Application of miR397 in enhancing virus resistance of corn

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to application of miR397 in enhancing virus resistance of corn, and the nucleotide sequence of the miR397 is shown as SEQ ID NO.24. The invention finds that the expression quantity of the miR397 is adjusted when SCMV and MCMV infect the corn, and the expression quantity of the miR397 is adjusted after SCMV or MCMV infection. The symptoms of the leaves or chlorotic mottles of corn leaves of transgenic overexpressed miR397 strains OE397-1 and OE397-2 are heavier, and the accumulation amount of virus RNA (Ribonucleic Acid) and coat protein is increased, while the symptoms of corn leaves of transgenic silent miR397 strains STTM397-10 and STTM397-11 are lighter, and the accumulation amount of virus RNA and coat protein is reduced. The results show that the miR397 can negatively regulate and control the virus resistance of the corn, so that the application of the miR397 in enhancing the virus resistance of the corn is provided.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically involving the application of miR397 in enhancing the virus resistance of maize. Background Technology

[0002] corn( Zea mays Corn (L.) is an important food crop, closely related to people's lives, but it is susceptible to a variety of diseases, among which viral diseases pose a significant threat and can lead to severe yield losses. Corn dwarf mosaic virus (SDV) is a viral disease that seriously endangers corn production in my country, occurring in all major corn-producing areas. Sugarcane mosaic virus (SCMV) is the main pathogen causing SMV in my country. Corn seedlings are most susceptible to SCMV infection. Generally, a few thin yellow streaks or spots first appear on the basal leaflets, then the disease spreads to the entire leaf within a few days, starting from the new leaves. Finding control measures for SMV is therefore urgently needed.

[0003] Maize chlorotic mottle virus (MCMV) is the sole member of the genus *Maize Chlorotic Mottle Virus* in the family Cloverviridae. MCMV causes symptoms such as mosaic chlorosis and stunted growth in plants. In the field, it can sometimes lead to necrosis, severe maldevelopment, low seed setting, shortened inflorescences, and premature plant death. While MCMV infection alone can cause only mild symptoms, co-infection with viruses from the family Potato Virology (YVV), such as maize dwarf mosaic virus (MDMV), SCMV, or wheat streak mosaic virus (WSMV), causes a severe maize disease—maize lethal necrosis disease (MLND)—resulting in significant yield losses. MLND is a highly destructive maize disease, primarily caused by co-infection with SCMV and MCMV. MLND can lead to leaf necrosis, premature senescence, spikelet loss, and even plant death.

[0004] miRNAs regulate gene expression and participate in antiviral responses; however, it is still unknown whether miR397 participates in maize's antiviral response. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides the application of miR397 in enhancing the virus resistance of maize.

[0006] Application of miR397 in enhancing virus resistance in maize. The nucleotide sequence of miR397 is shown in SEQ ID NO.24.

[0007] This invention discovered that SCMV and MCMV infection of maize regulates miR397 expression. Following SCMV or MCMV infection, transgenic maize lines overexpressing miR397, OE397-1 and OE397-2, exhibited more severe mosaic or chlorotic mottling symptoms in their leaves, along with increased accumulation of viral RNA and coat proteins. Conversely, transgenic miR397-silenced lines, STTM397-10 and STTM397-11, showed milder symptoms and reduced accumulation of viral RNA and coat proteins. These results indicate that miR397 negatively regulates maize's resistance to viruses, thus proposing the application of miR397 in enhancing maize's viral resistance.

[0008] Preferably, viral resistance is enhanced by inhibiting miR397 expression.

[0009] Preferably, methods for inhibiting miR397 expression include short tandem simulated target methods.

[0010] Preferably, the STTM primers used in the short tandem simulated target method are shown in SEQ ID NO.15~SEQ ID NO.16.

[0011] Preferably, in the short tandem target simulation method, the sequence shown in SEQ ID NO.17 is used as a template, and a 108-bp fragment is amplified using the STTM primers, ligated into an expression vector, and transformed into maize to inhibit miR397 expression; The nucleotide sequence of the 108-bp fragment is shown in SEQ ID NO.25.

[0012] Preferably, the virus includes sugarcane mosaic virus and maize chlorotic mottle virus.

[0013] Preferably, enhanced virus resistance in maize results in milder mosaic symptoms and reduced virus accumulation in maize leaves that suppress miR397 expression compared to wild-type leaves.

[0014] A method for enhancing virus resistance in maize by inhibiting the expression of miR397; The viruses include sugarcane mosaic virus and maize chlorotic mottle virus.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discovered that SCMV and MCMV infection of maize regulates miR397 expression. After SCMV or MCMV infection, compared to B104, transgenic lines overexpressing miR397, OE397-1 and OE397-2, exhibited more severe mosaic or chlorotic mottling symptoms in maize leaves and increased accumulation of viral RNA and coat proteins. Conversely, transgenic lines silencing miR397, STTM397-10 and STTM397-11, showed milder symptoms and reduced accumulation of viral RNA and coat proteins. These results indicate that miR397 negatively regulates maize's resistance to viruses, thus proposing the application of miR397 in enhancing maize's viral resistance. Attached Figure Description

[0016] Figure 1 The image shows the symptoms of corn leaves at different time points after viral infection, Bar=1cm.

[0017] Figure 2 Viral infection affects the expression of miR397 in maize.

[0018] Figure 3 Heatmap showing the expression levels of potential miR397 target genes in maize infected with SCMV and MCMV alone and in combination.

[0019] Figure 4 Viral infection affects potential target genes of maize miR397 ZmCBL The expression.

[0020] Figure 5 Transgenic maize detection: A: detection of overexpressed miR397 fragment, where M: Marker, 1-19: OE-397; B: detection of silenced miR397 fragment, where M: Marker, 1-20: STTM-397, and the mock is B104 maize leaf.

[0021] Figure 6 *: The accumulation levels of miR397 in transgenic maize with silenced and overexpressed miR397. p <0.05, ***: p <0.001.

[0022] Figure 7 To silence and overexpress miR397 potential target genes in transgenic maize ZmCBL The level of accumulation, *: p <0.05, ***: p <0.001.

[0023] Figure 8The images show leaf symptoms of transgenic maize with and without silencing or overexpressing miR397 after viral infection. A: Leaf symptoms of transgenic maize with and without silencing or overexpressing miR397 after SCMV infection. B: Leaf symptoms of transgenic maize with and without silencing or overexpressing miR397 after MCMV infection.

[0024] Figure 9 The data represent the accumulation levels of viral RNA and CP protein in miR397-silenced and miR397-overexpressing transgenic maize. A: Accumulation level of SCMV RNA in miR397-silenced and miR397-overexpressing transgenic maize; B: Accumulation level of MCMV RNA in miR397-silenced and miR397-overexpressing transgenic maize; C: Accumulation level of SCMV CP protein in miR397-silenced and miR397-overexpressing transgenic maize; D: Accumulation level of MCMV CP protein in miR397-silenced and miR397-overexpressing transgenic maize. p <0.01, ***: p <0.001. Detailed Implementation

[0025] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0026] The nucleotide sequence of miR397 is: UCAUGAGCGCAGCGUUGAUG, denoted as SEQ ID NO.24.

[0027] Example 1 Viral infection affects the expression of maize miR397 and its potential target genes. 1. Test materials Test seeds: B73 maize variety; Test viruses: SCMV-BJ and MCMV, kindly provided by Professor Fan Zaifeng of China Agricultural University, stored at -80℃. For detailed literature on SCMV and MCMV, please see: Xia Z, Zhao Z, Chen L, Li M, Zhou T, Deng C, Zhou Q, Fan Z. Synergistic infection of two viruses MCMV and SCMV increases the accumulations of both MCMV and MCMV-derived siRNAs in maize. Scientific Reports. 2016, 6:20520. doi: 10.1038 / srep20520.

[0028] Table 1. Reagents required for the experiment Table 2. Instruments required for the experiment 2. Test methods (1) Maize SCMV and MCMV inoculation, both individually and in combination. First, select plump, disease-free, and undamaged corn seeds (B73 variety). Place a layer of vermiculite of a certain thickness in a glass petri dish, scatter the prepared corn seeds on the vermiculite, and then cover them with more vermiculite. Add water to the petri dish until the vermiculite is moist. Place the petri dish in a 25°C dark environment to germinate the seeds. When the corn seeds germinate to 1-2 cm in length, transplant the seedlings into seedling trays and place them in an artificial climate incubator. Perform a 16-hour light treatment at 28°C followed by an 8-hour dark treatment at 22°C.

[0029] To prepare the pathogen, take diseased leaves containing the virus (SCMV or MCMV) from a -80℃ freezer, cut them into small pieces, and place them in a mortar. While grinding, add liquid nitrogen (note that sterilization should be performed during preparation to avoid contaminating the pathogen), and add 0.01 M phosphate-buffered saline (PBS). Shake thoroughly to mix, incubate on ice for 3 min, centrifuge at 5000 r / min for 3 min at 4℃, collect the supernatant and place it on ice for later use. Mixing equal volumes of SCMV and MCMV pathogens yields the SCMV / MCMV complex infection pathogen, while mixing with an equal volume of PBS buffer yields the SCMV or MCMV single infection pathogen.

[0030] When the third leaf of the corn plant has just emerged, evenly sprinkle a small amount of carborundum on the middle of the second leaf. Use a pipette to draw 25 μL of the original virus solution and place it on your index finger to rub the corn leaf for inoculation. After inoculation with SCMV, MCMV, and a mixture of the two viruses (S+M), take photos to record the symptoms at three time points: day 3, day 6, and day 9. Then, take leaf samples from the affected areas and freeze them at -80°C.

[0031] (2) Plant RNA extraction (Trizol method) First, pre-treat the required mortar and centrifuge tubes with DEPC water and then autoclave them. Prepare liquid nitrogen, Trizol reagent, chloroform, isopropanol, and 75% ethanol. Weigh an appropriate amount of sample and grind it into powder in a pre-cooled mortar (adding liquid nitrogen continuously during grinding to prevent sample melting and RNA degradation). Transfer the powder to a new 1.5 mL centrifuge tube and add 1000 μL of Trizol using a pipette. After adding the Trizol, vortex to thoroughly mix the powder. Add 200 μL of chloroform to the tube, vortex vigorously for 15 seconds, incubate at room temperature for 2-3 minutes, and centrifuge for 15 minutes. After centrifugation, the tube will separate into two layers: a colorless aqueous phase (containing RNA) on top and an organic phase containing DNA and proteins on the bottom. Carefully transfer the upper aqueous phase to a new centrifuge tube, being careful not to aspirate any other impurities. Then add an equal volume (approximately 450 μL) of isopropanol, let stand for 10 minutes, and then centrifuge at 12000 g for 10 minutes. Discard the liquid in the tube, add 1000 μL of 75% ethanol to wash, and centrifuge at 7000 g for 5 minutes at 4°C. Discard the supernatant in the tube, absorb as much 75% ethanol as possible, and air dry at room temperature for several minutes, but do not allow the RNA precipitate to dry completely. Add 30 μL of DEPC water to the centrifuge tube containing the RNA precipitate and gently pipette to dissolve.

[0032] (3) RNA reverse transcription reaction Prepare the following mixture in an RNase-free centrifuge tube: 4×gDNA wiper mix 4 μL, template RNA 1 pg-μg, and then add RNase-free ddH2O to make the total volume 16 μL. Mix the liquids and react at 42℃ for 2 min.

[0033] Reaction system: Add 4 μL of 5×HiScriptIII qRT Super Mix directly to the reaction tube from the previous step.

[0034] Reverse transcription reaction: 37℃, 15 min; 85℃, 5 s.

[0035] (4) Extraction of plant small RNA Corn leaf samples stored at -80℃ were ground using a grinder, and plant small RNA was extracted according to the kit method.

[0036] (5) Plant small RNA reverse transcription Reaction system: Total RNA up to 2 μg, 2×miRNA RT Reaction Buffer 10 μL, miRNA RTEnzyme Mix 2 μL, RNase-Free ddH2O to 20 μL.

[0037] Reaction program: 42℃, 60 min; 95℃, 3 min.

[0038] (6) Real-time quantitative PCR (RT-qPCR) detection Reverse transcription yields cDNA, which is used to identify the internal reference gene. -ΔΔCT The method involves computational analysis, using Prism software for graphical analysis.

[0039] The reaction systems are shown in Tables 3 and 4.

[0040] Table 3 RT-qPCR reaction system for mRNA Table 4. RT-qPCR reaction system for miRNA The reaction procedures are shown in Tables 5 and 6.

[0041] Table 5. RT-qPCR reaction procedure for mRNA Table 6. RT-qPCR reaction procedure for miRNA (7) RT-qPCR detection primers Table 7 Primers for detecting miR397 and its potential target genes. result 1. Different viral infections affect the expression of maize miR397. This invention uses maize B73 seeds as experimental material. SCMV, MCMV, and S+M are inoculated onto the first true leaf of the maize plant. Leaves above the inoculated leaf are harvested at 3, 6, and 9 days, and the disease incidence is recorded by photograph. Figure 1 The expression trend of miR397 in B73 maize inoculated with SCMV and MCMV was detected by RT-qPCR. The results showed that ( Figure 2At 3 days after vaccination: miR397 expression was upregulated by SCMV infection alone, and downregulated by MCMV infection alone and SCMV-MCMV co-infection; at 6 days after vaccination: miR397 expression was upregulated by SCMV infection alone, downregulated by MCMV infection alone, and no significant difference in miR397 expression between SCMV and MCMV co-infection; at 9 days after vaccination: miR397 expression was significantly upregulated by SCMV infection alone, MCMV infection alone, and SCMV-MCMV co-infection.

[0042] 2. Bioinformatics prediction of potential target genes of miR397 To clarify the expression of miR397 target genes after individual and co-infection with SCMV and MCMV, the psRNATarget website was used to predict potential miR397 target genes. Based on the prediction results, 186 potential miR397 target genes were identified. Target genes with an expected value of 4 or less were selected, ultimately yielding 25 optimal potential target genes. Based on previous transcriptome data, 53 significantly expressed miR397 potential target genes were identified, and heatmap analysis was performed. Figure 3 Further analysis revealed ZmCBL (Zm00001d027455_T001) was significantly expressed as a potential target gene of miR397.

[0043] 3. Different viral infections affect potential target genes of miR397 ZmCBL expression In the prediction ZmCBL After being identified as a potential target gene of miR397, according to ZmCBL The sequence was used to design detection primers ZmCBL-F / R, and the RT-qPCR method showed that ( Figure 4 ), 3 days after inoculation: SCMV infection alone ZmCBL Downregulation of expression, MCMV infection alone and SCMV and MCMV co-infection ZmCBL Upregulation of expression; 6 days after vaccination: SCMV infection alone and SCMV / MCMV co-infection ZmCBL Both SCMV and MCMV expression were upregulated, with no significant changes observed in MCMV infection alone; at 9 days post-vaccination: SCMV and MCMV expression were upregulated in both SCMV and MCMV infection alone. ZmCBL Both were upregulated, indicating co-infection by SCMV and MCMV. ZmCBL Downregulation of expression. At different time points, after SCMV and MCMV infection alone, and after co-infection with SCMV and MCMV, the potential target genes of miR397 were downregulated. ZmCBL The expression patterns varied. In summary, at different time points, inoculation with different maize viruses, miR397 and... ZmCBLThe expression of all genes was affected, indicating that miR397 and its potential target genes were affected. ZmCBL It participates in the resistance of corn to different viral infections.

[0044] Example 2 Effects of transgenic silencing and overexpression of miR397 on virus-infected maize 1. Test materials Main materials and reagents: Sugarcane mosaic virus (SCMV), maize chlorotic mottle virus (MCMV) virulence, and primary and secondary antibodies.

[0045] 2. Test methods (1) Maize virus inoculation Same as Example 1.

[0046] (2) DNA extraction Different maize leaf strains were collected and ground in grinding tubes using a grinder. 600 μL of preheated PCB buffer (65°C) and 12 μL of β-mercaptoethanol were added, mixed, and shaken. The mixture was then incubated in a 65°C water bath for 25 minutes to ensure thorough mixing. Next, 600 μL of chloroform was added, and the mixture was centrifuged at 12,000 rpm for 5 minutes at room temperature. The supernatant was collected into a 1.5 mL centrifuge tube. An equal volume of BD buffer was added to the supernatant, and the tube was inverted to mix. An equal volume of anhydrous ethanol was then added to the supernatant, and the mixture was thoroughly mixed. The entire volume was then transferred to a new adsorption column, allowed to stand for 2 minutes, and centrifuged at 10,000 rpm for 1 minute. The centrifuged liquid was discarded. The adsorption column was returned to the collection tube, 500 μL of wash buffer was added, and the column was centrifuged at 10,000 rpm for 1 minute. The waste liquid was discarded, and the previous step was repeated. Centrifuge at 12,000 rpm for 2 minutes without load. Then, transfer the adsorption column to a new centrifuge tube, add 50 μL of TE buffer, let stand for 3 minutes, and then centrifuge at 12,000 rpm for 2 minutes to obtain the DNA product. Store the DNA product at -20°C.

[0047] (3) DNA level detection Primers 377 / 378-F / R (Table 8) were designed using software to detect the vector fragment in maize leaves of each transgenic line, and a PCR program was designed for verification (Table 9).

[0048] Table 8 Primers for detecting transgenic maize Table 9 PCR system (25 μL) (4) Real-time quantitative PCR (RT-qPCR) detection Same as Example 1.

[0049] Table 10 Primers for SCMV and MCMV detection result 1. Constructing vectors for silencing and overexpressing miR397 The STTM sequence for silencing miR397 was designed based on the miR397 sequence. The specific method is as follows: the miR397 sequence was reverse-complemented, and three ATG bases were added between the 10-11 bases at the 3' end of the resulting sequence to obtain TM. Primers STTM-397-F / R were designed using the TM sequence, and a 108-bp fragment was amplified using a 48-nt spacer sequence as a template. This fragment was then ligated into the maize expression vector pEGOEP (Beijing Bomei Xingao Technology Co., Ltd.). The nucleotide sequence of the 108-bp fragment is: GTCGACCATCAACGCTGAGTCGCTCAATGAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATCATCAACGCTGAGTCGCTCAATGAGGATCC, denoted as SEQ ID NO.25.

[0050] Using the rice miR528 precursor as a backbone, primers were designed based on the pre-miRNA and miR397 sequences. The miR397 sequence was overexpressed using artificial miRNA. At the same time, an overexpression vector was constructed using isosigmazyme and a polycistronic (triple) approach.

[0051] Table 11 Primers required for constructing vectors for silencing and overexpressing miR397 2. Obtaining transgenic maize with silenced and overexpressed miR397 The constructed vectors were sent to the company for genetic transformation of maize B104 inbred lines. This resulted in 17 transgenic T0 generation maize lines overexpressing miR397 and 20 transgenic T0 generation maize lines silencing miR397. DNA level analysis of the transgenic maize showed that 12 of the 17 transgenic maize lines overexpressing miR397 were positive, and 17 of the 20 transgenic maize lines silencing miR397 were positive. The target band size for overexpressing miR397 was approximately 250 bp, and the detected band size for silencing miR397 was approximately 100 bp, indicating that the inserted miR397 vector fragment was detected in the transgenic maize leaves. Figure 5 ).

[0052] The expression of miR397 in silenced and overexpressed transgenic maize was detected by RT-qPCR. The results showed that miR397 accumulation was significantly upregulated in the overexpressing maize lines OE397-1 and OE397-2, while miR397 accumulation was significantly downregulated in the silenced maize lines STTM397-10 and STTM397-11. Figure 6 Subsequently, the miR397 target gene was analyzed using RT-qPCR. ZmCBL The expression of [the information] was examined, and the results showed that... ZmCBL Expression was downregulated in the OE397-1 and OE397-2 lines, and upregulated in the STTM397-10 and STTM397-11 lines. Figure 7 ).

[0053] 3. miR397 negatively regulates maize's resistance to viruses. Transgenic maize lines OE397-1, OE397-2, STTM397-10, and STTM397-11 were selected, with the maize B104 inbred line as a control. They were inoculated with SCMV and MCMV, respectively. On the 7th day after inoculation, the severity of disease symptoms on maize leaves was observed and samples were photographed and collected.

[0054] Compared to the B104 control, SCMV inoculation alone resulted in more pronounced mosaic symptoms in the overexpressing maize lines OE397-1 and OE397-2, with lesions covering the entire leaf and accompanied by more significant chlorosis. Conversely, the silenced lines STTM397-10 and STTM397-11 showed milder symptoms compared to B104. Figure 8 A). Five of the same strains were also selected for individual MCMV inoculation, and disease symptoms were observed. Compared with B104, the OE397-1 and OE397-2 maize strains showed more severe chlorotic mottling symptoms on their leaves, with enlarged chlorotic spots exhibiting a yellow-green mottled appearance. The symptoms of STTM397-10 and STTM397-11 were relatively milder than those of B104. Figure 8 B).

[0055] Dual detection of viral RNA and protein levels was performed on infected maize. First, the viral accumulation level was detected using real-time quantitative PCR with detection primers SCMV-F / R and MCMV-F / R (Table 10). The results showed that SCMV expression was significantly higher in the overexpressing maize lines OE397-1 and OE397-2. Conversely, SCMV expression was significantly reduced in the silenced maize lines STTM397-10 and STTM397-11. Figure 9A). Similarly, in OE397-1 and OE397-2 maize, MCMV was significantly upregulated, while in STTM397-10 and STTM397-11 maize, MCMV was downregulated. Figure 9 B). Subsequently, the accumulation levels of MCMV and SCMV coat protein (CP) were detected by Western blotting. The results showed that the SCMV protein accumulation levels in OE397-1 and OE397-2 were significantly higher than those in control B104, while the SCMV protein accumulation levels in STTM397-10 and STTM397-11 were significantly lower than those in control B104. Figure 9 C). Similarly, the expression trend of MCMV in transgenic maize lines is the same as that of SCMV. Figure 9 D). These results indicate that miR397 negatively regulates maize's resistance to viruses.

[0056] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0057] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0058] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of miR397 in enhancing virus resistance in maize, characterized in that, The nucleotide sequence of miR397 is shown in SEQ ID NO.

24.

2. The application according to claim 1, characterized in that, Viral resistance is enhanced by inhibiting miR397 expression.

3. The application according to claim 2, characterized in that, Methods to suppress miR397 expression include the short tandem target simulation method.

4. The application according to claim 3, characterized in that, The STTM primers used in the short tandem simulated target method are shown in SEQ ID NO.15~SEQ ID NO.

16.

5. The application according to claim 4, characterized in that, In the short tandem simulated target method, the sequence shown in SEQ ID NO.17 is used as a template, and a 108-bp fragment is amplified using the STTM primers, ligated into an expression vector, and transformed into maize to inhibit miR397 expression; The nucleotide sequence of the 108-bp fragment is shown in SEQ ID NO.

25.

6. The application according to claim 1, characterized in that, The viruses include sugarcane mosaic virus and maize chlorotic mottle virus.

7. The application according to claim 6, characterized in that, Enhanced virus resistance in maize resulted in milder mosaic symptoms and reduced virus accumulation in maize leaves that suppressed miR397 expression compared to wild-type leaves.

8. A method for enhancing virus resistance in maize, characterized in that, Virus resistance in maize is enhanced by inhibiting miR397 expression as described in claim 1; The viruses include sugarcane mosaic virus and maize chlorotic mottle virus.

Images