A ga-sensitive male sterile gene and its application in corn hybrid seed production

By developing GA-sensitive male sterility gene mutants ggms3 and ggms4, the stability problem of maize male sterility lines has been solved, enabling low-cost and high-efficiency maize hybrid seed production, expanding the types of sterile lines, and improving the controllability and stability of seed production.

CN121204092BActive Publication Date: 2026-03-24ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-28
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

The lack of stable male-sterile maize lines in existing technologies leads to high seed production costs and low efficiency. Furthermore, photoperiod- and temperature-sensitive male-sterile lines are sensitive to environmental temperature, which can easily lead to seed production failure.

Method used

Develop GA-sensitive male sterility genes, and through mutants ggms3 and ggms4, prevent the anthers and silks of maize male flowers from elongating. Spraying gibberellin restores fertility, thus achieving sterile hybrid seed production.

Benefits of technology

It has reduced seed production costs, improved seed production efficiency, avoided the impact of environmental factors, provided new types of sterile lines, and offered a new direction for maize hybrid seed production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121204092B_ABST
    Figure CN121204092B_ABST
Patent Text Reader

Abstract

The present application relates to a GA sensitive male sterile gene and its application in corn hybrid seed production, and belongs to the technical field of plant gene breeding. The open reading frame sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 2. The mutation of the gene makes the anther filaments of the male flowers of the recipient plants unable to stretch out and shed pollen, and further makes the recipient plants exhibit male sterility. The present application finds and verifies that the mutation of the GA sensitive male sterile gene can cause the corn to exhibit male sterility, and the single amino acid substitution mutant material has no significant change in the vegetative growth and seed setting amount, but still stably exhibits the phenotype of GA sensitive male sterility. The obtained mutant material can be used for hybrid seed production, and spraying gibberellin when the corn is in the stage of heading for one week can restore the fertility of the mutant material and be used for self-crossing breeding, thereby providing a new direction and theoretical basis for corn hybrid seed production.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant gene breeding, and particularly relates to a GA-sensitive male sterility gene and application thereof in hybrid seed production of maize. BACKGROUND

[0002] Maize is the highest yield crop in the world, which is largely due to the popularization and planting of hybrid maize. Hybrid maize has significant heterosis, but since there is no available male sterile line at present, the preparation of hybrid maize mainly relies on artificial detasseling to avoid self-pollination, which significantly increases the seed production cost of maize, restricts the degree of mechanization of seed industry, and is not conducive to the development of seed industry and agriculture.

[0003] At present, the male sterile lines successfully applied in hybrid seed production include two types of nuclear-cytoplasmic male sterility and photothermal sensitive male sterility. The gene locus of nuclear-cytoplasmic male sterility is very limited, and the three-line method hybridization using the nuclear-cytoplasmic male sterile line needs to use the maintainer line to assist the sterile line breeding, and the seed production process is complicated. The two-line method hybridization seed production based on the photothermal sensitive sterile line can use different light and temperature conditions to perform selfing and hybrid seed production of sterile lines, which greatly simplifies the seed production process, but the gene is sensitive to environmental temperature, and the fertility recovery caused by weather changes can lead to seed production failure.

[0004] At present, the excavation and cultivation of maize male sterility genes still refer to the ideas of rice, and no nuclear-cytoplasmic sterile or photothermal sensitive sterile material and gene that can be stably used in commerce has been obtained. In order to excavate other condition-dependent male sterility genes and cultivate new type of male sterile lines, so as to provide a new direction for hybrid seed production of maize, the present application provides a GA-sensitive male sterility gene and application thereof in hybrid seed production of maize. SUMMARY

[0005] The purpose of the present application is to provide a GA-sensitive male sterility gene and application thereof in hybrid seed production of maize in order to solve the above problems.

[0006] The present application achieves the above-mentioned purpose through the following technical solutions:

[0007] The present application provides application of a GA-sensitive male sterility gene in regulating pollen shedding of maize male flowers, the nucleotide sequence of the open reading frame (ORF) of the GA-sensitive male sterility gene is shown in SEQ ID NO. 1, and the mutation of the gene can inhibit pollen shedding of maize male flowers.

[0008] The present application also provides application of the above-mentioned GA-sensitive male sterility gene in producing male sterility traits of maize, and the mutation of the gene makes maize produce male sterility traits.

[0009] The application also provides application of the GA-sensitive male sterile gene in corn male sterile hybrid seed production.

[0010] The application also provides application of the GA-sensitive male sterile gene in corn male sterile hybrid seed production.

[0011] As a further optimization of the application, the GA-sensitive male sterile gene is mutated, so that the mutant plant filament cannot elongate, the anther cannot dehisce and shed pollen, and the mutant plant exhibits male sterility.

[0012] As a further optimization of the application, the mutation is any one of G to A mutations at positions 433 or 434 of the open reading frame of the GA-sensitive male sterile gene.

[0013] As a further optimization of the application, the mutation is generated by EMS mutagenesis of a corn inbred line Z58, and the obtained mutant plant is ggms3 and ggms4 The corresponding corn seeds ggms3 and ggms4, i.e., Zea mays L. ggms3 and Zea mays L. ggms4, are preserved in the China Center for Type Culture Collection, and the preservation numbers are CCTCC No: P202524 and CCTCC No: P202530, respectively.

[0014] As a further optimization of the application, spraying the mutant plant with gibberellin or an agricultural growth regulator containing gibberellin can restore filament elongation and male fertility at one week after heading.

[0015] As a further optimization of the application, the plant height, biomass, female stick size, and seed setting amount of the mutant plant have no significant difference from those of the wild type.

[0016] The application also provides application of the mutant plant in corn male sterile hybrid seed production and seed multiplication.

[0017] The application also provides a method for breeding a corn male sterile line, which comprises gene editing treatment of a corn inbred line to cause G to A mutation at positions 433 or 434 of the GA-sensitive male sterile gene, and the obtained mutant plant is the male sterile line.

[0018] The application also provides a method for breeding a corn male sterile line and corn male sterile hybrid seed production, which comprises using the above method to breed a corn male sterile line and corn male sterile hybrid seed production, using the corn male sterile line as the female parent, a fertile corn inbred line as the male parent, and field planting according to the specifications of hybrid seed production to achieve corn male sterile hybrid seed production.

[0019] The present invention also provides a method for cultivating maize male-sterile lines using the above method and for propagating maize male-sterile seeds. One week after tasseling, the fertility of the maize male-sterile lines is restored by spraying gibberellin or an agricultural growth regulator containing gibberellin, and maize male-sterile seeds are propagated.

[0020] The beneficial effects of this invention are as follows:

[0021] This invention obtained two GA-sensitive male-sterile mutants by screening the pollen EMS mutagenesis of Z58, a backbone inbred line of the commonly used maize female parent. ggms3 and ggms4 And verified ggms3 and ggms4 The mutations were all located in Zm00001eb379120 Gene.

[0022] Mutations result in the inability of the filaments to elongate and the anthers to dehisce and release pollen in maize male flowers, thus causing male sterility. The obtained mutant materials exhibit stable sterility, allowing for hybridization and seed production without emasculation, reducing production costs and improving efficiency. Spraying the mutant plants with gibberellin one week after tasseling restores filament elongation and male fertility; this operation is controllable and avoids the problem of sterile materials regaining fertility under environmental and temperature influences, leading to seed production failure. This invention expands the types of two-line male-sterile lines, providing a new direction and theoretical basis for maize hybrid seed production, and is of great significance to the development of the maize seed industry. Attached Figure Description

[0023] Figure 1 The anthers of the pollen-shedding mutant were unable to protrude from the cervical shell;

[0024] Figure 2 Spraying the mutant male ear with GA once can restore its pollen-shedding ability;

[0025] Figure 3 for ggms1 Map-based cloning gene localization diagram;

[0026] Figure 4 The mutation sequences of each mutant are shown in the diagram.

[0027] Figure 5 Phenotypes of each mutant and wild type at the heading and pollen shedding stage;

[0028] Figure 6 for ggms3 and ggms4 The size and seed production of females were not significantly different from those of the wild type.

[0029] Figure 7 for ggms3 and ggms4 It can stably maintain the male-sterile phenotype. Detailed Implementation

[0030] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0031] I. Experimental Materials

[0032] Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0033] II. Experimental Methods

[0034] 1. Obtaining and fertility identification of GA-sensitive male sterile mutants

[0035] Through EMS mutagenesis, propagation, and phenotypic screening of pollen from maize inbred lines B73 and CM1, a GA-sensitive male-sterile mutant was screened in the B73 M2 population. ggms1 GA-sensitive male sterility mutants were screened in the CM1 M2 population. ggms2 ;

[0036] Pollen EMS mutagenesis, propagation, and phenotypic screening were conducted on the Z58 core inbred line, a commonly used maize female parent. Two GA-sensitive male-sterile mutants were identified in the Z58 M2 population. ggms3 , ggms4 ;

[0037] Anthers from male-sterile mutant seedlings one week after heading were stained with KI-I2 and TTC, and the results were observed. Figure 1 As shown in the figure, the mutant pollen has normal viability, but the filaments of the mutant anther cannot elongate, causing the anther to be unable to extend, split open, and release pollen, resulting in male infertility.

[0038] like Figure 2 As shown, spraying the mutant ear with 1 ml of 100 μM GA once a week after heading can restore filament elongation and male fertility.

[0039] 2. Mutation site analysis of GA-sensitive male sterility mutants

[0040] Towards ggms2 to ggms4 One week after the mutant ears emerged, the male ears were sprayed once with 1 ml of 100 μM GA, and their pollen was used to... ggms1 When female rods were pollinated, the F1 offspring produced by testcrosses all maintained the GA-sensitive male-sterile phenotype, indicating that...ggms1 To ggms4 The same gene mutation causes.

[0041] Recycling ggms1 Hybridization with B73, F2 population for mapping was obtained, using 1831 F2 materials (of which 600 GA-sensitive male sterile) and corresponding molecular markers, the gene was located in the interval of 28.10 Mb and 28.95 Mb of chromosome 9 (as shown in Figure 3 ).

[0042] According to the Maize GDB website, there is only one GA pathway related gene Zm00001eb379120 in the interval, encoding a key enzyme of GA synthesis pathway (ent-kaurene oxidase). Using 3 pairs of primers covering the ORF of the gene (F1+R1, F2+R2, F3+R3), PCR was carried out with the mutant genome as the template, and the PCR products were sent to the company for sequencing;

[0043] The primer sequences are as follows:

[0044] SEQ ID NO. 3: F1: TGGTATCCAGACAGGACTTAGA;

[0045] SEQ ID NO. 4: R1: CAGCTCTAGTACCGGTTCCT;

[0046] SEQ ID NO. 5: F2: CAACTAATGGTAATCAGGAGAGA;

[0047] SEQ ID NO. 6: R2: TGCTATTAGCGTGCATACATGT;

[0048] SEQ ID NO. 7: F3: GTGGATTGAAGGCGAAATAGAA;

[0049] SEQ ID NO. 8: R3: CAAAGCTTTGAAAAGTAAGTATGCA;

[0050] The results are shown in Figure 4 , ggms1, ggms2 Insertion and deletion of bases occurred in the splice site and ORF, respectively, resulting in premature termination of translation, ggms3 , ggms4 G to A mutation occurred at the 433rd and 434th base of the ORF, ggms3 and ggms4 The mutation of glycine to arginine and glutamic acid, respectively.

[0051] 3. Verification of the breeding effect of GA-sensitive male sterile mutant

[0052] GA-sprayed GA-unsprayed ggms3 、 ggms4 and Z58 as the female parent, and Chang 7-2 as the male parent for pollination. The results are shown in Figure 5 、 6 The whole plant height, biomass, final size of female ear, and seed setting rate of ggms3 、 ggms4 were not significantly different from Z58. This result indicates that the single base mutation of ggms3 、 ggms4 does not affect the seed production, and has great application potential in seed production.

[0053] The mutant seeds of ggms3, ggms4 were preserved in the China Center for Type Culture Collection, located at No. 299, Bajiyi Road, Wuchang District, Wuhan City, Hubei Province, inside Wuhan University, with a preservation date of September 17, 2025, ggms3, ggms4 The preservation numbers are CCTCC No: P202524 and CCTCC No: P202530, respectively.

[0054] 4. Verification of the phenotypic stability of ggms3 and ggms4

[0055] To confirm the stability of the male sterile phenotype of ggms3 and ggms4 without exogenous application of GA, Z58 was used as the wild type control and planted in a climate chamber together with ggms3 、 ggms4 Different planting condition parameters were set, including low temperature and short day length (23℃, 10h light / 14h dark, 30000Lx, 60% humidity), and high temperature and long day length (32℃, 14h light / 10h dark, 30000Lx, 60% humidity). The results are shown in Figure 7 Under the two planting conditions, ggms3 and ggms4 both can stably maintain the male sterile phenotype.

[0056] Since the spraying of GA is artificially controllable and not affected by external environment, the sterility of ggms3 and ggms4 is stable without spraying GA, which can be used for seed production. Spraying GA once after heading can restore fertility for the multiplication of sterile lines. ggms3 and ggms4 both have the potential to be applied as male sterile lines for corn hybrid seed production.

[0057] ​The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the patent scope of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the protection scope of the present application.

Claims

1. The application of a GA-sensitive male sterility gene in male-sterile hybrid seed production of maize, characterized in that, The nucleotide sequence of the open reading frame of the GA-sensitive male sterility gene is shown in SEQ ID NO.1; The mutation of the GA-sensitive male sterility gene causes the filaments of the anthers of the mutant plants to be unable to elongate and the anthers to be unable to dehisce and release pollen, thus causing the mutant plants to exhibit GA-sensitive male sterility. Spraying the mutant plants with gibberellin or agricultural growth regulators containing gibberellin one week after heading can restore filament elongation and male fertility. The mutant plants showed no significant differences from the wild type in plant height, biomass, female rod size, and seed production. The mutation is either a G-to-A mutation occurring at position 433 or 434 of the open reading frame of the GA-sensitive male sterility gene.

2. The application according to claim 1, characterized in that, The mutation was generated by EMS-induced mutagenesis of the maize inbred line Z58, resulting in mutant plants. ggms3 and ggms4 They are deposited at the China Center for Type Culture Collection, with accession numbers CCTCC No: P202524 and CCTCC No: P202530, respectively.

3. The application of the mutant plant as described in claim 1 in the production and propagation of male-sterile maize hybrids.

4. A method for cultivating male-sterile maize lines, characterized in that: Gene editing is performed on maize inbred lines to induce a G-to-A mutation at position 433 or 434 of the GA-sensitive male sterility gene as described in claim 1. The resulting mutant plants are GA-sensitive male sterile lines.

5. A method for cultivating GA-sensitive male-sterile maize lines using the method described in claim 4 and for conducting male-sterile hybridization for seed production, characterized in that: Using a maize GA-sensitive male-sterile line as the female parent and a fertile maize inbred line as the male parent, the maize was planted in the field according to the standards of hybrid seed production to achieve maize GA-sensitive male-sterile hybrid seed production.