MGAT1-deficient cells and uses thereof

Abstract

A method for producing a modified cell lacking mannosyl (alpha-1, 3-)-glycoprotein beta-1, 2-N-acetylglucosamino transferase 1 ("MGAT1") activity is disclosed. Also provided are CHO cell lines that lack MGAT1 activity produced by the methods. Further disclosed are methods for producing glycoproteins.

Description

[0001] Cross-reference of related applications

[0002] This application claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 502,866, filed May 17, 2023. The entire contents of the aforementioned application are incorporated herein by reference.

[0003] sequence list

[0004] This application contains a sequence list submitted electronically in .xml format, which is incorporated herein by reference in its entirety. A copy of the .xml file, created on May 15, 2024, is named “A1000-01200US_20240515_SeqListing.xml” and is 20 kilobytes in size. Technical Field

[0005] This disclosure relates to novel cell lines and methods for producing glycoproteins. Background Technology

[0006] Developing broadly protective vaccines against pathogenic viruses remains a significant challenge from both immunological and public health perspectives. For example, broadly protective vaccines are needed to address the continued emergence of new variants of SARS-CoV-2.

[0007] The SARS-CoV-2 spike protein, a key immunogen, is mutation-sensitive and contains conserved antigenic determinants masked by glycans. Recent studies have shown that spike protein glycosylation has a site-differential effect on viral infectivity, and that spike proteins produced in post-infected lung epithelial cells carry a more infectious glycoform. It has also been shown that immunization of mice with spike proteins pruned into a monoglycosylated state with N-linked glycans elicits a stronger immune response and better protection against SARS-CoV-2 variants compared to immunization with fully glycosylated spike proteins.

[0008] One method for generating viral antigens with altered glycosylation involves mutating the O- or N-glycosylation sites of the antigen. However, this alters the protein structure and can lead to the loss of antigenic determinants, thus reducing immunogenicity. Another method involves expressing the viral antigen in cell lines engineered to have altered glycosylation enzyme pathways.

[0009] Therefore, there is a need for cell lines and methods for generating glycan-modified glycoprotein antigens that can be used to develop broadly neutralizing antibodies against viruses and other pathogens. Summary of the Invention

[0010] To meet the above needs, a method for producing a modified cell lacking mannosyl (a-1,3-) -glycoprotein beta-1,2-N-acetylglucosaminyltransferase 1 ("MGAT1") activity is provided. The method introduces an RNA-guided endonuclease into a parent cell along with a guide RNA ("gRNA") comprising a sequence as set forth in: GGAUGCGCAGACCUGAGCAG (SEQ ID NO: 2), GGUAGUGGAGGACGAUCUGG (SEQ ID NO: 3), UUUCUCCACCUGUAGCAGGG (SEQ ID NO: 4), or GAUCGCCAGGCACUACCGCU (SEQ ID NO: 5); culturing the parent cell; isolating a plurality of daughter cells from the cell culture; and identifying a modified cell lacking MGAT1 activity.

[0011] CHO cells lacking MGAT1 activity produced by the above method are within the scope of the present invention.

[0012] Also provided is a MGAT1 -lacking CHO cell, wherein the cell contains in its genome a nucleic acid having a sequence as set forth in SEQ ID NO: 6.

[0013] A first method for producing a glycoprotein by obtaining a MGAT1 -lacking cell produced using the above method; expressing a protein having an N-glycosylation site in the cell and culturing the cell, whereby the protein is N-glycosylated at the N-glycosylation site by oligomannosyl glycans; and isolating the N-glycosylated protein from the cell is disclosed.

[0014] A second method for producing a glycoprotein by first producing a MGAT1 -lacking cell using the above method; expressing a protein having an N-glycosylation site in the cell and culturing the cell, whereby the protein is N-glycosylated at the N-glycosylation site by oligomannosyl glycans; and isolating the N-glycosylated protein from the cell is further disclosed.

[0015] Finally, a third method for producing a glycoprotein by obtaining the above-mentioned MGAT1 -lacking CHO cell containing SEQ ID NO: 6; expressing a protein having an N-glycosylation site in the cell and culturing the cell line, whereby the protein is N-glycosylated at the N-glycosylation site by oligomannosyl glycans; and isolating the N-glycosylated protein from the cell is disclosed.

[0016] One or more embodiments of the invention are set forth in detail in the following description. Other features, objects, and advantages of the invention will be apparent from the description, drawings, and claims. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Exhibits a Western blot autoradiograph showing SARS-CoV2 spike protein expressed in three different MGAT1 deficient CHO K1 cell lines and not treated with endonuclease H (“EndoH”) (-) or treated with endonuclease H (+).

[0018] Figure 2A Exhibits a Western blot autoradiograph examining media collected from MGAT1 deficient CHO K1 cell line cultures expressing SARS-CoV2 spike protein (“S protein”) compared to standard proteins comprising Sfg, Shm, and Smg. Sfg = fully glycosylated S protein, Shm = high mannose S protein, Smg = mono-glycosylated S protein, A = media from adherent cultures, and S = media from suspension cultures.

[0019] Figure 2B Exhibits a Western blot autoradiograph examining histidine tagged S-protein purified from suspension cultures of MGAT1 deficient CHO K1 cell lines and not treated with EndoH (-) or treated with EndoH (+) compared to standard proteins comprising Shm and Smg. Shm = high mannose S protein, Smg = mono-glycosylated S protein.

[0020] Figure 3A Graphical representation of the glycan composition of the 61-F.FSNVT.W fragment of the His-tag free delta SARS-CoV2 spike protein expressed with or without EndoH treatment using exemplary cells according to the present disclosure. Untreated fragments carry glycans comprising HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), and HexNAc(2)Hex(7), or no glycans (“un”). Treated fragments carry no glycans or only HexNAc(1). Filled rectangles represent NAc, and filled circles represent mannose.

[0021] Figure 3B Graphical representation of the glycan composition of the 74-F.HAIHVSGTNGTK.R fragment of the His-tag free delta SARS-CoV2 spike protein expressed with or without EndoH treatment using exemplary cells according to the present disclosure. Untreated fragments carry glycans comprising HexNAc (1), HexNAc(2)Hex(3), HexNAc(2)Hex(4), and HexNAc(2)Hex(5). Treated fragments carry only HexNAc(1). Filled rectangles represent NAc, and filled circles represent mannose.

[0022] Figure 3C Graphical representation of the glycan composition of the 122-L.IVNNATNVVIK.V segment of the His-tag free delta SARS-CoV2 spike protein expressed with exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), and HexNAc(2)Hex(8). The treated segment carries only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0023] Figure 3D Graphical representation of the glycan composition of the 149-Y.YHKNNKSWMESGVY.S segment of the His-tag free delta SARS-CoV2 spike protein expressed with exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(2)Hex(5). The treated segment carries only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0024] Figure 3E Graphical representation of the glycan composition of the 163-Y.SSANNCTFEYVSQPF.L segment of the His-tag free delta SARS-CoV2 spike protein expressed with exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(2)Hex(5) and HexNAc(2)Hex(6). The treated segment carries only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0025] Figure 3F Graphical representation of the glycan composition of the 232-I.GINIT.R segment of the His-tag free delta SARS-CoV2 spike protein expressed with exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), HexNAc(2)Hex(8), and HexNAc(2)Hex(9), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0026] Figure 3G Graphical representation of the glycan composition of the 280-K.YNENGTIT.D segment of the His-tag free delta SARS-CoV2 spike protein expressed using exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(2)Hex(4), HexNAc(2)Hex(5), and HexNAc(2)Hex(6). The treated segment carries only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0027] Figure 3H Graphical representation of the glycan composition of the 329-V.RFPNIT.N segment of the His-tag free delta SARS-CoV2 spike protein expressed using exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), and HexNAc(2)Hex(5), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0028] Figure 3I Graphical representation of the glycan composition of the 341-F.GEVFNAT.R segment of the His-tag free delta SARS-CoV2 spike protein expressed using exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), and HexNAc(2)Hex(5). The treated segment carries mostly HexNAc(l) and a small portion of HexNAc(2)Hex(4). The filled rectangles represent NAc, and the filled circles represent mannose.

[0029] Figure 3J Graphical representation of the glycan composition of the 601-S.VITPGTNTS.N segment of the His-tag free delta SARS-CoV2 spike protein expressed using exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(2)Hex(3), HexNAc(2)Hex(5), and HexNAc(2)Hex(6). The treated segment carries only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0030] Figure 3KGraphical representation of the glycan composition of the 614-V.LYQGVNCT.E segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(5), and HexNAc(2)Hex(6). The treated segment carries primarily HexNAc(l). The solid rectangles represent NAc, and the solid circles represent mannose.

[0031] Figure 3L Graphical representation of the glycan composition of the 655-V.NNSYECDIPI.G segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), and HexNAc(2)Hex(5), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The solid rectangles represent NAc, and the solid circles represent mannose.

[0032] Figure 3M Graphical representation of the glycan composition of the 707-A.YSNNSIA.I segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), and HexNAc(2)Hex(8), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The solid rectangles represent NAc, and the solid circles represent mannose.

[0033] Figure 3NGraphical representation of the glycan composition of the 715-T.NFTIS.V segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), HexNAc(2)Hex(8), and HexNAc(2)Hex(9), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The solid rectangles represent NAc, and the solid circles represent mannose.

[0034] Figure 3O Graphical representation of the glycan composition of the 799-K.TPPIKDFGGFNFS.Q segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), and HexNAc(2)Hex(8). The treated segment carries only HexNAc(l). The solid rectangles represent NAc, and the solid circles represent mannose.

[0035] Figure 3P Graphical representation of the glycan composition of the 1072-A.QEKNFTT.A segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with or without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), and HexNAc(2)Hex(7). The treated segment carries only HexNAc(l). The solid rectangles represent NAc, and the solid circles represent mannose.

[0036] Figure 3QGraphical representation of the glycan composition of the 1096-S.NGTHWFVT.Q segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with and without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), and HexNAc(2)Hex(7), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0037] Figure 3R Graphical representation of the glycan composition of the 1132-V.NNTV.Y segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with and without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), HexNAc(2)Hex(5), and HexNAc(2)Hex(7). The treated segment carries only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0038] Figure 3S Graphical representation of the glycan composition of the 1156-K.NHTSPDVDLG.D segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with and without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), and HexNAc(2)Hex(5), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0039] Figure 3T Graphical representation of the glycan composition of the 1171-S.GINASVV.N segment of the His-tag free delta SARS-CoV2 spike protein expressed by exemplary cells according to the present disclosure with and without EndoH treatment. The untreated segment carries glycans including HexNAc(l), HexNAc(2)Hex(4), and HexNAc(2)Hex(5), or no glycans (“un”). The treated segment carries no glycans or only HexNAc(l). The filled rectangles represent NAc, and the filled circles represent mannose.

[0040] Figure 3U A graphical representation of the glycan composition of the 655-V.NNSYECDIPI.G fragment of the His-tag free delta SARS-CoV2 spike protein expressed with and without EndoH treatment according to the exemplary cells of the present disclosure. The untreated fragment carries glycans including HexNAc (1), HexNAc(2)Hex(4), and HexNAc(2)Hex(5). The treated fragment carries only HexNAc (1). The solid rectangles represent NAc, and the solid circles represent mannose. DETAILED DESCRIPTION

[0041] In one aspect, the present disclosure provides a method for producing a modified cell that lacks MGAT1 activity. The method includes introducing an RNA-guided endonuclease into a parent cell, such as CHO K1, along with a guide RNA (gRNA).

[0042] As used herein, “MGAT1 -deficient” or “lacks MGAT1 activity” describes a cell in which the mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase 1 has no functional effect as compared to a wild-type or unmodified cell. The MGAT-1 deficiency can be achieved by altering the MGAT-1 gene through insertion of one or more nucleotides or deletion or substitution of one or more nucleotides thereof, causing a missense mutation, a nonsense mutation, or a frameshift mutation of the gene. The altered gene can no longer be able to express a protein product or can express a non-functional protein product.

[0043] In some embodiments, the RNA-guided endonuclease is a Clustered Regularly Interspaced Short Palindromic Repeat-associated protein (“Cas”), which can be Streptococcus pyogenes Cas9 (“SpCas9”), enhanced SpCas9 (eSpCas9), or SpCas9-high fidelity 1 (SpCas9-HF1). In certain embodiments, the RNA-guided endonuclease is SpCas9.

[0044] Without wishing to be bound by theory, in embodiments where the RNA-guided endonuclease is a Cas protein, the introduced gRNA will bind to the target gene at a location based on the hybridization between the gRNA and the target gene. The hybridization between the gRNA and the target gene recruits the Cas protein, thereby forming a complex that activates the Cas protein. The activated Cas protein cleaves the binding site and excises a fragment of the target gene, leaving a double-strand break (DSB). The DSB is then repaired via a homology-directed repair (HDR) mechanism. Thus, the repaired gene loses its fragment and is no longer complete. The gene is unable to express, or its expressed gene product will lose its function.

[0045] In some embodiments, the gRNA can comprise a nucleic acid sequence as set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In certain embodiments, the gRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 3.

[0046] In some embodiments, the mother cell of the present disclosure comprises a gene encoding a protein exhibiting MGAT1 activity. In embodiments where the gRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, the gene of the mother cell encoding a protein exhibiting MGAT1 activity comprises a target sequence capable of hybridizing to at least a portion of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, respectively.

[0047] In some embodiments, the gRNA used in the method comprises a Clustered Regularly Interspaced Short Palindromic Repeat RNA (“crRNA”) and a trans-activating crRNA (“tracrRNA”). In some embodiments, the crRNA and the tracrRNA are coupled to each other via hybridization, while in some other embodiments, the crRNA and the tracrRNA are formed as the same nucleic acid molecule. In certain embodiments, the tracrRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 11. It should be noted that in some embodiments, the crRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 and further comprises a region complementary to the 5’ end of the tracrRNA. For example, a crRNA comprising SEQ ID NO: 3 is GGUAGUGGAGGACGAUCUGGGUUUUAGAGCUAUGCU 3’ (SEQ ID NO: 13). Exemplary crRNAs comprising SEQ ID NO: 2, 4, and 5 are GGAUGCGCAGACCUGAGCAGGUUUUAGAGCUAUGCU (SEQ ID NO: 12), UUUCUCCACCUGUAGCAGGGGUUUUAGAGCUAUGCU (SEQ ID NO: 14), and GAUCGCCAGGCACUACCGCUGUUUUAGAGCUAUGCU (SEQ ID NO: 15), respectively.

[0048] In some embodiments, the RNA-guided endonuclease and gRNA can be introduced into the parental cell, which can be a CHO cell, such as CHO K1, as a preformed complex using electroporation.

[0049] In some embodiments, the above method comprises identifying a modified cell that lacks MGAT1 activity. The identification can be achieved using a MGAT1 enzyme activity assay or by sequencing the genomic DNA of candidate cells to identify those genomic DNAs that have an insertion and / or deletion that would result in loss of MGAT1 gene expression and / or loss of MGAT1 gene product enzyme activity. For example, the identification step can be performed by performing bacteriophage T7 endonuclease I ("T7EI") digestion analysis on genomic DNA fragments amplified from candidate cells and sequencing genomic DNA fragments from T7EI digestion analysis positive cells. T7EI digestion analysis is known in the art as an effective tool for identifying small sequence mismatches. For example, DNA fragments amplified from genomic DNA of cells can be variably and re-ligated with wild type DNA molecules. Subsequently, the ligated DNA fragments are digested by T7 endonuclease I, which produces digested DNA fragments of different sizes if a mismatch is present. However, the present disclosure is not limited to using T7EI digestion analysis.

[0050] In one aspect of the present disclosure, the modified cells described above can be used to produce glycoproteins. A first method is characterized by expressing a glycoprotein having an N-glycosylation site in a MGAT1 -deficient cell, which can be a modified CHO cell according to the present disclosure. In some embodiments, the method is performed in vitro. The glycoprotein can be expressed into the modified cells of the vector by suitable methods known in the art, such as transfection, retroviral transduction, and lentiviral transduction. The vector can be, but is not limited to, a plasmid expression vector, a retroviral vector, and a lentiviral vector. When a viral vector is used, the viral particles can be produced in a suitable host cell known in the art.

[0051] Expressing the glycoprotein in the MGAT1 -deficient cell results in N-glycosylation at the N-glycosylation site by oligomannosyl glycans. The N-glycosylated protein, i.e., the oligomannosyl glycoprotein, is then isolated from the cells by standard procedures known in the art. For example, the N-glycosylated protein can be purified from the culture supernatant. Alternatively, the cells can be collected by centrifugation, and the N-glycosylated protein can be purified from the cell pellet.

[0052] In some embodiments, the culture of the MGAT1 -deficient cell can be an adherent culture or a suspension culture.

[0053] The first method for producing a glycoprotein can also include removing the oligomannosyl glycans to leave only N-acetylglucosamine residues at the N-glycosylation sites, thereby producing a monoglycosylated protein. The oligomannosyl glycans can be removed by incubating the glycoprotein bearing the oligomannosyl glycans with the glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine 1,4-N-acetyl-beta-glucosaminyl hydrolase (“Endo H”).

[0054] In some embodiments, the glycoprotein expressed in the MGAT1 deficient cell can be, for example, a cellular protein or a viral envelope protein.

[0055] In certain embodiments, the glycoprotein is a viral envelope protein, such as a SARS-CoV2 spike protein, a Pan-sarbecovirus spike protein, a Pan-beta coronavirus spike protein, or an influenza hemagglutinin. The SARS-CoV2 spike protein can be, but is not limited to, an alpha-SARS-CoV2 spike protein, a beta-SARS-CoV2 spike protein, a gamma-SARS-CoV2 spike protein, a delta-SARS-CoV2 spike protein, or an omicron-SARS-CoV2 spike protein, or a variant thereof.

[0056] In certain embodiments, the SARS-CoV2 spike protein can include the amino acid sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 17.

[0057] In other embodiments, the glycoprotein is a cellular protein, such as alpha-fetoprotein, beta-human chorionic gonadotropin, cancer antigen 15-3, 19-9, 27.29, 125, and 549, carcinoembryonic antigen, carcinoembryonic antigen-related cell adhesion molecule, human epithelial growth factor receptor 2, oncofetal fibronectin, placental alkaline phosphatase, and prostate specific antigen.

[0058] In one aspect of the disclosure, two other methods for producing a glycoprotein are provided. In some embodiments, these methods are performed in vitro.

[0059] The second exemplary method includes the steps of the first method, except that the second method additionally includes producing a modified cell that lacks MGAT1 activity.

[0060] The third exemplary method is a particular variation of the first method, wherein the third method specifically employs a MGAT1 deficient cell that includes in its genome a nucleic acid having a sequence as set forth in SEQ ID NO: 6.

[0061] The following specific examples are to be understood as merely illustrative and are not to be understood as limiting the remainder of the disclosure in any way. Without further elaboration, it is believed that one skilled in the art can, based on the description herein, utilize the present disclosure to its fullest extent. All publications cited herein are hereby incorporated by reference in their entirety.

[0062] Example

[0063] Example 1: MGAT1 gene editing in CHO cells

[0064] Exemplary adherent CHO K1 cells were cultured in Ham's F12 (Sigma) supplemented with 2 mM GLUTAMAX™ (GIBCO) and 10% fetal bovine serum ("FBS") at 37°C, 5% CO2. For suspension cultures, exemplary CHOK1 cells were also grown in BalanCD CHO Growth A Medium (FUJIFILM Irvine Scientific) supplemented with 8 mM GLUTAMAX™ and 0.5% Anti-Clumping Supplement (FUJIFILM Irvine Scientific) at 37°C, 5% CO2.

[0065] Example 2: Gene editing

[0066] Gene editing of the MGAT1 gene in CHO K1 cells was performed using standard techniques. Briefly, ribonucleoprotein particles ("RNPs") were prepared in vitro by mixing recombinant Cas9, a universal tracrRNA (SEQ ID NO: 11), and a crRNA including a sequence as set forth in SEQ ID NO: 2, 3, 4, or 5. The mixture was incubated at 37°C for 10 minutes to form the RNP.

[0067] According to the manual, the RNP (5 microliters) containing 3.3 µM Cas9, 6.6 µM tracrRNA, and 6.6 µM of one of the four crRNAs was electroporated into 1.0 x 10 5 cells in 10 µL R buffer using a Neon system (Thermo Fisher). After electroporation, the cells were plated in a 24-well plate (2 mL per well) and cultured at 37°C, 5% CO2 for three days.

[0068] Example 3: Detection of gene edited clones by T7EI analysis

[0069] To verify the results of the gene editing described in Example 2, the electroporated cells were grown to reach a cell number of 1.0 x 10 5 The cells were lysed in 100 µL lysis buffer (10 mM Tris-HCl pH 8.0, 0.05% SDS, 250 µg / ml proteinase K) for 15 min at 37°C and heat inactivated for 15 min at 85°C.

[0070] The relevant region of the MGAT1 gene was amplified from samples of cell lysates by polymerase chain reaction (“PCR”) using the forward primer ACCCGTGAGGTGTTCCGCCT (SEQ ID NO: 7) and the reverse primer AGACACGGGCAAGGAAATCCC (SEQ ID NO: 8) to obtain a 943 bp product.

[0071] The PCR products were subjected to T7 endonuclease El digestion analysis according to the manufacturer’s protocol (New England Biolabs: “NEB”). The T7E1 -treated samples were analyzed by agarose gel electrophoresis to identify cells carrying insertions / deletions (“indels”) in the region of the MGAT1 gene of interest.

[0072] Following column purification, the indel positive cell clones were further analyzed by sequencing the 943 bp product using the forward primer ACCCCCTCACCAGCCGTGAT (SEQ ID NO: 9) and the reverse primer TCTGGACGAATACAGGCCCGC (SEQ ID NO: 10).

[0073] Cells were seeded with serial dilutions to obtain clonal cell lines.

[0074] Example 4: Screening for MGAT1 - CHO K1 clonal cell lines

[0075] The loss of MGAT1 activity in the CHO K1 clonal cell lines was assessed by expressing the SARS-CoV2 spike glycoprotein in the cells. The expressed spike protein was subsequently incubated with EndoH to detect incompletely glycosylated high mannose type modified spike proteins. The glycoproteins were expressed in the CHO K1 clonal cell lines using the lentiviral expression system as outlined below.

[0076] Lentivirus production

[0077] 1.7 x 10 7Two 293T cells (ATCC CRL-3216) were added to 15 cm plates. After 24 hours of culture, the cells were transfected with a total of 30 µg of four plasmid vectors as follows: 10 µg of a plasmid expressing the viral GAG, POL, and ENV genes and carrying the REV response element; 2.5 µg of a plasmid expressing REV; 2.5 µg of a plasmid expressing the VSV-G protein; and 15 µg of a plasmid carrying a histidine-tagged S protein coding sequence (wild-type S protein sequence as described in SEQ ID NO: 16) and a lentiviral backbone. The plasmids were transfected into the 293T cells using Lipofectamine 3000 as per the supplier's (Thermo Fisher) instructions. After 48 hours of culture, the cell supernatant was collected, filtered through a 0.45 µm filter, and concentrated 100-fold using a Lenti-X concentrator (Takara) according to the manufacturer's protocol.

[0078] spike protein production

[0079] Add 30 microliters of concentrated lentivirus to 2×10 4 Candidate MGAT1 - In CHO-K1 clone cells, after one round of single-cell limiting dilution, the cells were further expanded until they reached more than 1 × 10⁻⁶. 5 10 cells. Then, 1×10 5 Cells were seeded in 24-well plates with 0.5 mL of culture medium and grown for 96 hours. Supernatants were collected from each well and purified using COVID-19 spike protein affinity resin (Repligen, SR-24156: NGL#22) according to the manual. In short, the collected supernatant was loaded onto a column and topped with 10 mL of buffer A (20 mM Tris-HCl, 140 mM NaCl, pH 7.5). The column was then washed with 8 CV of buffer A and eluted with 7 CV of buffer B (100 mM acetate, 1 M arginine, pH 5.5), followed by 4 CV of buffer C (200 mM acetate). The column was then cleaned in situ (CIP) with 4 CV of buffer D (0.1 N NaOH). The column was then neutralized with 5 CV of buffer A. After purification, the collected supernatant was concentrated to a final volume of 20 µL.

[0080] EndoH digestion and protein blotting

[0081] As instructed by the manufacturer (NEB), digest 10 μL of concentrated supernatant containing approximately 20 µg of protein with 1 µg EndoH or a protein simulant at 37°C for 2 hours. MGAT1 -The cells produced high mannose glycoproteins that were digestible by EndoH and exhibited a fast mobility in acrylamide gel electrophoresis, i.e. gel shift.

[0082] After digestion, 16 μΐ, of each sample was examined using a BOLT™ system (ThermoFisher) using 8% Bis-Tris mini protein gels as per manufacturer’s instructions using Western blot analysis.

[0083] After transfer from gel electrophoresis to a PVDF membrane, the S protein was detected using primary antibody mouse anti-SARS-CoV2 (clone 1035206; R&D Systems) and secondary antibody horseradish peroxidase-conjugated goat anti-mouse Fc (Invitrogen) followed by visualization using Clarity Max Western ECL substrate (BioRad).

[0084] The results are shown in Figure 1 All three candidate CHO K1 clonal cell lines exhibited gel shift of the S protein to lower molecular weight after EndoH digestion, confirming the lack of MGAT1 activity in these cells.

[0085] One exemplary CHO K1 clonal cell was selected for further evaluation. The MGAT1 gene in this cell line has two nucleotide deletions at positions 640 and 641 of SEQ ID NO: 1 within the MGAT1 coding sequence. The double base deletion causes a frame shift in the MGAT1 coding sequence. The DNA sequence including the deletion site is shown in SEQ ID NO: 6.

[0086] Example 5: Optimization of S protein expression

[0087] The CHO K1 clonal cell lines were adapted to suspension culture using standard methods. Attached cultures of the clonal cell lines were grown in 24-well plates and suspension cultures were grown in T125 flasks. The histone-tagged S protein was expressed in both cell cultures using the methods set forth above.

[0088] The cultured media were collected (0.5 mL from wells of a 24-well plate and 30 mL from a T125 flask), concentrated to 20 μΐ, and analyzed using Western blot analysis as described above. The results are shown in Figure 2A

[0089] Standard S protein samples of full glycosylation (S fg ), high mannose glycosylation (S hm ), and monoglycosylation (S mg ) exhibited different mobilities as expected. See Figure 2, first three lanes. ​

[0090] Both adherent (A) and suspension (S) cultures of the CHO K1 clonal cell line expressed substantial S protein following lentivirus infection. See Figure 2A , last two lanes. The mobility of the S protein is consistent with the high mannose form, confirming that the CHO K1 cell line is MGAT1 - .

[0091] His-tagged high mannose S protein was purified from the suspension culture media using nickel chelation, subjected to EndoH treatment as set forth in Example 4 above, and analyzed using Western blot. The results are shown in Figure 2B . The untreated S protein purified from the CHOK1 clonal cell line migrated at the same position indicative of high mannose S protein, while the EndoH treated purified S protein migrated to a position corresponding to monoglycosylated S protein.

[0092] Alternatively, the experiments described in Example 4 and Example 5 were repeated to express SARS-CoV2 spike protein (delta strain) without His tag. The expressed and purified S protein was divided into 5 portions and treated with chymotrypsin, chymotrypsin with trypsin, trypsin, alpha-lytic protease with trypsin, and alpha-lytic protease, respectively. The treated samples were then vacuum dried for MS analysis. The results show that the purity of the expressed spike protein samples was over 90%, and the protease digestion was highly efficient, with digestion rates higher than 95%.

[0093] Following protease digestion, the spike protein was cleaved into 17 peptide fragments including a total of 21 N-glycosylation sites (not including the peptide including N17 glycosylation site). All 21 N-glycosylation sites were highly mannoglycosylated (i.e., with high mannose content), especially mannose-5 (Man5). The high mannose content was further verified by using Endo H treatment, as only a single GluNAcs Figures 3A to 3U ) was observed after treatment.

[0094] Other Embodiments

[0095] Example 1. A method of producing a modified cell lacking mannosyl (a-1,3-) - glycoprotein beta-1,2-N-acetylglucosaminyltransferase (MGAT1) activity, the method comprising: introducing an RNA-guided endonuclease into a mother cell along with a guide RNA (“gRNA”) comprising a sequence as set forth in: GGAUGCGCAGACCUGAGCAG (SEQ ID NO: 2), GGUAGUGGAGGACGAUCUGG (SEQ ID NO: 3), UUUCUCCACCUGUAGCAGGG (SEQ ID NO: 4), or GAUCGCCAGGCACUACCGCU (SEQ ID NO: 5); culturing the mother cell and expanding the mother cell; isolating a plurality of daughter cells from the cell culture; identifying a modified cell lacking MGAT1 activity; and isolating the modified cell lacking MGAT1 activity.

[0096] Example 2. The method of Example 1, wherein identifying a modified cell lacking MGAT1 activity comprises: performing bacteriophage T7 endonuclease I (T7EI) digestion analysis on genomic DNA fragments amplified from a plurality of daughter cells and sequencing genomic DNA fragments from T7EI digestion analysis positive cells.

[0097] Example 3. The method of Example 1 or Example 2, wherein the gRNA comprises a Clustered Regularly Interspaced Short Palindromic Repeat RNA (crRNA) and a trans-activating crRNA (tracrRNA), and the RNA-guided endonuclease is Cas9.

[0098] Example 4. The method of any one of Examples 1-3, wherein the method comprises: introducing the RNA-guided endonuclease into a cell along with a guide RNA (gRNA) using electroporation with a preformed complex of the RNA-guided endonuclease and the gRNA.

[0099] Example 5. The method of any one of Examples 1-4, wherein the mother cell is a CHO cell.

[0100] Example 6. The method of Example 5, wherein the gRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 3.

[0101] Example 7. A Chinese hamster ovary cell line produced according to the method of any one of Examples 1-6.

[0102] Example 8. The cell line of Example 7, wherein the cell line is derived from a CHO K1 cell line.

[0103] Embodiment 9. A method for producing a glycoprotein, the method comprising: obtaining a mannosyl (a-l,3-) -glycoprotein b-l,2-N-acetylglucosaminyltransferase deficient (MGATl deficient) cell produced according to the method of any one of embodiments 1-8; expressing a protein having an N-glycosylation site in the MGATl deficient cell, whereby the protein is N-glycosylated at the N-glycosylation site with an oligomannoside; and isolating the N-glycosylated protein from the cell.

[0104] Embodiment 10. The method of embodiment 9, further comprising incubating the glycosylated protein with Endo H to remove the oligomannoside, whereby an N-acetylglucosamine residue remains at the N-glycosylation site.

[0105] Embodiment 11. The method of embodiment 9 or embodiment 10, wherein the protein is a viral envelope protein.

[0106] Embodiment 12. The method of embodiment 11, wherein the protein is a viral envelope protein selected from the group consisting of a SARS-CoV2 spike protein, a pan-Sarbecovirus spike protein, a pan-Betacoronavirus spike protein, and an influenza hemagglutinin.

[0107] Embodiment 13. The method of embodiment 12, wherein the SARS-CoV2 spike protein is an alpha-SARS-CoV2 spike protein, a beta-SARS-CoV2 spike protein, a gamma-SARS-CoV2 spike protein, a delta-SARS-CoV2 spike protein, or an omicron-SARS-CoV2 spike protein.

[0108] Embodiment 14. The method of embodiment 13, wherein the SARS-CoV2 spike protein comprises an amino acid sequence as set forth in SEQ ID NO: 16 or SEQ ID NO: 17.

[0109] Embodiment 15. The method of embodiment 9 or embodiment 10, wherein the protein is selected from the group consisting of a- fetoprotein, b-human chorionic gonadotropin, cancer antigen 15-3, 19-9, 27.29, 125, and 549, carcinoembryonic antigen, carcinoembryonic antigen-related cell adhesion molecule, human epithelial growth factor receptor 2, oncofetal fibronectin, placental alkaline phosphatase, and prostate specific antigen.

[0110] Embodiment 16. A method for producing a glycoprotein, the method comprising: producing a mannosyl (a-l,3-)-glycoprotein beta-l,2-N-acetylglucosaminyltransferase deficient (MGATl deficient) cell according to the method of any one of embodiments 1-15; expressing a protein having an N-glycosylation site in the MGATl deficient cell, whereby the protein is N-glycosylated at the N-glycosylation site with an oligomannosyl glycan; and isolating the N-glycosylated protein from the cell.

[0111] Embodiment 17. A Chinese hamster ovary cell line deficient in mannosyl (a-l,3-)- glycoprotein beta-l,2-N-acetylglucosaminyltransferase activity, the cell line comprising in its genome a nucleic acid having a sequence as set forth in SEQ ID NO: 6.

[0112] Embodiment 18. The cell line of embodiment 17, wherein the cell line is derived from a CHO Kl cell line.

[0113] Embodiment 19. A method for producing a glycoprotein, the method comprising: obtaining a mannosyl (a-l,3-)-glycoprotein beta-l,2-N-acetylglucosaminyltransferase deficient Chinese hamster ovary cell line according to embodiment 17 or embodiment 18; expressing a protein having an N-glycosylation site in the cell line, whereby the protein is N-glycosylated at the N-glycosylation site with an oligomannosyl glycan; and isolating the N-glycosylated protein from the cell line.

[0114] Embodiment 20. The method of embodiment 19, further comprising incubating the glycosylated protein with Endo H to remove the oligomannosyl glycan, whereby an N-acetylglucosamine residue remains at the N-glycosylation site.

[0115] Embodiment 21. The method of embodiment 19 or embodiment 20, wherein the protein is a viral envelope protein.

[0116] Embodiment 22. The method of embodiment 21, wherein the protein is a viral envelope protein selected from the group consisting of a SARS-CoV2 spike protein, a pan sarbecovirus spike protein, a pan betacoronavirus spike protein, and an influenza hemagglutinin.

[0117] Example 23. The method of Example 22, wherein the SARS-CoV2 spike protein is an alpha-SARS-CoV2 spike protein, a beta-SARS-CoV2 spike protein, a gamma-SARS-CoV2 spike protein, a delta-SARS-CoV2 spike protein, or an omicron-SARS-CoV2 spike protein.

[0118] Example 24. The method of Example 23, wherein the SARS-CoV2 spike protein comprises an amino acid sequence as set forth in SEQ ID NO: 16 or SEQ ID NO: 17.

[0119] Example 25. The method of Example 19 or Example 20, wherein the protein is selected from the group consisting of alpha-fetoprotein, beta-human chorionic gonadotropin, cancer antigen 15-3, 19-9, 27.29, 125, and 549, carcinoembryonic antigen, carcinoembryonic antigen-related cell adhesion molecule, human epithelial growth factor receptor 2, oncofetal fibronectin, placental alkaline phosphatase, and prostate specific antigen.

[0120] All of the features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

[0121] From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various uses and conditions. Thus, other embodiments are also within the scope of the following claims.

[0122] SEQUENCE LIST

[0123] .

Claims

1. A method for producing a modified cell that lacks mannosyl (a-l,3-)-glycoprotein beta- 1,2-N-acetylglucosaminyltransferase (MGAT1) activity, the method comprising: introducing an RNA-guided endonuclease into a parental cell along with a guide RNA (gRNA) comprising a sequence as set forth in: GGAUGCGCAGACCUGAGCAG (SEQ ID NO: 2), GGUAGUGGAGGACGAUCUGG (SEQ ID NO: 3), UUUCUCCACCUGUAGCAGGG (SEQ ID NO: 4), or GAUCGCCAGGCACUACCGCU (SEQ ID NO: 5); culturing the parental cell and expanding the parental cell; isolating a plurality of daughter cells from the cell culture; identifying a modified cell that lacks MGAT1 activity; and isolating the modified cell that lacks MGAT1 activity.

2. The method of claim 1, wherein identifying a modified cell that lacks MGAT1 activity comprises: performing bacteriophage T7 endonuclease I (T7EI) digestion analysis on genomic DNA fragments amplified from a plurality of daughter cells and sequencing genomic DNA fragments from T7EI digestion analysis positive cells.

3. The method of claim 1, wherein the gRNA comprises a clustered regularly interspaced short palindromic repeat RNA (crRNA) and a trans-activating crRNA (tracrRNA), and the RNA- guided endonuclease is Cas9.

4. The method of claim 1, wherein the method comprises: introducing an RNA-guided endonuclease into a cell along with a guide RNA (gRNA) using electroporation of a preformed complex of the RNA-guided endonuclease and the gRNA.

5. The method of claim 1, wherein the parental cell is a CHO cell.

6. The method of claim 5, wherein the gRNA comprises a nucleic acid sequence as set forth in SEQ ID NO:

3.

7. A Chinese hamster ovary cell line produced according to the method of claim 1.

8. The cell line of claim 7, wherein the cell line is derived from a CHO K1 cell line.

9. A method of producing a glycoprotein, the method comprising: obtaining a mannosyl (a-l,3-)-glycoprotein beta- 1,2-N-acetylglucosaminyltransferase deficient (MGAT1 deficient) cell produced according to the method of claim 1; expressing a protein having an N-glycosylation site in the MGAT1 deficient cell, whereby the protein is N-glycosylated at the N-glycosylation site by an oligomannose glycan; and isolating the N-glycosylated protein from the cell.

10. The method of claim 9, further comprising incubating the glycosylated protein with Endo H (Endo H) to remove the oligomannosyl glycans, whereby N-acetylglucosamine residues remain at the N-glycosylation site.

11. The method of claim 9, wherein the protein is a viral envelope protein.

12. The method of claim 11, wherein the protein is a viral envelope protein selected from the group consisting of SARS-CoV2 spike protein, pan-Sarbecovirus spike protein, pan- Betacoronavirus spike protein, and influenza hemagglutinin.

13. The method of claim 12, wherein the SARS-CoV2 spike protein is an alpha- SARS-CoV2 spike protein, a beta-SARS-CoV2 spike protein, a gamma-SARS-CoV2 spike protein, a delta-SARS-CoV2 spike protein, or an omicron-SARS-CoV2 spike protein.

14. The method of claim 13, wherein the SARS-CoV2 spike protein comprises an amino acid sequence as set forth in SEQ ID NO: 16 or SEQ ID NO:

17.

15. The method of claim 9, wherein the protein is selected from the group consisting of alpha-fetoprotein, beta-human chorionic gonadotropin, cancer antigen 15-3, 19-9, 27.29, 125, and 549, carcinoembryonic antigen, carcinoembryonic antigen-related cell adhesion molecule, human epithelial growth factor receptor 2, oncofetal fibronectin, placental alkaline phosphatase, and prostate specific antigen.

16. A method of producing a glycoprotein, the method comprising: producing a mannosyl (a-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase deficient (MGAT1 deficient) cell according to the method of claim 1; expressing a protein having an N-glycosylation site in the MGAT1 deficient cell, whereby the protein is N-glycosylated at the N-glycosylation site by an oligomannosyl glycan; and isolating the N-glycosylated protein from the cell.

17. A Chinese hamster ovary cell line deficient in mannosyl (a-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase activity, the cell line comprising in its genome a nucleic acid having a sequence as set forth in SEQ ID NO:

6.

18. The cell line of claim 17, wherein the cell line is derived from a CHO K1 cell line.

19. A method of producing a glycoprotein, the method comprising: obtaining a mannosyl (a-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase deficient Chinese hamster ovary cell line according to claim 17; expressing a protein having an N-glycosylation site in the MGAT1 deficient cell, whereby the protein is N-glycosylated at the N-glycosylation site by an oligomannosyl glycan; and isolating the N-glycosylated protein from the cell. expressing a protein having an N-glycosylation site in the cell line, whereby the protein is N-glycosylated at the N-glycosylation site by an oligomannosyl glycan; and isolating the N-glycosylated protein from the cell line.

20. The method of claim 19, further comprising incubating the glycosylated protein with Glycopeptide-D-Mannosyl-N4-(N-Acetyl-D-Glucosaminyl)2-Asparagine 1,4-N-Acetyl-β- Glucosaminyl Hydrolase (EndoH) to remove the oligomannosyl glycan, whereby an N-acetylglucosamine residue remains at the N-glycosylation site.

21. The method of claim 19, wherein the protein is a viral envelope protein.

22. The method of claim 21, wherein the protein is a viral envelope protein selected from the group consisting of a SARS-CoV2 spike protein, a pan-Sarbecovirus spike protein, a pan- Betacoronavirus spike protein, and an influenza hemagglutinin.

23. The method of claim 22, wherein the SARS-CoV2 spike protein is an alpha-SARS-CoV2 spike protein, a beta-SARS-CoV2 spike protein, a gamma-SARS-CoV2 spike protein, a delta- SARS-CoV2 spike protein, or an omicron-SARS-CoV2 spike.

24. The method of claim 23, wherein the SARS-CoV2 spike protein comprises an amino acid sequence as set forth in SEQ ID NO: 16 or SEQ ID NO:

17.

25. The method of claim 19, wherein the protein is selected from the group consisting of alpha-fetoprotein, beta-human chorionic gonadotropin, cancer antigen 15-3, 19-9, 27.29, 125, and 549, carcinoembryonic antigen, carcinoembryonic antigen-related cell adhesion molecule, human epithelial growth factor receptor 2, oncofetal fibronectin, placental alkaline phosphatase, and prostate specific antigen.

Images