Method for inhibiting TRIM28 gene expression, TRIM28-targeted gRNA (guide Ribonucleic Acid) and application

Abstract

The invention relates to the technical field of biology, and discloses a method for inhibiting TRIM28 gene expression, which comprises the following steps: co-transfecting gRNA and Cas9 nuclease into a cancer cell line to realize the knockout of TRIM28; wherein the gRNA is specifically targeted at a specific site of the TRIM28; the nucleotide sequence of the gRNA is as shown in SEQ ID NO. 1; the invention also relates to the application of the gRNA of the target TRIM28 and the gRNA in preparation of a product for knocking out the cancer cell TRIM28 gene. Specific screening of gRNA of the cancer promoting gene TRIM28 is achieved, the nucleotide sequence of the gRNA is shown as SEQ ID NO.1, the gRNA has the remarkable advantages of high specificity and low miss-target property, knockout of the TRIM28 gene in a cancer cell line is achieved, expression of the TRIM28 gene in the cancer cell line is inhibited, and the gRNA can be applied to preparation of cancer inhibiting drugs.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for inhibiting TRIM28 gene expression and a gRNA targeting TRIM28 and its application. Background Technology

[0002] Prostate cancer is one of the most common malignant tumors in men worldwide, with its incidence and mortality rates rising annually. The development of prostate cancer is associated with multiple factors, including genetic susceptibility, environmental influences, and endocrine factors. Although existing treatments (such as surgery, radiotherapy, and hormone therapy) have achieved good results in some patients, the risk of drug resistance and recurrence remains. Tumor drug resistance is one of the challenges faced in clinical practice, thus urgently requiring new treatment strategies.

[0003] TRIM28 (Tripartite Motif Containing 28) is a transcriptional regulator that plays a crucial role in the development and progression of various cancers. For example, the Chinese patent CN117143257A, which describes the TRIM28-KRAB-ZNF10 binary complex, its preparation method, and a kit for prostate cancer screening, demonstrates that TRIM28 participates in biological processes such as tumor cell proliferation, apoptosis, migration, and invasion by regulating the expression of downstream genes. Abnormal expression of TRIM28 in prostate cancer cells is associated with tumor invasiveness and poor prognosis, suggesting it may serve as a key therapeutic target.

[0004] However, there are few or no existing methods for directly targeting and inhibiting the oncogenic sites of the TRIM28 gene. The main reasons are: (1) The TRIM28 gene is long and has highly conserved domains, which can easily lead to off-target effects when screening gRNAs; (2) If the selected gRNA sequence is homologous to other genes, it may cause non-specific knockdown, which can easily lead to errors in experimental results.

[0005] Therefore, it is currently very difficult to directly inhibit the oncogenic sites of the TRIM28 gene, as there is no gRNA that can precisely target the oncogenic sites of the TRIM28 gene. Summary of the Invention

[0006] The purpose of this invention is to provide a method for inhibiting TRIM28 gene expression and a gRNA targeting TRIM28 and its application, so as to solve the problem that the existing technology has great difficulty in screening gRNA and lacks gRNA technology that can accurately target the TRIM28 gene.

[0007] To solve the above-mentioned technical problems, the present invention specifically provides the following technical solution: This invention provides a method for inhibiting TRIM28 gene expression, comprising the following steps: gRNA and Cas9 nuclease were co-transfected into cancer cell lines to achieve the knockout of TRIM28; The gRNA specifically targets a specific site of TRIM28. The nucleotide sequence of the gRNA is shown in SEQ ID NO.1.

[0008] In a preferred embodiment of the present invention, the cancer cell line is a prostate cancer cell line.

[0009] In a preferred embodiment of the present invention, the prostate cancer cell line is DU145 or PC3.

[0010] This invention provides a method for inhibiting TRIM28 gene expression and its application in the preparation of products that inhibit TRIM28 expression in prostate cancer cell lines.

[0011] This invention provides a gRNA that targets TRIM28, wherein the gRNA specifically targets a specific site of TRIM28; The nucleotide sequence of the gRNA is shown in SEQ ID NO.1.

[0012] This invention provides an application of gRNA in the preparation of products that knock out the TRIM28 gene in cancer cells.

[0013] As a preferred embodiment of the present invention, the product is used to inhibit the proliferation of cancer cell lines; The cancer cell line is a prostate cancer cell line.

[0014] As a preferred embodiment of the present invention, the product contains the gRNA and Cas9 nuclease.

[0015] Compared with the prior art, the present invention has the following advantages: This invention is the first to propose directly targeting the TRIM28 gene as a base editing therapy for prostate cancer. By combining TRIM28-targeted gene editing technology, gRNA that can specifically target the TRIM28 gene is obtained. After co-transfecting the gRNA with a drug composed of Cas9 nuclease into cancer cell lines, the TRIM28 gene can be knocked out in the cancer cell lines. The expression of the TRIM28 gene in the cancer cell lines is inhibited, thereby inhibiting the growth and metastasis of tumor cells and achieving an anti-cancer effect. This invention is based on the CRISPR / Cas9 system. Through in-depth bioinformatics analysis, the target sequences of TRIM28 were comprehensively screened and evaluated, so that the selected gRNA targets only the specific site of TRIM28 without binding to other gene regions. The nucleotide sequence of the obtained gRNA is shown in SEQ ID NO.1. This gRNA has significant advantages of high specificity and low off-target effects, and can be applied to the preparation of anticancer drugs. Attached Figure Description

[0016] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings in the following description are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0017] Figure 1 This invention provides a Western blot image of the protein after transfecting TRIM28-gRNA3 into DU145 prostate cancer cells; Figure 2 This invention provides a Western blot image of the protein after transfecting PC3 prostate cancer cells with TRIM28-gRNA3; Figure 3 This invention provides a statistical chart comparing the cell proliferation capacity of DU145 cell lines transfected with gRNA3 with those of untransfected DU145 cell lines. Figure 4 This invention provides a statistical chart comparing the cell proliferation capacity of PC3 cell lines co-transfected with gRNA3 and Cas9 nuclease with untransfected PC3 cell lines; Figure 5 This invention provides a statistical chart comparing the diameter of organoids at different time points in organoid formation experiments of untreated and TRIM28-gRNA-transfected prostate cancer cells; Figure 6 This invention provides staining images of transfected PC3 and DU145 prostate cancer cells with TRIM28-gRNA3, respectively. Figure 7 The present invention provides staining images of transfecting TRIM28-gRNA3 into PC3 and DU145 prostate cancer cells, respectively; Figure 8 This invention provides statistical graphs of cell proliferation activity after transfection of TRIM28-gRNA3 into PC3 and DU145 prostate cancer cells, respectively. Figure 9This invention provides a statistical chart comparing tumor volume in mice after subcutaneous injection of tumor cells from the control group and the group transfected with TRIM28-gRNA3. Figure 10 This invention provides a statistical chart comparing the tumor weight of mice after subcutaneous injection of tumor cells from the control group and the group transfected with TRIM28-gRNA3 until the tumors grew to a suitable size. Detailed Implementation

[0018] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0019] This invention provides a method for inhibiting TRIM28 gene expression, including effectively knocking out TRIM28 gene expression in prostate cancer cells using a CRISPR / Cas9 system.

[0020] Specifically, based on the CRISPR / Cas9 system, a comprehensive screening and evaluation of the target sequences of TRIM28 was conducted through in-depth bioinformatics analysis to ensure that the selected gRNAs target only specific sites of TRIM28 and do not bind to other gene regions. The nucleotide sequences of the obtained gRNAs are shown in SEQ ID NO.1.

[0021] SEQ ID NO.1: CTGCCAGCTCAATGCCCACA The CBE gRNA of this invention, through precise design and optimization, possesses significant advantages in high specificity and low off-target effects.

[0022] This invention utilizes base editing technology to effectively knock out the expression of the TRIM28 gene through a specific gRNA sequence. It has advantages such as high specificity and low off-target effect, and can achieve precise knockout of the TRIM28 gene at the cellular level.

[0023] The validation results of the aforementioned base editor in various prostate cancer cell lines and animal models show that the editing effect is highly concentrated on the target site, and no obvious non-specific mutations were detected. This specific design and validation data fully support the precision and safety of this invention in targeted therapy for TRIM28, providing an effective gene editing tool with low off-target effects.

[0024] The method for inhibiting TRIM28 gene expression provided by this invention specifically includes the following steps: The above gRNA was co-transfected with Cas9 nuclease into cancer cell lines to knock out the oncogenic site of the TRIM28 gene in the cell lines. By inhibiting the expression of TRIM28, the proliferation and metastasis of cancer cells were significantly reduced, which has good prospects for clinical application.

[0025] The cancer cell lines are prostate cancer cell lines, specifically DU145, PC3, etc.

[0026] This invention is the first to directly target the TRIM28 gene as a base editing therapy for prostate cancer. Combining TRIM28-targeted gene editing technology, using CRISPOR to predict highly specific sgRNAs, and preferentially selecting targets close to PAM, gRNAs that specifically target the TRIM28 gene are obtained. After co-transfecting the gRNA with a drug composed of Cas9 nuclease into cancer cell lines, the TRIM28 gene can be knocked out, and the expression of the TRIM28 gene in the cell lines is inhibited, thereby inhibiting the growth and metastasis of tumor cells and achieving an anti-cancer effect.

[0027] The above-mentioned methods or drugs can provide more effective treatment options and new intervention methods for prostate cancer patients.

[0028] The drugs mentioned above related to the application of gRNA can also be extended to the treatment research of other types of tumors with high TRIM28 expression.

[0029] Compared to other gRNAs, this gRNA has significant advantages in high specificity and low off-target activity, which are illustrated below with examples: Example 1: Cell transfection: The gRNA was named gRNA3, and gRNA3 was co-transfected with Cas9 nuclease into DU145 and PC3 to achieve TRIM28 knockout; Screening and identification: The knockout effect of the TRIM28 gene was confirmed by PCR and sequencing, and its impact on cell proliferation, migration and invasion was evaluated.

[0030] Based on Example 1, the following further discloses a verification method for functional experiments to address the impact caused by the above-mentioned problems.

[0031] 1. Protein extraction and Western blot analysis methods (1) Protein extraction and quantification a. Tissue / cell lysis: Place tumor tissue, adjacent normal tissue or cell pellet on ice and add pre-prepared lysis buffer (RIPA : protease inhibitor : PMSF : phosphatase inhibitor A / B = 100 : 1 : 1 : 1).

[0032] The lysis system was placed on ice for 40 min, vortexed every 10 min, and then subjected to sonication. The lysate was then centrifuged at 12,000 rpm for 10 min in a pre-cooled centrifuge to 4°C, and the supernatant protein solution was collected. Aliquots were then stored at -80°C for later use.

[0033] b. Protein concentration determination: Protein concentration was determined using a BCA kit, and the sample concentration was adjusted to 20 μg / μL. 5×SDS-PAGE Loading Buffer was added at a 4:1 ratio, and the mixture was denatured at 95℃ for 5 min. The sample was then stored at -20℃.

[0034] (2) SDS-PAGE electrophoresis a. Gel preparation: Prepare separating gel and stacking gel of appropriate concentration and allow them to stand for polymerization.

[0035] b. Sample loading and electrophoresis: Load 20-30 μg of protein into each well, and add 4 μL of pre-stained protein marker to both lanes. Electrophoresis conditions: Stacking gel stage: 90 V constant voltage for 15-30 min; separating gel stage: 120 V constant voltage for 1.5 h.

[0036] (3) Transfer and sealing a. Wet transfer: Cut gel strips within the target molecular weight range, and activate the PVDF membrane with methanol for 15 seconds. Transfer conditions: 300 mA constant current, 90 min (adjust time according to molecular weight).

[0037] b. Blocking: After transfer, the PVDF membrane was immersed in 5% skim milk (prepared by TBST) and blocked at room temperature for 1 h.

[0038] (4) Antibody incubation and detection a. Primary antibody incubation: After blocking, wash the membrane 3 times with TBST (10 min / time). Cut the PVDF membrane according to the molecular weight of different proteins and the position of markers. Place the cut bands in the primary antibody of the corresponding protein and incubate overnight in a shaker at 4°C.

[0039] b. Secondary antibody incubation: Wash the membrane 3 times with TBST (10 min / time), incubate with HRP-labeled secondary antibody at room temperature for 1 h, and wash the membrane 3 times again with TBST (10 min / time).

[0040] c. Development and Quantification: The ECL chemiluminescent reagent was uniformly coated on the membrane surface, and the signal was acquired using the ChemiDoc XRS+ imaging system. The gray values ​​of the bands were analyzed using Image Lab software, and normalization was performed using β-actin as an internal reference.

[0041] 2. CCK-8 cell proliferation detection method DU145 or PC3 cells were seeded into 96-well plates, with 3000 cells per well. Working solutions were prepared by mixing CCK-8 stock solution with serum-free and phenol red-free 1640 medium at a volume ratio of 1:10 under dark conditions. After 24, 48, 72, and 96 hours of cell seeding, the original medium was discarded, and the cells were gently washed twice with pre-cooled PBS. 100 μL of CCK-8 working solution was added to each well. PBS was filled into the well edges as an optical control. The 96-well plates were completely wrapped with aluminum foil and incubated at 37°C in the dark for 2 hours.

[0042] After incubation, absorbance was measured at 450 nm using a NanoDrop 2000 spectrophotometer. The experimental design employed a completely randomized block design, with 6 replicates per group, and each experiment was independently repeated 3 times.

[0043] 3. Clonal Formation Detection Methods DU145 and PC3 cells were seeded in 6-well plates at a density of 1000 cells per well. 1640 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution was added, and the plates were incubated statically at 37°C and 5% CO2. The medium was replaced with fresh medium every 3 days, and cell colonies were observed. After 2 weeks of culture, the cell colonies were observed to determine their formation, size, and number. The original medium was replaced with pre-cooled PBS to wash the cells. After air-drying at room temperature for approximately 2 hours, the cells were fixed with 4% paraformaldehyde for approximately 30 minutes to stabilize their morphology. The cells were then washed again with PBS to remove the fixative.

[0044] Cells were stained with crystal violet solution. 1 mL of crystal violet solution was added to each well, and staining was performed at room temperature for 30 min. Cells were then slowly rinsed with running water until the background was colorless, and allowed to air dry at room temperature. Finally, the size and number of clonal colonies were observed. At least three biological replicates were required for the experiment, and edge effects should be excluded.

[0045] 4. Transwell testing method (1) Cell migration experiment a. Cell starvation treatment: When the cell confluence reaches 80%, discard the culture medium and wash twice with PBS. Replace with serum-free 1640 culture medium and starve the cells at 37°C and 5% CO2 for 12-16 hours to synchronize the cell cycle and eliminate interference from serum growth factors.

[0046] b. Transwell chamber equilibration: Place the Transwell chamber in a 24-well plate, add 600 μL of 1640 medium containing 10% FBS to the lower chamber, and incubate for 1 hour to equilibrate the hydrophilicity of the membrane surface.

[0047] c. Cell seeding and migration: Cells were digested with trypsin, centrifuged, and resuspended in serum-free medium, adjusting the density to 1×10⁶ cells / year. 5 cells / mL. 2 × 10⁶ cells / mL inoculated per upper chamber. 4 200 μL of cells were incubated at 37°C for 24 hours.

[0048] d. Fixation, staining, and counting: Remove the chamber, wash twice with PBS, fix with 4% paraformaldehyde at room temperature for 15 min, and wash again with PBS. Stain with crystal violet for 30 min, gently rinse with running water, and wipe non-migrating cells in the upper chamber with cotton swabs. Take pictures of 5 randomly selected fields of view under a microscope, and count the number of migrating cells using ImageJ software. The experiment was repeated 3 times.

[0049] (2) Cell invasion experiment a. Cell starvation treatment: When the cell confluence reaches 80%, discard the culture medium and wash twice with PBS, replace with serum-free 1640 culture medium, and starve the cells at 37°C and 5% CO2 for 12-16 hours to synchronize the cell cycle and eliminate interference from serum growth factors.

[0050] b. Matrigel coating: Thaw Matrigel overnight at 4°C, and dilute pre-chilled pipette tips at a ratio of 1:8 in serum-free 1640. Add 60 μL of diluted gel to each Transwell compartment and incubate at 37°C for 2 hours to form a uniform basement membrane.

[0051] c. Transwell chamber equilibration: Place the Transwell chamber in a 24-well plate, add 600 μL of 1640 medium containing 10% FBS to the lower chamber, and incubate for 1 hour to equilibrate the hydrophilicity of the membrane surface.

[0052] d. Cell seeding and invasion: Cells were digested with trypsin, centrifuged, and resuspended in serum-free medium, with the density adjusted to 1×10⁶ cells / year. 5 cells / mL. 4 × 10⁶ cells / mL inoculated per upper chamber. 4 200 μL of cells were incubated at 37°C for 24 hours.

[0053] e. Fixation, staining, and counting: Remove the chamber, wash twice with PBS, fix with 4% paraformaldehyde at room temperature for 15 min, and wash again with PBS. Stain with crystal violet for 30 min, gently rinse with running water, and wipe non-migrating cells in the upper chamber with cotton swabs. Take pictures of 5 randomly selected fields of view under a microscope, and count the number of migrating cells using ImageJ software. The experiment was repeated 3 times.

[0054] For details, please see [link / details]. Figures 3-8 As shown.

[0055] Figure 3A statistical chart comparing the cell proliferation capacity of DU145 cell lines transfected with gRNA3 with that of untransfected DU145 cell lines; Figure 4 A statistical chart comparing the cell proliferation capacity of PC3 cells co-transfected with gRNA3 and Cas9 nuclease with that of untransfected PC3 cells; Figure 5 A statistical comparison of organoid diameter at different time points in organoid formation experiments of prostate cancer cells in the untreated group and the group transfected with TRIM28-gRNA.

[0056] Figure 6 The staining images are those obtained after transfecting TRIM28-gRNA3 into PC3 and DU145 prostate cancer cells, respectively, in a clonogenic assay. Figure 7 The staining images are from Transwell assays of prostate cancer cells transfected with TRIM28-gRNA3, respectively, for PC3 and DU145 cells. Figure 8 Statistical graph of cell proliferation activity after transfection of TRIM28-gRNA3 into PC3 and DU145 prostate cancer cells, respectively.

[0057] from Figures 3 to 8 As can be seen from Example 1, the gRNA successfully knocked out the TRIM28 gene in the cell line.

[0058] TRIM28, as a co-repressor, typically works in conjunction with other proteins, such as KRAB zinc finger proteins. Knockdown of TRIM28 may prompt cells to compensate by activating other proteins or pathways to maintain survival and basic functions. This compensatory mechanism makes it difficult to accurately assess the direct impact of TRIM28 knockdown when screening gRNAs.

[0059] 5. In vivo experiments in mice In the xenotransplantation model, 4-week-old SPF-grade male BALB / c nude mice (Shulaibao, Wuhan, China) were acclimatized and then subcutaneously injected with approximately 1×10⁻⁶ mmol / L into the right axilla. 7 Logarithmic growth phase cells (PBS suspension, 100 μL). Starting from day 15 after inoculation, the long diameter (L) and short diameter (W) of the tumor were measured every 72 hours using digital calipers (accuracy 0.01 mm), while monitoring changes in mouse body weight (fluctuation range ≤15%). After 40 days of continuous observation, the basic experimental group was euthanized (CO2 inhalation method), and the tumor was completely removed and weighed (electronic balance accuracy 0.1 mg).

[0060] The statistical results of tumor volume comparison between the control group and the TRIM28-gRNA3 transfected group after subcutaneous injection of tumor cells in mice are shown in the figure. Figure 9 As shown.

[0061] The statistical results of tumor weight comparison between the control group and the TRIM28-gRNA3 transfected group after subcutaneous injection of tumor cells in mice and after tumor growth to an appropriate size are shown in the figure. Figure 10 As shown.

[0062] The method for effectively knocking out TRIM28 gene expression in prostate cancer cells provided in this embodiment demonstrates that the screened gRNA has advantages such as high specificity and low off-target effects. It targets only the specific site of TRIM28 without binding to other gene regions, enabling precise knockout of the TRIM28 gene at the cellular level. This can inhibit the growth and metastasis of tumor cells and significantly reduce the proliferation and metastasis of prostate cancer cells. This provides a new method for inhibiting TRIM28 gene expression within cells and also provides an application of gRNA in the preparation of anti-prostate cancer products, offering a new avenue for the development of anti-cancer drugs.

[0063] The above embodiments are merely exemplary embodiments of this application and are not intended to limit this application. The scope of protection of this application is defined by the claims. Those skilled in the art can make various modifications or equivalent substitutions to this application within its substance and scope of protection, and such modifications or equivalent substitutions should also be considered to fall within the scope of protection of this application.

Claims

1. A method for inhibiting TRIM28 gene expression, characterized in that, Includes the following steps: gRNA and Cas9 nuclease were co-transfected into cancer cell lines to achieve the knockout of TRIM28; The gRNA specifically targets a specific site of TRIM28. The nucleotide sequence of the gRNA is shown in SEQ ID NO.

1.

2. The method for inhibiting TRIM28 gene expression according to claim 1, characterized in that, The cancer cell line is a prostate cancer cell line.

3. The method for inhibiting TRIM28 gene expression and the application of the TRIM28-targeting gRNA according to claim 2, characterized in that, The prostate cancer cell line is DU145 or PC3.

4. The application of the method for inhibiting TRIM28 gene expression as described in claims 1-3 in the preparation of a product for inhibiting TRIM28 expression in prostate cancer cell lines.

5. A gRNA targeting TRIM28, characterized in that, The gRNA specifically targets a specific site on TRIM28; The nucleotide sequence of the gRNA is shown in SEQ ID NO.

1.

6. The use of the gRNA as described in claim 5 in the preparation of a product that knocks out the TRIM28 gene in cancer cells.

7. The application according to claim 6, characterized in that, The product is used to inhibit the proliferation of cancer cell lines; The cancer cell line is a prostate cancer cell line.

8. The application according to claim 7, characterized in that, The product contains the gRNA and Cas9 nuclease.

Images