw materials used are the initial concentrations of each raw material in the purchased commercial products.

[0041] The skilled in the art should know that, unless otherwise specified, the reagents (such as qPCR reaction solution, reagents of nucleic acid extraction system, buffers, etc.), kits and technical solutions used in the following examples are all completed by using commercially available reagents, kits and conventional molecular biology technical operations in the industry.

[0042] Example 1: Design and synthesis of primers, probes, PPV8 plasmid standard and detection system.

[0043] 1. Design and synthesis of primer probe combination According to the PPV8 gene sequence queried by NCBI, a primer probe capable of specifically detecting PPV8 was designed, which contained one forward primer, one reverse primer and one probe. The primers were custom synthesized by Tianyi Hui (PAGE purification), and the probe was custom ordered by Shengong Biology (HPLC purification). The sequences are shown in Table 1.

[0044] Table 1 PPV8 primer and probe

[0045] 2. Construction of PPV8 plasmid standard and detection system According to the target fragment to be amplified, a standard sample was prepared by constructing a synthetic recombinant plasmid pUC57-PPV8 from Shanghai Biotech Co., Ltd. The plasmid standard sample was added to the PPV8-qPCR detection system as a template.

[0046] The nucleotide sequence of the target fragment is shown in SEQ ID NO. 4, specifically: tccctgagcacacaaaaccaatccaacaaagatgcatattcatcaatctctttcaccaactaccacctgactttggtttattggcgccaaatgaaattggcgggct.

[0047] The reaction system and reaction procedure in Tables 2 and 3 were optimized, and the linearity and sensitivity of the PPV8-qPCR reaction were optimal.

[0048] Table 2 qPCR amplification system

[0049]

[0050] Table 3 qPCR reaction procedure

[0051] Example 2: verification of detection sensitivity, specificity, and durability.

[0052] 1. Plasmid sensitivity and standard curve of PPV8-qPCR detection system The synthesized recombinant plasmid pUC57-PPV8 was extracted using the Plasmid Mini Kit I from OMEGA, and the recombinant plasmid concentration (ng / μl) and OD 260nm / OD 280nm value were determined using a UV spectrophotometer to determine the quality of the extracted plasmid.

[0053] The plasmid copy number was calculated according to the formula (plasmid concentration ng / μl x 6.02 x 10 23 ) / (10 9 x genome length x 660 Da / bp). The extracted plasmid template was diluted by 10 times in gradient. Six dilution gradients 10 2 -10 7 copies / reaction standard plasmid were taken as templates to establish a standard curve for the Taq Man fluorescent quantitative PCR detection method of PPV8.

[0054] Plasmid standard solution at 100 copies / reaction was used as plasmid sensitivity control. qPCR was performed using the amplification system and reaction procedure in Table 2-3. Three independent repeated experiments were performed on different days, and the plasmid sensitivity control was repeated 8 wells each time.

[0055] The experimental results are shown in Figure 1 and Figure 2 The standard curve Ct value and standard plasmid concentration showed a good linear relationship, with a correlation coefficient R 2 ≥ 0.99; PPV8 plasmid standard could be stably detected, and the sensitivity reached 100 copies / reaction, i.e. 5 copies / μl, with a detection rate of 100% (24 / 24).

[0056] 2. Specificity verification (1) Human and animal cell genomic DNA Porcine kidney cells PK-15, African green monkey kidney cells Vero, Chinese hamster ovary cells CHO-K1, human embryonic kidney cells 293 and 293T were preserved by the company, and genomic DNA was extracted using QIAamp Mini kit (50) (QIAGEN, 51304).

[0057] (2) Viral full-length plasmid genomic DNA Porcine circovirus type 2 (PCV-2) and porcine parvovirus type 1-7 (PPV1-7) viral full-length plasmids were preserved by the company, and genomic DNA was extracted using Plasmid Mini Kit I (OMEGA, D6943-02).

[0058] After extraction, the concentration of the above extracted cell and viral plasmid standard genomic DNA was measured using a microspectrophotometer; according to the measured concentration, the cell genomic DNA was diluted to 20 ng / μl as a template for qPCR. The extracted DNA of porcine viral full-length plasmid was diluted to 10 6 copies / reaction as a template for qPCR.

[0059] The pUC57-PPV8 recombinant plasmid was extracted, and after measuring the concentration, it was diluted to 100 copies / reaction as a positive control, and the reaction system and procedure were consistent with Table 2 and Table 3.

[0060] The results are shown in Figure 3 and Figure 4 The primers and probes in the PPV8-qPCR detection system had no cross-reaction with human, porcine, monkey, hamster cells, PPV1-7 subtypes and PCV-2 viral full-length plasmids, and the amplification of non-PPV8 plasmid genomic DNA is shown in Table 4.

[0061] Table 4

[0062] 3. Durability verification Common engineering cell lines 293 / CHO / Vero were selected for durability verification. By detecting the inhibition of PPV8 target amplification by the genomic DNA of these commonly used engineering cells, it was determined whether it would affect the normal detection of PPV8.

[0063] Genomic DNA of 293 / CHO / Vero cells was extracted, the concentration was measured and diluted to 80 ng / μl for standby. 100 copies / reaction of pUC57-PPV8 plasmid standard was used as a positive control, and 400 ng / reaction of 293 / CHO / Vero cell genome was introduced into 100 copies / reaction of PPV8 plasmid standard, and the qPCR reaction system and procedure were the same as in Table 2-3.

[0064] As shown in Table 4, the introduction of 293 / CHO / Vero cell genome did not affect the normal detection of PPV8. Figure 5

[0065] Example 3: Application of PPV8-qPCR detection method.

[0066] The primer probe combination provided in Examples 1 and 2 and the PPV8-qPCR detection method were used to detect PPV8 in the 293T cell sample to be tested to determine whether PPV8 contamination existed in the sample. The specific method is as follows: Test sample: Take 10 6 μL of PBS; Positive control: Take 200 μL of PPV8 pseudovirus diluted with PBS to 10 3 PFU / mL; Applicability control: Add the same PPV8 pseudovirus as the positive control to the test sample; All the above samples (test sample, positive control and applicability control) were extracted with Viral Nucleic Acid purification kit (simgen, 4002050) to extract DNA, and 5 μl was taken as working solution for qPCR detection.

[0067] Negative control: Take 200 μl of PBS as negative control; No template control: RNase-free water; Sensitivity control: 100 copies / reaction of PPV8 plasmid standard; ​The reaction system and amplification procedure are the same as those in Table 2-3.

[0068] The result judging standard of the PPV8-qPCR detection method is as follows: 1. Test effectiveness The following requirements need to be met at the same time in the same test. Otherwise, the test is invalid.

[0069] (1) No template control: no Ct value, no obvious amplification curve.

[0070] (2) Sensitivity control: has obvious amplification curve, and Ct value ≤ 38.

[0071] (3) Negative control: no Ct value, no obvious amplification curve.

[0072] (4) Positive control: has obvious amplification curve, and Ct value ≤ 35.

[0073] (5) Applicability control: has obvious amplification curve, and if the Ct value is larger, the difference with the Ct value of the positive control is not more than 3 cycles.

[0074] 2. Sample detection result judgment The standard for judging the sample detection result is shown in Table 5.

[0075] Table 5 Standard for judging sample detection result

[0076] The detection results are shown in Table 6 and Figure 6 It can be seen that according to the judgment standard of the PPV8-qPCR detection method, it is judged that the 293T cells are not contaminated by PPV8.

[0077] Table 6 Detection results

[0078] The above specific embodiments describe the implementation of the present application in detail, but the present application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the present application, various simple modifications and changes can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. A primer probe combination for detecting porcine parvovirus type 8, characterized by, The primer probe combination comprises a forward primer, a reverse primer and a detection probe, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 1, the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the detection probe is shown as SEQ ID NO.

3.

2. A system for detecting porcine parvovirus type 8, characterized by, The primer probe combination comprises a forward primer, a reverse primer and a detection probe, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 1, the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the detection probe is shown as SEQ ID NO.

3.

3. The system for detecting porcine parvovirus type 8 according to claim 2, characterized in that, The PPV8 standard plasmid, the PPV8 pseudo virus, the basic buffer and the RNase-free water are further included.

4. A product for detecting porcine parvovirus type 8, characterized in that, The primer probe combination of claim 1 is included, or the system of any one of claims 2-3 is included.

5. The product of claim 4, wherein, The product is a detection kit, a detection test strip or a detection chip.

6. A method for detecting porcine parvovirus type 8, characterized by, The method is not for the purpose of disease diagnosis and treatment, and the primer probe of claim 1 is used, or the system of any one of claims 2-3 is used, or the product of any one of claims 4-5 is used for detection.

7. The method of claim 6, wherein, The method comprises the following steps: The sample to be tested, the positive control, the suitability control, the sensitivity control, the no template control and the negative control are prepared; DNA of the sample to be tested, the negative control, the positive control and the suitability control is extracted, and then the sample to be tested DNA, the positive control DNA, the suitability control DNA, the sensitivity control, the no template control and the negative control are respectively detected by qPCR; The test effectiveness is determined and the detection result is determined according to the qPCR reaction amplification curve and the Ct value; The test effectiveness determination method is that the no template control has no Ct value and no obvious amplification curve, the sensitivity control has an obvious amplification curve and a Ct value ≤ 38, the negative control has no Ct value and no obvious amplification curve, the positive control has an obvious amplification curve and a Ct value ≤ 35, and the suitability control has an obvious amplification curve, and if the Ct value is larger, the difference with the Ct value of the positive control is not more than 3 cycles; then it is determined that the test is effective; The detection result determination method is that when the Ct value is ≤ 38 and there is an obvious amplification curve, it is determined that the detection result is positive; when the Ct value is > 38 and there is an obvious amplification curve, it is determined that the detection result is invalid; when there is no Ct value and no obvious amplification curve, it is determined that the detection result is negative.