Lucid ganoderma liver-protecting health-care food and preparation method thereof

Abstract

The invention belongs to the field of health-care foods, and particularly relates to a lucid ganoderma liver-protecting health-care food and a preparation method thereof. The lucid ganoderma liver-protecting health-care food comprises the following components in parts by weight: 20-35 parts of a lucid ganoderma extract, 15-25 parts of a Chinese wolfberry fruit extract, 12-20 parts of a Chinese magnoliavine fruit extract, 13-20 parts of a cassia seed extract and 13-25 parts of a poria cocos extract. The health-care food disclosed by the invention has the functions of protecting the liver, resisting oxidation and reducing and regulating lipid.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of health food, and particularly relates to a Ganoderma lucidum liver-protecting health food and a preparation method thereof. BACKGROUND

[0002] The liver is an important metabolic and detoxification organ of the human body, and plays a core role in maintaining normal physiological functions of the body. In modern society, long-term drinking, high-fat diet, excessive stress, and improper use of drugs can easily lead to liver function damage, fatty liver, alcoholic hepatitis, and other diseases. Therefore, developing natural health food with liver-protecting function has become a hot spot of current research and market attention. Ganoderma lucidum, as a traditional precious Chinese medicinal material, has significant liver-protecting, antioxidant, and immune-regulating effects. Its main active ingredients include polysaccharides and triterpenoids, which have been proved to have protective effects on liver cells.

[0003] At present, health foods developed from Chinese medicinal materials on the market, such as Ganoderma lucidum polysaccharide powder and wolfberry oral liquid, still have certain limitations in terms of compatibility science, integrity of active ingredient extraction, and functional synergy mechanism, and it is difficult to meet the needs of multi-factor liver damage intervention. SUMMARY

[0004] To at least solve one of the above technical problems, the present application provides a Ganoderma lucidum liver-protecting health food and a preparation method thereof. The health food has the functions of protecting the liver, antioxidant, and lipid-lowering and lipid-regulating.

[0005] The present application adopts the following technical solutions:

[0006] A Ganoderma lucidum liver-protecting health food comprises the following components in parts by weight: Ganoderma lucidum extract 20-35 parts, wolfberry fruit extract 15-25 parts, Schisandra chinensis extract 12-20 parts, Cassia seed extract 13-20 parts, and Poria cocos extract 13-25 parts.

[0007] Preferably, the Ganoderma lucidum liver-protecting health food comprises the following components in parts by weight: Ganoderma lucidum extract 20-30 parts, wolfberry fruit extract 15-20 parts, Schisandra chinensis extract 15-20 parts, Cassia seed extract 15-20 parts, and Poria cocos extract 15-20 parts.

[0008] In some embodiments, the Ganoderma lucidum liver-protecting health food comprises the following components in parts by weight: Ganoderma lucidum extract 20 parts, wolfberry fruit extract 20 parts, Schisandra chinensis extract 20 parts, Cassia seed extract 20 parts, and Poria cocos extract 20 parts.

[0009] In particular, the present application studies find that when the weight ratio of Ganoderma lucidum extract, Fructus Lycii extract, Schisandra chinensis extract, Cassia seed extract and Poria cocos extract is 30:20:15:15:20, the effects of protecting liver, resisting oxidation and reducing and regulating lipid are optimal.

[0010] According to the embodiment of the present application, the Ganoderma lucidum liver-protecting health food comprises the following components in parts by weight: Ganoderma lucidum extract 30 parts, Fructus Lycii extract 20 parts, Schisandra chinensis extract 15 parts, Cassia seed extract 15 parts and Poria cocos extract 20 parts.

[0011] According to the embodiment of the present application, the preparation method of the Ganoderma lucidum extract is as follows:

[0012] 1) Water extraction of crude polysaccharide

[0013] The Ganoderma lucidum fruiting body (dry) is crushed (about 20-40 mesh) ; the Ganoderma lucidum coarse powder is mixed with purified water at a ratio of 1:10-1:15 (g / mL), heated to 95-100 DEG C, extracted for 1.5-2 hours, and extracted for 2-3 times in total, and the extraction liquid is combined; the extraction liquid is filtered (filtered through filter cloth or filter), and the filtrate is collected; the residue is retained; the filtrate is concentrated under reduced pressure to 1 / 4-1 / 6 of the original volume to form a concentrated liquid; 90-95% ethanol is slowly added under stirring conditions to reach a final concentration of 75-80% (V / V), and the polysaccharide is precipitated at 4-6 DEG C (12-16 hours) ; the precipitate is centrifuged and separated, and the supernatant is discarded to obtain the polysaccharide precipitate; and the polysaccharide precipitate is dried to obtain the Ganoderma lucidum polysaccharide extract;

[0014] 2) Ethanol extraction of triterpenes

[0015] The residue is added to 85-95% ethanol at a ratio of 1:10-15 (g / mL), and refluxed and extracted for 1-3 times, each time for 1-1.5 hours; the ethanol extraction liquid is combined; the residue is removed by filtration to obtain the triterpene extraction liquid; the ethanol is recovered by concentration under reduced pressure to obtain a concentrated liquid (thick liquid containing Ganoderma lucidum triterpenes) ; and the Ganoderma lucidum triterpene extract is obtained by drying;

[0016] 3) The Ganoderma lucidum polysaccharide extract and the Ganoderma lucidum triterpene extract are mixed to obtain the Ganoderma lucidum extract.

[0017] The Ganoderma lucidum extract of the present application is obtained by two-step extraction, and polysaccharides and triterpenes can be obtained at the same time, and water-soluble and fat-soluble components are considered.

[0018] According to the embodiment of the present application, the preparation method of the Fructus Lycii extract is as follows:

[0019] The wolfberry is crushed into 20-40 mesh coarse powder; the wolfberry coarse powder is mixed with purified water at a ratio of 1:8-1:12 (g / mL), heated to 85-95℃, and extracted for 1-1.5 hours, for a total of 2-3 times; the extraction liquid is combined; the extraction liquid is filtered to remove residue (by filter cloth or plate and frame filter), and the filtrate is collected; the water extraction liquid is concentrated under reduced pressure to 1 / 4-1 / 6 of the original volume to obtain a concentrated liquid (thick extraction liquid); 90-95% ethanol is slowly added to the concentrated liquid to reach a final concentration of 75%-80% (V / V), and the concentrated liquid is allowed to stand at 4℃ (for 12-18 hours) to precipitate the polysaccharide component; the precipitate is centrifuged and dried to obtain wolfberry extract.

[0020] According to an embodiment of the present application, the preparation method of the Schisandra extract is as follows:

[0021] The Schisandra (dried) is crushed into 20-40 mesh coarse powder; the Schisandra coarse powder is mixed with 70-75% ethanol at a ratio of 1:8-1:10 (g / mL), heated to reflux or constant temperature extraction, with the temperature controlled at 60-70℃, and extracted for 1.5-2 hours each time, for a total of 2-3 times; the residue is filtered out (by cloth bag or filter), and the ethanol extraction liquid is collected; the extraction liquid is concentrated under reduced pressure (40-55℃) to 1 / 6-1 / 8 of the original volume to obtain a concentrated liquid; dried to obtain the Schisandra extract.

[0022] According to an embodiment of the present application, the preparation method of the Cassia extract is as follows:

[0023] The Cassia is crushed into 20-40 mesh coarse powder; the Cassia coarse powder is mixed with water at a ratio of 1:10-1:12 (g / mL), heated to 90-100℃, and extracted for 1-1.5 hours, for a total of 2-3 times, and the extraction liquid is combined; the residue is filtered out (by filter cloth or plate and frame filter), and the filtrate is collected; the filtrate is concentrated in a reduced pressure concentrator to 1 / 4-1 / 6 of the original volume to obtain a concentrated liquid; dried to obtain the Cassia extract.

[0024] According to an embodiment of the present application, the preparation method of the Poria extract is as follows:

[0025] The Poria is cut into pieces and crushed into 20-40 mesh coarse powder; the Poria coarse powder is mixed with purified water at a ratio of 1:10-1:12 (g / mL), heated to 95-100℃, and extracted for 1-1.5 hours each time, for a total of 2-3 times, and the extraction liquid is combined; the extraction liquid is filtered to remove residue (by filter cloth or plate and frame filter), and the filtrate is collected; the filtrate is concentrated under reduced pressure (with the temperature controlled at 50-60℃) to 1 / 6-1 / 8 of the original volume to obtain a concentrated liquid; dried to obtain the Poria extract.

[0026] As a better embodiment of the present application, the Ganoderma lucidum for preparing the Ganoderma lucidum extract is Ganoderma leucocontextum RK001 (Ganoderma leucocontextum RK001), which has been preserved in China Center for Type Culture Collection (CCTCC) on December 13, 2023, and the preservation number is CCTCC NO: M20232555. The Ganoderma leucocontextum RK001 has high contents of crude polysaccharides and total triterpenes, and can further improve the effects of protecting liver, resisting oxidation and reducing and regulating blood lipids in the health-care food of the present application.

[0027] According to the embodiments of the present application, the Ganoderma lucidum liver-protecting health-care food of the present application takes the Ganoderma lucidum extract, the Fructus Lycii extract, the Schisandra chinensis extract, the Cassiae semen extract and the Poria cocos extract as active ingredients.

[0028] According to the embodiments of the present application, the Ganoderma lucidum liver-protecting health-care food of the present application takes the Ganoderma lucidum extract, the Fructus Lycii extract, the Schisandra chinensis extract, the Cassiae semen extract and the Poria cocos extract as active ingredients, and is prepared or composed according to the above-mentioned proportions.

[0029] The Ganoderma lucidum liver-protecting health-care food of the present application can be prepared into capsules, granules, powders, tablets or compound plant drinks according to the conventional techniques in the art.

[0030] The Ganoderma lucidum liver-protecting health-care food of the present application can further contain excipients or carriers available in the field of pharmacy or health-care food.

[0031] The present application further provides the use of the Ganoderma lucidum liver-protecting health-care food in the preparation of health-care food having the functions of protecting liver, resisting oxidation or reducing and regulating blood lipids.

[0032] According to the embodiments of the present application, the protection of liver includes the auxiliary protection against chemical liver injury.

[0033] According to the embodiments of the present application, the resistance to oxidation is helpful to the resistance to oxidation.

[0034] According to the embodiments of the present application, the reduction and regulation of blood lipids is helpful to the maintenance of the healthy level of blood lipids (cholesterol / triglyceride).

[0035] The recommended daily dosage of the Ganoderma lucidum liver-protecting health-care food of the present application is 1000-1500 mg per day, calculated based on the active ingredients (i.e. the Ganoderma lucidum extract, the Fructus Lycii extract, the Schisandra chinensis extract, the Cassiae semen extract and the Poria cocos extract), and can be taken in 1-3 times.

[0036] This invention relates to a Ganoderma lucidum liver-protecting health food product, with Ganoderma lucidum as its core ingredient to nourish liver qi and enhance the body's resistance. It is combined with other liver-protecting herbs to enhance the synergistic liver-protecting effect. Ganoderma lucidum is sweet in taste and neutral in nature, entering the heart, lung, and liver meridians. Modern research has confirmed its significant protective effect against liver damage, while also enhancing immunity. As the main ingredient, it undertakes the primary function of "tonifying the liver and regulating the overall condition." Goji berries nourish the liver and kidneys, have antioxidant properties, lower blood lipids, and can improve liver cell function. Schisandra chinensis contains lignan compounds and has the effect of "consolidating essence and qi, astringing the liver and benefiting the lungs." Cassia seed can clear liver heat, lower blood lipids, and combat fatty liver. Poria cocos strengthens the spleen and eliminates dampness, regulates the middle jiao, indirectly promotes the smooth flow of liver qi, and enhances the overall absorption of the medicine. Modern pharmacology shows that: Ganoderma lucidum polysaccharides and triterpenes: regulate immunity, have antioxidant effects, and resist liver fibrosis; Lycium barbarum polysaccharides: lower ALT and AST levels and inhibit liver fibrosis; Schisandra chinensis: has antioxidant effects, protects mitochondria, and promotes hepatocyte regeneration; Cassia tora: regulates lipid metabolism and lowers cholesterol; Poria cocos: enhances the body's immunity, improves intestinal flora, and promotes diuresis and detoxification.

[0037] This invention relates to a Ganoderma lucidum liver-protecting health food formula, with Ganoderma lucidum as the principal ingredient, leveraging its core functions of protecting and nourishing the liver, and strengthening the body's resistance, thus establishing the overall formula's foundation. Goji berries and Schisandra chinensis serve as assistant ingredients; goji berries focus on tonifying the Yin of the liver and kidneys, while Schisandra chinensis helps nourish Yin, astringe the liver, and consolidate essence, working synergistically with the principal ingredient to enhance liver-protecting power. Cassia seeds and Poria cocos serve as adjuvant ingredients: cassia seeds assist in clearing the liver, lowering lipids, moistening the intestines, and promoting detoxification; Poria cocos strengthens the spleen and eliminates dampness, aiding in drug absorption and harmonizing the Qi of the spleen and stomach. Its spleen-meridian affinity also helps direct the medicinal power to the middle Jiao, coordinating the effects of all the ingredients. This formula is meticulously constructed, prioritizing tonification and supplementing with clearing, combining tonification with clearing and clearing with nourishment, presenting an overall effect of "tonifying the liver and benefiting Qi, soothing the liver and relieving depression, clearing and purging simultaneously, and harmonizing the five internal organs."

[0038] This invention relates to Ganoderma lucidum liver-protecting health food, which has the functions of protecting the liver (with an auxiliary protective effect against chemical liver damage), anti-oxidation, and lowering and regulating lipids. It is suitable for people with easily impaired liver function, those who frequently attend social events, those who stay up late, and those with fatty liver. Detailed Implementation

[0039] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described in detail below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0040] With regard to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0044] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0045] The preparation methods for each extract are detailed below.

[0046] Ganoderma lucidum extract: The dried Ganoderma lucidum fruiting body was pulverized to 40 mesh; the coarse powder was mixed with purified water at a ratio of 1:10 (g / mL), heated to 95℃, and extracted for 1.5 hours, for a total of two extractions. The extracts were combined. The extract was filtered through a filter cloth, and the filtrate was collected; the residue was retained; the filtrate was concentrated under reduced pressure to 1 / 4 of its original volume to form a concentrate; 95% ethanol was slowly added under stirring to achieve a final concentration of 80% (V / V), and the mixture was allowed to stand at 4-6℃ for 12 hours to precipitate polysaccharides; the precipitate was separated by centrifugation, and the supernatant was discarded to obtain the polysaccharide precipitate; the precipitate was dried to obtain the Ganoderma lucidum polysaccharide extract; the residue was added to 95% ethanol and refluxed twice at a ratio of 1:10 (g / mL), for 1 hour each time; the ethanol extracts were combined; the residue was removed by filtration to obtain the triterpenoid extract; the ethanol was recovered by concentration under reduced pressure to obtain the concentrate; the concentrate was dried to obtain the Ganoderma lucidum triterpenoid extract; the Ganoderma lucidum polysaccharide extract and the Ganoderma lucidum triterpenoid extract were mixed to obtain the Ganoderma lucidum extract.

[0047] Goji Berry Extract: Grind goji berries into 40-mesh coarse powder; mix the coarse goji berry powder with purified water at a ratio of 1:10 (g / mL), heat to 90℃, and extract for 1.5 hours, repeating the extraction twice; combine the extracts; filter the extract through a filter cloth to remove residue, and collect the filtrate; concentrate the aqueous extract to 1 / 4 of its original volume under reduced pressure to obtain a concentrated solution; slowly add 95% ethanol to the concentrated solution to achieve a final concentration of 75% (V / V), and let it stand at 4℃ for 12 hours to precipitate polysaccharide components; centrifuge to obtain the precipitate, dry it, and obtain the goji berry extract.

[0048] Schisandra chinensis extract: Dried Schisandra chinensis was pulverized into a 40-mesh coarse powder; the coarse Schisandra chinensis powder was mixed with 70% ethanol at a ratio of 1:10 (g / mL), heated to reflux, and the temperature was controlled at 70℃. Each extraction was carried out for 2 hours, and a total of 3 extractions were performed; the residue was removed by filtration through a cloth bag, and the ethanol extract was collected; the extract was concentrated to 1 / 6 of its original volume under reduced pressure (40-55℃) to obtain a concentrated solution; the solution was dried to obtain the Schisandra chinensis extract.

[0049] Cassia seed extract: Cassia seeds were pulverized into 40-mesh coarse powder; the ratio of coarse cassia seed powder to water was 1:10 (g / mL), and the mixture was heated to 95℃ and extracted for 1.5 hours, for a total of 2 extractions. The extracts were combined; the residue was removed by filtration with a filter cloth, and the filtrate was collected; the filtrate was concentrated to 1 / 4 of its original volume in a vacuum concentrator to obtain a concentrated solution; the solution was dried to obtain cassia seed extract.

[0050] Poria cocos extract: Cut Poria cocos into pieces and pulverize into 40-mesh coarse powder; extract at a ratio of Poria cocos coarse powder: purified water = 1:10 (g / mL), heat to 95℃, extract for 1.5 hours each time, for a total of 2 extractions, and combine the extracts; filter the extract through a filter cloth to remove residue, and collect the filtrate; concentrate the filtrate to 1 / 6 of its original volume under reduced pressure (temperature controlled at 50-60℃) to obtain a concentrated solution; dry to obtain Poria cocos extract.

[0051] Example 1

[0052] This embodiment provides a Ganoderma lucidum liver-protecting health food, which is composed of the following components in parts by weight: 30 parts of Ganoderma lucidum extract, 20 parts of wolfberry extract, 15 parts of Schisandra chinensis extract, 15 parts of cassia seed extract, and 20 parts of Poria cocos extract.

[0053] Example 2

[0054] This embodiment provides a Ganoderma lucidum liver-protecting health food, which is composed of the following components in parts by weight: 20 parts of Ganoderma lucidum extract, 20 parts of wolfberry extract, 20 parts of Schisandra chinensis extract, 20 parts of cassia seed extract, and 20 parts of Poria cocos extract.

[0055] Example 3

[0056] This embodiment provides a Ganoderma lucidum liver-protecting health food, which is composed of the following components in parts by weight: 25 parts of Ganoderma lucidum extract, 25 parts of wolfberry extract, 12 parts of Schisandra chinensis extract, 13 parts of cassia seed extract, and 25 parts of Poria cocos extract.

[0057] Example 4

[0058] This embodiment provides a Ganoderma lucidum liver-protecting health food, which is composed of the following components in parts by weight: 35 parts of Ganoderma lucidum extract, 15 parts of wolfberry extract, 18 parts of Schisandra chinensis extract, 19 parts of cassia seed extract, and 13 parts of Poria cocos extract.

[0059] Example 5

[0060] This embodiment provides a Ganoderma lucidum liver-protecting health food, which differs from Embodiment 1 only in that the Ganoderma lucidum used to prepare the extract is the fruiting body of white-fleshed Ganoderma lucidum RK001 (Ganoderma leucocontextum RK001), whose preservation number is: CCTCC NO: M20232555.

[0061] The fruiting body of white-fleshed Ganoderma lucidum RK001 was obtained by cultivating it according to conventional methods in the art, and then prepared as Ganoderma lucidum extract.

[0062] Mother culture medium: Modified PDA medium (350g potato, 60g wheat bran, 20g glucose, 30g corn flour, 15g agar, 2000ml water, pH 6). Primary and cultivated culture medium: 65% sawdust, 15% wheat bran, 8% glucose, 10% corn flour, 1% lime, 1% gypsum; moisture content 55% ± 3%. All percentages are by weight. Mycelial growth temperature is 20-25℃.

[0063] Experimental Example 1

[0064] Referring to Scheme 2 of the "Methods for Functional Testing and Evaluation of Health Foods (2023 Edition)": Alcoholic liver injury model, the experimental animals were mice. The test substance was administered via gavage at a dose of 10 g / kg body weight (BW), once daily for 30 days. The modeling method involved gavage administration of 50% anhydrous ethanol (analytical grade, diluted with distilled water) at 14 mL / kg BW for 30 days to induce an alcoholic liver injury model. The control group received an equal volume of distilled water. The detection indicators were the content of malondialdehyde (MDA), reduced glutathione (GSH), and triglycerides (TG) in liver tissue.

[0065] The experimental groups and test substance formulations (parts by weight) are shown in Table 1 below. The preparation method of the test substance in group DE is the same as in Example 1.

[0066] The test results are shown in Table 2 below.

[0067] Table 1

[0068]

[0069] Table 2

[0070]

[0071] As shown in Table 2, in the alcohol-induced mouse liver injury model, each treatment group exhibited varying degrees of hepatoprotective effects. While the indicators (MDA, GSH, TG) in groups E and D showed some improvement compared to the model control group, the differences were not significant, indicating weak hepatoprotective effects. The overall effect was rated as "poor" and "average." Group C showed a certain intervention effect, with significant improvement in all indicators compared to the model group, demonstrating a positive hepatoprotective effect. Groups B and A showed significant hepatoprotective effects, with significantly reduced MDA and significantly improved GSH and TG, showing significant differences compared to groups C, D, and E (p<0.05), indicating stronger antioxidant and anti-hepatoprotective effects. Furthermore, all indicators in group A were superior to those in group B, with statistically significant differences (p<0.05), suggesting that the Ganoderma lucidum components extracted using the new strain have better intervention potential in synergistic effects. These experimental results indicate that the formulation of this invention has good hepatoprotective effects, especially group A using the new strain Ganoderma lucidum RK001, which showed the best effect, demonstrating significant functional advantages and development prospects.

[0072] Example 6: White-fleshed Ganoderma leucocontextum RK001

[0073] The mother culture medium, the original culture medium, and the cultivar culture medium are the same as in Example 5.

[0074] Unless otherwise specified, the mycelial growth temperature is 20-25℃.

[0075] 1. Strain acquisition

[0076] In September 2022, wild white-fleshed Ganoderma lucidum was collected in Yongning Town, Ninglang County, Lijiang City, Yunnan Province. A pure species was isolated and named white-fleshed Ganoderma lucidum YS001.

[0077] Through domestication and cultivation, a strain with relatively stable genetic traits, high content of crude polysaccharides and total triterpenes, short growth cycle and high yield was obtained and named Ganoderma lucidum RK001.

[0078] 2. Strain identification

[0079] 2.1 Morphology of Ganoderma leucocontextum RK001 (White Flesh Ganoderma)

[0080] Cap: 0.8-3cm thick, 5-20cm wide, semi-circular, kidney-shaped or nearly circular, corky; yellow to reddish-brown, dark reddish-brown, dark purplish-red or almost blackish-reddish-brown near the stipe, with a distinct lacquer-like luster; surface with annular ridges and radial wrinkles, thin at the edge.

[0081] Flesh: Pure white or nearly white.

[0082] Stipe: purplish-brown, lateral or occasionally eccentric, white inside, fibrous to woody in texture.

[0083] Spores: The spore print is brown, and the spores are brown, nearly oval, with double walls, and usually 8-9 μm × 4.35-6.5 μm in size.

[0084] 2.2 Molecular Identification

[0085] The ITS sequence of Ganoderma lucidum RK001 was determined as follows:

[0086] tgagctgtctacctgatttgaggtcagaggtcataaagctgtcttcaagcgaagacggttagaag

[0087] ctcgccaaacgcttcacggtcgcggcgtagacattatcacaccgagagccgatccgcaaggaatcaagc

[0088] taatgcatttaagaggagccgaccgaagagggccgacaagcctccaagtccaagcctacaaaccgcaaa

[0089] agcttgtaggttgaagatttcatgacactcaaacaggcatgctcctcggaataccaaggagcgcaaggt

[0090] gcgttcaaagattcgatgattcactgaattctgcaattcacattacttatcgcatttcgctgcgttctt

[0091] catcgatgcgagagccaagagatccgttgctgaaagttgtatatagatgcgttacatcgcaatacacat

[0092] tctaatactttatagagtttgtgataaacgcaggcacagacgcgcttcacgaagccccgcaaggagcac

[0093] gcttcgcagatctgaaacccacagtaagtgcacaggtgtagagtggatgagcagggcgtgcacgtgcct

[0094] cggaaggccagctacaacccagtcagaactcgataatgatccttccgcaggttcacctacggaaacctt

[0095] gttacactttttttccttccaaagac

[0096] Upon comparison, the ITS sequence of Ganoderma lucidum RK001 is similar to that of Ganoderma lucidum.

[0097] Based on morphological and molecular biological identification, Ganoderma lucidum RK001 belongs to Ganoderma lucidum (Ganoderma contextum).

[0098] 2.3 Antagonism Test

[0099] Based on the "NY / T1845-2010 Differential Identification of Edible Fungi Strains and Antagonistic Reactions", differential identification of strains (species) was carried out.

[0100] White-fleshed Ganoderma lucidum YS001 and RK001 were inoculated onto the same plate and cultured in PDA medium at a constant temperature of 30℃ to observe antagonistic reactions. The results showed antagonism between the two. After domestication and cultivation, White-fleshed Ganoderma lucidum RK001 acquired stable genetic traits, exhibited significantly faster growth rate, and showed vigorous growth.

[0101] White Ganoderma lucidum RK001 was deposited at the China Center for Type Culture Collection (CCTCC, Wuhan University, Wuhan, China 430072) on December 13, 2023, with accession number CCTCC NO: M20232555.

[0102] 3. Mycelial growth rate of Ganoderma lucidum RK001 (white-fleshed)

[0103] Modified PDA medium was heated and quantitatively poured into petri dishes. Ganoderma lucidum strains YS001 and RK001 were quantitatively inoculated. Every two days, colony diameters were measured using the "cross-hatching method" on the bottom of the petri dishes. The mycelial growth rates of the strains are shown in Table 3 below. One-way ANOVA was performed on the mycelial growth rates, and the results showed that the mycelial growth rate of Ganoderma lucidum RK001 was significantly higher than that of Ganoderma lucidum YS001 (P<0.01).

[0104] Table 3

[0105] Strain Mycelial growth rate (cm / d) Ganoderma lucidum YS001 1.625 Ganoderma lucidum RK001 2.192

[0106] 4. Cultivation Experiment of White-fleshed Ganoderma RK001

[0107] 4.1 Agronomic traits

[0108] Conventional methods were used for bag cultivation. The results are shown in Table 4 below.

[0109] Table 4

[0110] Strain Contamination rate Full bag time Biological conversion rate Ganoderma lucidum YS001 7.05％ 45.1d 476 kg Ganoderma lucidum RK001 4.80％ 35.2d 689 kg Ganoderma lucidum RK001 4.98％ 36.8d 642 kg

[0111] Note: *Use standard culture medium (60% sawdust, 28% bran, 8% glucose, 1% lime, 1% gypsum; moisture content 55% ± 3%; weight percentage). All other conditions are the same.

[0112] The cultivation experiment results show that the white-fleshed Ganoderma lucidum RK001 has a low contamination rate of miscellaneous bacteria, rapid mycelial growth, and good growth vigor. Furthermore, using the improved culture medium of this invention is beneficial for increasing mycelial growth rate and bioconversion rate.

[0113] 4.2 Determination of active ingredient content

[0114] Determination method: Refer to the 2020 edition of the Chinese Pharmacopoeia.

[0115] The test results are shown in Table 5 below.

[0116] Table 5

[0117] Strain Crude polysaccharide content Total triterpene content Ganoderma lucidum YS001 2.81％ 1.25％ Ganoderma lucidum RK001 4.22％ 1.46％ Ganoderma lucidum RK001 3.69％ 1.37％

[0118] The results showed that the crude polysaccharide content and total triterpenoid content of Ganoderma lucidum RK001 could reach as high as 4.22% and 1.46%, respectively. Compared with ordinary culture medium, the improved culture medium of this invention is also beneficial to further increase the crude polysaccharide content and total triterpenoid content.

[0119] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A Ganoderma lucidum-based liver-protecting health food, characterized in that, It includes the following components by weight: 20-35 parts of Ganoderma lucidum extract, 15-25 parts of Lycium barbarum extract, 12-20 parts of Schisandra chinensis extract, 13-20 parts of Cassia tora extract, and 13-25 parts of Poria cocos extract.

2. The Ganoderma lucidum liver-protecting health food according to claim 1, characterized in that, It includes the following components by weight: 20-30 parts of Ganoderma lucidum extract, 15-20 parts of Lycium barbarum extract, 15-20 parts of Schisandra chinensis extract, 15-20 parts of Cassia tora extract, and 15-20 parts of Poria cocos extract.

3. The Ganoderma lucidum liver-protecting health food according to claim 1, characterized in that, It includes the following components in parts by weight: 20 parts Ganoderma lucidum extract, 20 parts Lycium barbarum extract, 20 parts Schisandra chinensis extract, 20 parts Cassia tora extract, and 20 parts Poria cocos extract.

4. The Ganoderma lucidum liver-protecting health food according to claim 1, characterized in that, The weight ratio of Ganoderma lucidum extract, Lycium barbarum extract, Schisandra chinensis extract, Cassia tora extract, and Poria cocos extract is 30:20:15:15:

20.

5. The Ganoderma lucidum liver-protecting health food according to claim 1, characterized in that, It includes the following components by weight: 30 parts Ganoderma lucidum extract, 20 parts Lycium barbarum extract, 15 parts Schisandra chinensis extract, 15 parts Cassia tora extract, and 20 parts Poria cocos extract.

6. The Ganoderma lucidum liver-protecting health food according to any one of claims 1-5, characterized in that, The Ganoderma used to prepare the Ganoderma extract was white-fleshed Ganoderma RK001, with the preservation number: CCTCCNO: M20232555.

7. The Ganoderma lucidum liver-protecting health food according to any one of claims 1-6, characterized in that, The aforementioned Ganoderma lucidum liver-protecting health food is available in capsule, granule, powder, tablet, or compound plant beverage form.

8. The Ganoderma lucidum liver-protecting health food according to any one of claims 1-7, characterized in that, The aforementioned Ganoderma lucidum liver-protecting health food may also contain excipients or carriers that are pharmaceutically or health food-grade.

9. The use of the Ganoderma lucidum liver-protecting health food according to any one of claims 1-8 in the preparation of health foods with liver-protecting, antioxidant, or lipid-lowering and lipid-regulating functions.

10. The application according to claim 9, characterized in that, The liver protection mentioned includes an auxiliary protective effect against chemically induced liver damage; the antioxidant effect is to help fight oxidation; and the lipid-lowering and lipid-regulating effect is to help maintain healthy blood lipid (cholesterol / triglycerides) levels.

Images