Targeted RNA modification regulation method

Abstract

The present application provides methods of modulating RNA modification by introducing an engineered antisense oligonucleotide targeting the RNA modification site in a host cell, RNA modified erase antisense oligonucleotides for de-modifying a target RNA, and RNA modified erase antisense oligonucleotides for use in the methods, as well as compositions comprising the same.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to a method for targeting RNA modification regulation. BACKGROUND

[0002] RNA modification refers to chemical modifications that occur in different ways on RNA molecules, which play an important role in regulating processes such as transcription, splicing, degradation, and transport of RNA. In recent years, research has found that RNA modification plays a key role in gene expression regulation, cell fate determination, and disease development, becoming one of the research hotspots in the field of biomedicine. Since the first discovery of RNA chemical modification 60 years ago, more than 170 types of RNA modification have been identified, and it has been found that about 10 types exist in mRNA in the mammalian transcriptome. These modifications are added to mRNA by different writing proteins, and a part of erasing proteins is responsible for removing the modifications. RNA modification has an important impact on the stability, splicing, localization, and translation efficiency of mRNA metabolism. Functionally, they affect a wide range of physiological and pathological processes. Individual modification sites may play an important role in specific biological processes, such as cell differentiation. The disorder of individual modification sites is often associated with various diseases, including autoimmune diseases, cancer, and neurodegenerative diseases, indicating that they have significant therapeutic potential in intervention. Studies have shown that individual modification sites have important functions in biological processes such as cell differentiation, and their disorder is associated with various diseases. Recent research has found that most RNA modification enzymes have specific sequence and structure requirements when writing specific RNA modification sites. This means that these enzymes have a certain preference for selectively adding modifications to specific locations of RNA molecules, and this preference may be influenced by the RNA sequence and structure. By understanding the sequence and structure requirements of these modification enzymes, we can better understand their mechanisms in RNA modification and help develop intervention strategies targeting specific modification sites.

[0003] Although there have been efforts to explain the role of individual modification sites in recent years, there are still challenges. Currently, researchers have developed various Cas13 protein-based intervention strategies targeting RNA modification, but existing RNA modification erasing tools have some limitations, such as lack of precision and specificity, global non-specific effects, etc., which limit their application in precise regulation of RNA modification sites. For example, it is difficult to accurately control the position and globality of erasing proteins. Therefore, developing efficient tools to remove modification sites is crucial for revealing the role of individual modification sites and developing targeted interventions for diseases.

[0004] RCMS (reengineered m5C modification system) is a technology based on CRISPR-Cas13d, which is used for targeted modification of m5C methylation and demethylation in specific transcripts. RCMS editors are composed of dCasRx protein localized in the nucleus combined with Tet2 catalytic domain demethylase, which can precisely manipulate the methylation modification of specific m5C sites. For m6A modification, Xia et al. developed a bidirectional dCasRx epitranscriptome editing platform composed of dCasRx protein localized in the nucleus combined with methyltransferase METTL3 or demethylase ALKBH5, which is used for editing m6A modification in specific transcripts. Both of these two schemes use CRISPR-Cas technology to achieve specific editing of RNA modification, targeting m5C and m6A modification respectively, providing new tools and platforms for studying RNA epigenetics. The recently developed dCas13-based RNA modification interference method has some inherent limitations:

[0005] 1. Lack of precise control over removal of specific modification sites: Although Cas13 can guide the eraser to a specific location, the current method lacks the ability to precisely control the eraser to remove specific modification sites. This may result in inaccurate erasure of target modifications, affecting the precise regulation of modification sites;

[0006] 2. Global non-specific effects: Overexpression of dCas13-eraser protein may cause global non-specific effects, such as off-target effects. This means that in addition to the target modification sites, other unrelated modifications or RNA sequences may also be affected, increasing the complexity and uncertainty of experimental results;

[0007] 3. Lack of universal applicability: dCas-based modification removal tools need to be developed separately for each modification, which increases the complexity and time cost of development. Because different modification types may require different eraser proteins and targeted design and optimization, many important RNA modification types such as A-to-I RNA editing, pseuU and m1A currently lack corresponding eraser proteins, so the existing dCas13-based method is not feasible for these modifications;

[0008] 4. Complex development process: The development of dCas-based modification removal tools involves protein engineering, design optimization, and in vitro and in vivo validation, which may require a large amount of time and resources, and there is a risk of failure.

[0009] 5. Unable to precisely quantify regulation: Current dCas-based modification removal tools often lack precise quantitative regulation of the modification removal process, which may result in excessive removal or insufficient removal of modifications, affecting the accuracy and reliability of experimental results.

[0010] 6. Cytotoxicity and immunogenicity: The introduction of foreign proteins such as Cas13 can cause cytotoxicity and immunogenicity reactions, which can have a negative impact on the survival and homeostasis of cells, and can trigger a response of the host immune system.

[0011] 7. Low delivery efficiency, difficult clinical application: CRISPR-Cas13 system achieves the regulation of gene expression by specifically targeting RNA. However, its delivery efficiency in vivo is affected by many factors, including the choice of vector, the size and structure of the CRISPR component, and the specificity of the target tissue for delivery;

[0012] In summary, although the dCas-based removal modification tool has certain potential, its limitations and challenges still exist, and further research and technical improvement are needed to solve them. Therefore, it is an urgent need to develop a more efficient, more accurate, and more targeted RNA modification erasing tool. SUMMARY

[0013] Therefore, the technical problem to be solved by the present application is to provide a method for targeted RNA modification regulation, in order to improve the efficiency and accuracy of RNA modification regulation.

[0014] The method for targeted RNA modification regulation provided by the present application comprises: blocking the recognition and / or action of the RNA modification enzyme on the modification site by using an antisense oligonucleotide (ASO) targeting the modification site.

[0015] The antisense oligonucleotide targeting the modification site is reverse complementary to the modification site and its upstream and downstream fragments. The method for targeted RNA modification regulation described in the present application is mainly used for removing RNA modification, and the antisense oligonucleotide used is also referred to as ERASER or ERASER ASO in some embodiments. In the present application, the ASO is a chemically modified antisense oligonucleotide.

[0016] In the method described in the present application, the RNA modification refers to the modification occurring on the RNA, for example, at least one base in the sequence of the RNA is modified. The RNA modification includes but is not limited to any one of the following: 5-methylcytosine modification, 5-hydroxymethylcytosine modification, N6-methyladenine modification, 7-methylguanine modification, N6,2'-O-dimethyladenine modification, 2-oxymethylation modification, N1-methyladenine modification, pseudouracil modification, hypoxanthine modification, 5-methoxylcytosine modification, 5-methyluracil modification, N4-acetylcytosine modification, 5-fluorouracil modification, N7-methylguanine modification, and 2'-O-methylation modification.

[0017] In the present application, the type of the RNA is not limited, and the targeted RNA is at least one selected from the group consisting of pre-messenger RNA (pre-mRNA), messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), long non-coding RNA (lncRNA), small nuclear RNA (snRNA), micro-interfering RNA (miRNA) and Piwi-interacting RNA (piRNA).

[0018] In the method of the present application, the ASO acts on the modification site, so as to hinder the action of various RNA modification enzymes. For example, the RNA modification enzyme is a methyltransferase, a phosphorylase, an acetylase, a glycosyltransferase, an oxidoreductase, an adenylylase, a hydroxymethylase or an RNA deaminase. For example, the methyltransferase can be NSUN2 / 6 RNA methyltransferase or MELLT3 / 14 RNA methyltransferase.

[0019] In the method of the present application, the length of the antisense oligonucleotide targeting the modification site is not less than 10 bp; preferably, the length of the antisense oligonucleotide targeting the modification site is 10-50 bp; preferably, the length of the antisense oligonucleotide targeting the modification site is 12-40 bp; more preferably, the length of the antisense oligonucleotide targeting the modification site is 14-30 bp; most preferably, the length of the antisense oligonucleotide targeting the modification site is 17-21 bp. In the embodiments of the present application, the length of the antisense oligonucleotide targeting the modification site is 17 bp, 18 bp, 19 bp, 20 bp or 21 bp.

[0020] In the method of the present application, the number of the modification sites is an integer of 1 or more; preferably, the number of the modification sites is 1, 2, 3, 4 or 5. In the present application, when the number of the nucleotides corresponding to the modification site on the antisense oligonucleotide ASO targeting the modification site is 1, the ASO only targets one RNA modification site, and multiple ASOs are used to regulate multiple modification sites. When the number of the modification sites is more than 1, one ASO can be used to regulate the occurrence of the modification, or multiple ASOs can be used to regulate the occurrence of the modification, which is not limited in the present application. When the number of the modification sites is more than 1, and the length of the region where the multiple modification sites exist is not more than the length of the ASO, it is preferred to use the same ASO to regulate the modification.

[0021] In the embodiments of the present application, the antisense oligonucleotide targeting the modification site comprises a nucleotide opposite to the modification site, an upstream homologous fragment and a downstream homologous fragment. The upstream homologous fragment is reverse complementary to the upstream sequence of the RNA where the modification site is located, and the downstream homologous fragment is reverse complementary to the downstream sequence of the RNA where the modification site is located. Preferably, the length of the upstream homologous fragment and the downstream homologous fragment is independently selected from 5-25 bp, preferably, the length of the upstream homologous fragment and the downstream homologous fragment is independently selected from 6-20 bp, more preferably, the length of the upstream homologous fragment and the downstream homologous fragment is independently selected from 7-15 bp. For example, the length of the upstream homologous fragment is 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp or 15 bp; the length of the downstream homologous fragment is 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp or 15 bp; the length of the upstream homologous fragment and the downstream homologous fragment is different by 0-15 bp; preferably, the length of the upstream homologous fragment and the downstream homologous fragment is different by 0-10 bp; more preferably, the length of the upstream homologous fragment and the downstream homologous fragment is different by 0-5 bp. For example, in the present application, the length of the upstream homologous fragment and the downstream homologous fragment is different by 0 bp, 1 bp, 2 bp, 3 bp, 4 bp or 5 bp.

[0022] In the method of the present application, the antisense oligonucleotide and the nucleotide opposite to the modification site, the upstream homologous fragment and the downstream homologous fragment can also comprise non-paired bases, i.e. not completely complementary. Preferably, the ASO and the target sequence are more than 80% complementary; preferably, the ASO and the target sequence are more than 90% complementary; most preferably, the ASO and the target sequence are completely complementary.

[0023] The antisense oligonucleotide targeting the modification site is chemically modified at least one base, wherein the chemical modification is optionally selected from one or more of the following: LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, PNA, Morpholino, BNA, methylation modification, phosphorothioate modification and DNA base substitution modification.

[0024] Preferably, 1-5 bases at the 3' end and the 5' end of the antisense oligonucleotide targeting the modification site are modified.

[0025] Preferably, 1-3 bases at the 3' end and the 5' end of the antisense oligonucleotide targeting the modification site are modified.

[0026] Preferably, 3 bases at the 3' end of the antisense oligonucleotide are modified by LNA, 3 bases at the 5' end of the antisense oligonucleotide are modified by LNA, the remaining bases are modified by 2'OME or MOE, and all the bases are modified by full phosphorothioate.

[0027] In some embodiments, the antisense oligonucleotide targeting the modification site has a length of 17-21 nt, 3 bases at the 3' end are modified by LNA, 3 bases at the 5' end are modified by LNA, the remaining bases are modified by 2'OMe or MOE, and all bases are modified by phosphorothioate.

[0028] In some embodiments, the antisense oligonucleotide targeting the modification site has a structure of (N1)x-(N2)y-(N3)z, wherein N is a base selected from any one of A, U, C, G. N2 is a nucleic acid matching the modification site, (N1)x and (N3)z are fragments respectively reverse complementary to the upstream and downstream homologous arms, and x, y, z respectively represent the number of bases of N1, N2 and N3. For example, y = 1, x = 8, 9 or 10, and z = 8, 9 or 10.

[0029] For example, y = 1, x = 8, and z = 8, the structure of the ASO is LN*LN*LN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*LN*LN*LN*.

[0030] For example, y = 1, x = 9, and z = 9, the structure of the ASO is LN*LN*LN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*LN*LN*LN*.

[0031] For example, y = 1, x = 10, and z = 10, the structure of the ASO is LN*LN*LN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*mN*LN*LN*LN*.

[0032] For example, y = 1, x = 8, and z = 8, the structure of the ASO is LN*LN*LN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*LN*LN*LN*.

[0033] For example, y = 1, x = 9, and z = 9, the structure of the ASO is LN*LN*LN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*LN*LN*LN*.

[0034] For example, y = 1, x = 10, and z = 10, the structure of the ASO is LN*LN*LN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*eN*LN*LN*LN*.

[0035] In the ASO structure as described above, L represents LNA modification, m represents 2'OMe modification, e represents 2'MOE modification, and * represents PS modification.

[0036] More specifically, the antisense oligonucleotide targeting the modification site has a nucleic acid sequence as shown in any one of SEQ ID NOs: 1-22 or 65-70. In the sequence listing, the ASO is represented as RNA, but under the ST.26 standard, both U and T are represented as T, and the specific sequences of the ASOs are as follows:

[0037] In one specific embodiment, the antisense oligonucleotide targets the m5C modification at the 156713158 site on chromosome 1, and the antisense oligonucleotide is: LG*LG*LT*mU*mC*mC*mC*mA*mG*mU*mU*mU*mG*mC*LA*LG*LG; or LG*LG*LG*mG*mU*mU*mC*mC*mC*mA*mG*mU*mU*mU*mG*mC*mA*mG*LG*LC*LC; or LG*LG*LT*eU*eC*eC*eC*eA*eG*eU*eU*eU*eG*eC*LA*LG*LG; or LG*LG*LG*eG*eU*eU*eC*eC*eC*eA*eG*eU*eU*eU*eG*eC*eA*eG*LG*LC*LC.

[0038] In another specific embodiment, the antisense oligonucleotide targets the m5C modification at the 135984141 site on chromosome 9, and the antisense oligonucleotide is: LT*LG*LA*mG*mC*mC*mU*mG*mG*mC*mA*mU*mG*mU*LT*LG*LA; or LT*LC*LT*mG*mA*mG*mC*mC*mU*mG*mG*mC*mA*mU*mG*mU*mU*mG*LA*LG*LC; or LT*LG*LA*eG*eC*eC*eU*eG*eG*eC*eA*eU*eG*eU*LT*LG*LA; or LT*LC*LT*eG*eA*eG*eC*eC*eU*eG*eG*eC*eA*eU*eG*eU*eU*eG*LA*LG*LC.

[0039] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m5C modification at position 48389569 of chromosome 19, and the antisense oligonucleotide is: LT*LG*LT*mA*mG*mC*mC*mA*mC*mC*mG*mC*mU*mG*mG*mA*mG*LG*LC*LT; or is LT*LG*LG*mA*mG*mG*mC*mU*mG*mU*mG*mG*mC*mA*mG*mC*mU*LA*LC*LA; or is LT*LG*LT*eA*eG*eC*eC*eA*eC*eC*eG*eC*eU*eG*eG*eA*eG*LG*LC*LT; or is LT*LG*LG*eA*eG*eG*eC*eU*eG*eU*eG*eG*eC*eA*eG*eC*eU*LA*LC*LA;

[0040] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m6A modification at position 40903256 of chromosome 15, and the antisense oligonucleotide is: LC*LG*LT*mC*mG*mU*mA*mG*mU*mC*mC*mA*mU*mG*LT*LA*LC, or is LC*LG*LT*eC*eG*eU*eA*eG*eU*eC*eC*eA*eU*eG*LT*LA*LC;

[0041] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m6A modification at position 25677538 of chromosome 9, and the antisense oligonucleotide is: LT*LG*LC*mA*mG*mU*mA*mG*mU*mC*mC*mG*mG*mG*LA*LA*LC, or is LT*LG*LC*eA*eG*eU*eA*eG*eU*eC*eC*eG*eG*eG*LA*LA*LC;

[0042] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m6A modification at position 145806215 of chromosome 6, and the antisense oligonucleotide is: LA*LT*LC*mC*mA*mA*mA*mG*mU*mC*mA*mC*mU*mA*LT*LT*LT, or is LA*LT*LC*eC*eA*eA*eA*eG*eU*eC*eA*eC*eU*eA*LT*LT*LT;

[0043] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m6A modification at position 9264847 of chromosome 1, and the antisense oligonucleotide is: LC*LG*LG*mA*mA*mG*mU*mG*mU*mC*mC*mA*mC*mU*LG*LG*LT, or LC*LG*LG*eA*eA*eG*eU*eG*eU*eC*eC*eA*eC*eU*LG*LG*LT.

[0044] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m6A modification at position 40903256 of chromosome 6, and the antisense oligonucleotide is: LC*LC*LC*mC*mA*mC*mA*mG*mU*mA*mC*mA*mC*mA*LC*LA*LC, or LC*LC*LC*eC*eA*eC*eA*eG*eU*eA*eC*eA*eC*eA*LC*LA*LC.

[0045] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m5C modification at the ACTB site, and the antisense oligonucleotide is: LG*LT*LC*mA*mU*mA*mG*mU*mC*mC*mG*mC*mC*mU*LA*LG*LA.

[0046] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m5C modification at the MALAT1 site, and the antisense oligonucleotide is: LA*LC*LT*mC*mA*mA*mA*mG*mU*mC*mC*mA*mA*mU*LG*LC*LA.

[0047] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m5C modification at the MYC-1 site, and the antisense oligonucleotide is: LC*LT*LG*mU*mU*mA*mG*mA*mA*mG*mG*mA*mA*mU*LC*LG*LT.

[0048] In another specific embodiment, the RNA modification site targeted by the antisense oligonucleotide is the m5C modification at the MYC-2 site, and the antisense oligonucleotide is: LA*LG*LT*mU*mC*mA*mU*mA*mG*mG*mU*mG*mA*mU*LT*LG*LC.

[0049] In another embodiment, the antisense oligonucleotide targets the m5C modification at the VEGFA site, and the antisense oligonucleotide is: LT*LC*LA*mC*mC*mC*mG*mU*mC*mC*mA*mU*mG*mA*LG*LC*LC.

[0050] In another embodiment, the antisense oligonucleotide targets the m5C modification at the MCM5 site, and the antisense oligonucleotide is: LC*LG*LA*mG*mU*mC*mC*mA*mU*mG*mA*mG*mU*mC*LC*LA*LG.

[0051] Further, the method of the present application comprises: introducing the antisense oligonucleotide into an organism, and inhibiting the occurrence of RNA modification in the cell.

[0052] In the present application, the introduction comprises: contacting a construct containing the antisense oligonucleotide with the organism, and the construct is a GalNAc conjugated or LNP-embedded antisense oligonucleotide.

[0053] In the present application, the introduction can be only one ASO, or multiple ASOs can be introduced, and the present application does not limit this. One of the introduced ASOs can target only one site, or one ASO can target multiple sites, and the present application does not limit this.

[0054] In the present application, the organism is a eukaryote and / or a prokaryote, which can be from an animal, a plant or a microorganism, and the present application does not limit this. In some embodiments, the organism is a eukaryote, for example, it is a cell, an embryo and / or a tissue from an animal. Or for example, it is a cell, a tissue, a seed or an embryo from a plant. Or for example, it is a cell or a spore from a eukaryotic microorganism. In other embodiments, the organism is a prokaryote, which is a cell of a prokaryotic microorganism.

[0055] In the embodiments of the present application, the cell is a human cell and / or an animal cell, and the animal is a mouse.

[0056] The present application also provides an antisense oligonucleotide targeting a modification site as described in the method described above.

[0057] The present application also provides a complex containing the antisense oligonucleotide and Galnac conjugation or LNP embedding.

[0058] The present application also provides a composition comprising the antisense oligonucleotide as described above and the complex as described above.

[0059] A host cell comprising the antisense oligonucleotide as described above and / or the complex as described above.

[0060] The present invention also provides a reagent for targeting RNA modification regulation, comprising an antisense oligonucleotide targeting the modification site as described in the methods described above, or a complex as described above, or a composition as described above, or a host cell as described above.

[0061] The reagents described also include reagents, adjuvants, or excipients required for transfection and / or transformation.

[0062] The reagents include electroporation transfection reagents, ionotropic transfection reagents, and / or liposome transfection reagents; for example, the electroporation transfection reagents include trypsin, PBS buffer, sodium chloride, potassium chloride, lactate, acetic acid, Tween, poloxamer, and Span; the ionotropic transfection reagents include calcium-phosphorus transfection reagents; and the liposome transfection reagents include... 3000, Lipofectamine RNAiMAX, Lipo8000, etc.

[0063] The adjuvant includes at least one of the following: cytokines (e.g., interferons such as IFN-α, IFN-β and IFN-γ, lymphokines such as IL-2, IL-3, IL-4, IL-5 and IL-10, etc.), monokines such as IL-1, IL-6, IL-8 and IL-12, and other cytokines such as TNF and GM-CSF), co-stimulatory molecules (e.g., B7-1 and B7-2), emulsifying adjuvants (Titer MaxGold(TMG)), Freund's adjuvants, saponins, and monophosphate acyl lipids.

[0064] The excipients include polyethylene glycol and / or polylysine.

[0065] The present invention also provides the use of antisense oligonucleotides targeting modification sites as described in the methods described above, or complexes as described above, or compositions as described above, or host cells as described above, in the preparation of medicaments for the prevention and treatment of diseases related to RNA modification.

[0066] In this invention, the diseases related to RNA modification include: tumors, nervous system diseases, immune system diseases, metabolic diseases and / or infectious diseases.

[0067] Preferably, the tumor includes malignant and benign tumors, such as breast cancer, lung cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, ovarian cancer, prostate cancer, bladder cancer, and melanoma.

[0068] The neurological diseases mentioned include Parkinson's disease, Alzheimer's disease, stroke, multiple sclerosis, meningitis, spinal cord injury, brain tumors, etc.

[0069] The immune system diseases include rheumatoid arthritis, systemic lupus erythematosus, autoimmune thyroid disease, ulcerative colitis, Crohn's disease, scleroderma, systemic sclerosis, etc.

[0070] The metabolic diseases include diabetes, obesity, hypertension, hyperlipidemia, hyperthyroidism, hypothyroidism, osteoporosis, etc.

[0071] The infectious diseases include AIDS, hepatitis B, hepatitis C, tuberculosis, malaria, dengue fever, cholera, influenza, pneumonia, etc.

[0072] Further, the present application also provides a medicine for preventing and treating diseases related to RNA modification, which comprises the antisense oligonucleotide targeting the modification site as described in the method, or the complex as described above, or the composition as described above, or the host cell as described above.

[0073] The medicine of the present application also comprises other therapeutic agents, enhancers and / or immunomodulators, and the present application does not limit the types of drugs used in combination, the doses of drugs used in combination and the administration modes.

[0074] Further, the present application also provides a method for preventing and treating diseases related to RNA modification, which comprises administering the medicine as described above to a subject.

[0075] The present application uses antisense oligonucleotides targeting RNA modification sites to regulate RNA modification, which has the advantages including but not limited to:

[0076] 1. Precision and specificity: ERASER ASO can achieve precise erasure of RNA modification sites, avoiding the influence on other modification sites, and has higher specificity and accuracy;

[0077] 2. Reduction of global non-specific effects: compared with the method of overexpressing dCas, the ASO used by ERASER has lower global non-specific effects, reducing the interference with the cell state, and helping to more accurately evaluate the function and regulatory mechanism of the target modification site;

[0078] 3. High efficiency: ERASER ASO tool has high modification erasure effect, and uses chemical modification to improve the cell permeability and selectivity of ASO;

[0079] 4. Universality and versatility: the design concept and method of ERASER ASO can be applied to various types of RNA modification, and are not limited to specific modification enzymes or modification types, and have wider applicability and versatility.

[0080] 5. Simplified development process: Compared with dCas tools developed separately for each modification, ERASERASO provides a more simplified development process, reducing the development time and cost of tools.

[0081] 6. Precise regulation and quantitative adjustment: Since the ASO used by ERASER can be accurately designed and regulated, precise regulation and quantitative adjustment of modifications can be achieved, providing a more powerful tool for in-depth study of the function and regulation mechanism of RNA modification.

[0082] Therefore, the ERASERASO provided by the present application has higher precision, specificity, universality and precise regulation ability compared with the dCas-based targeted removal of RNA modification tool. Experiments show that the inhibition rate of RNA modification by this method reaches 50% to 100%, providing a more effective tool and method for the field of RNA modification research. BRIEF DESCRIPTION OF DRAWINGS

[0083] Figure 1 Figure 1 is a schematic diagram of RNA modification types and the design principle of ERASER, wherein:

[0084] (A) Schematic diagram of different types of RNA modification and modification sites. Different types of RNA modification (such as m5C, m6A) have specific structural characteristics in RNA molecules and are mediated by corresponding modification enzymes to modify at specific sites.

[0085] (B) Schematic diagram of the design principle of ERASER. ERASER forms a double-stranded structure by designing specific antisense oligonucleotides (ASO) to bind to the target RNA, thereby interfering with the action of modification enzymes and achieving precise erasure of RNA modification sites.

[0086] (C) Schematic diagram of the construction of a reporter system for mRNAm5C modification. The m5C modification site is selected and constructed into a psiCHECK2 reporter plasmid, inserted into the 3'UTR region of hRluc, for evaluating the inhibition effect of ERASER on m5C modification.

[0087] (D) Evaluation results of the inhibition effect of ERASER on m5C modification. ERASERASO centered on the m5C site was designed, and different modifications (MOE and OMe) and lengths (17nt and 21nt) were evaluated. The m5C level of the substrate was detected by target BS-PCR, and it was found that the m5C modification level was significantly reduced in ERASER transfected cells, proving the effective inhibition effect of ERASER on m5C modification.

[0088] Figure 2 Figure 2 is an evaluation of the inhibition effect of ERASER on endogenous gene m5C and m6A modification:

[0089] (A) ERASER's effective inhibition on endogenous m5C sites, two m5C sites distributed in different functional regions of RNA were detected in HEK293T cells, and the inhibition effect on endogenous m5C sites was observed, with an inhibition rate of 80% to 95%;

[0090] (B) Design and effect evaluation of ERASER ASO, comparison of the inhibition effect of 17nt OMe and MOE modified ASO targeting RALGDS m5C site, it is observed that OMe modified ERASER ASO has stronger inhibition effect at lower concentration;

[0091] (C) YTH-TadA fusion protein mediated RNA editing detection system, YTH-TadA is a fusion protein composed of YTH binding protein and TadA, which is used to introduce specific RNA editing modification, in this system, m6A level can be explained as RNA editing level;

[0092] (D) Inhibition effect of ERASER ASO on YTH-TadA mediated RNA editing, 17nt ERASER ASO centered on m6A was designed, different modifications (OMe and MOE) were used, after transfection of ERASER ASO in HEK293T cells and transfection of YTH-TadA fusion protein after 12 hours, the RNA editing level of substrate was evaluated by PCR amplification fragment Sanger sequencing, and it was observed that ERASER ASO effectively inhibited YTH-TadA mediated RNA editing, and OMe modified ERASER ASO had more robust inhibition effect.

[0093] Figure 3 Effect of ERASER ASO on tumor RNA modification

[0094] (A) Effect of m5C ERASER ASO (HDGF) and m6A ERASER ASO (ACTB, MALAT1, MYC) on tumor development related RNA methylation modification sites;

[0095] (B) According to the position of tumor related gene RNA methylation modification site (3'UTR or 5'UTR), the front and back 40nt fragments were cloned into the corresponding position of hRluc in psiCHECK2 reporter plasmid, among them, HDGF m5C, MYC m6A and VEGFA m6A sites are located in 3'UTR, and MCM5 m6A is located in 5'UTR;

[0096] (C) HDGF m5C / HDGF m5C mutant / HDGF m5C and ASO, MYC / MYC m5C mutant / MYC m5C and ASO were transfected into bladder cancer cell line T24 respectively, VEGFA / VEGFA m5C mutant / VEGFA m5C and ASO, MCM5 / MCM5 m5C mutant / MCM5 m5C and ASO were transfected into lung cancer cell line A549, and the expression of the reporter plasmid dual luciferase was detected after 48 hours. DETAILED DESCRIPTION

[0097] The present application provides a method for targeting RNA modification regulation, and those skilled in the art can improve the process parameters according to the content herein. It should be particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are all considered to be included in the present application. The methods and applications of the present application have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0098] Unless otherwise defined herein, the scientific and technical terms used in connection with the present application shall have the meanings understood by those of ordinary skill in the art.

[0099] In the present application, "and / or" is used to describe the association relationship of the associated objects, which means that there can be three kinds of relationships, for example, A and / or B, which can represent the following cases: A exists alone, A and B exist together, and B exists alone. Wherein A and B can be singular or plural.

[0100] In the present application, "at least one" means one or more, and "more" means two or more. "At least one of the following (one / variety)" or similar expressions means any combination of these items, including any combination of single item (one / variety) or multiple items (one / variety).

[0101] In the present application, "including", "containing" and "having" can be used interchangeably, which is intended to represent the inclusiveness of the scheme, meaning that the scheme can have other elements in addition to the listed elements. It should also be understood that the use of "including", "containing" and "having" in this text also provides a "consisting of" scheme.

[0102] In the present application, "targeting" means targeting a specific modification site on RNA and specifically regulating, especially removing the modification.

[0103] In the present application, "RNA" is the full name of Ribonucleic Acid, which is a long-chain molecule composed of ribonucleotides condensed by phosphodiester bonds. In the present application, the bases of RNA are mainly A adenine, G guanine, C cytosine and U uracil. Generally, there are three major types of RNA molecules, namely messenger RNA (mRNA), transfer RNA (tRNA) and ribosomal RNA (rRNA), in addition to some special RNAs such as pre-messenger RNA, long non-coding RNA, small nuclear RNA, microRNA and Piwi-interacting RNA.

[0104] In the present application, "RNA modification" is a post-transcriptional level of regulation, which widely exists in various types of RNA as described above. The types of RNA modification that have been found so far include but are not limited to methylation, adenylylation, phosphorylation and other forms, which play an important regulatory role in transcription, splicing, translation and other processes. In recent years, more and more studies have shown that RNA modification is closely related to the occurrence and development of various diseases. For example, RNA modification plays an important role in cancer. For example, N6-methyladenine (m6A) modification is closely related to the occurrence and prognosis of various cancers. In the pathological process of cancer, abnormal expression of RNA modification enzymes related to m6A such as METTL3, FTO and ALKBH5 can inhibit the normal regulation of m6A modification, leading to instability and abnormal protein translation of RNA, thereby promoting the proliferation and metastasis of cancer cells. In addition, other RNA modification forms such as 5hmC and N4-acetylcytosine (ac4C) also play an important role in tumor growth and metastasis. And RNA modification also plays an important role in nervous system diseases. For example, in neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease, abnormal RNA modification can lead to neuronal dysfunction and cell death. Changes in specific RNA modification enzymes and modification sites are closely related to the pathogenesis and progression of these diseases. In addition, RNA modification is also related to the occurrence and development of immune system diseases, cardiovascular diseases and other diseases. By regulating RNA modification, we can better understand the pathogenesis of these diseases and provide new ideas and methods for the diagnosis and treatment of diseases.

[0105] In the present application, "antisense oligonucleotide" is a type of artificially synthesized oligonucleotide fragment, which can bind to target RNA molecules through base complementarity, interfering with and blocking the recognition and action of RNA modification enzymes on target sites.

[0106] In the present invention, "LNA modification" (Locked Nucleic Acid) locks the sugar ring into a bicyclic molecular pattern by a methylene bridge between the 2' oxygen atom and the 4' carbon atom, thereby restricting the flexibility of the sugar ring. It can make the pairing of LNA with DNA or RNA more stable and improve the thermal stability of duplexes.

[0107] In the present invention, 2'OMe modification replaces the hydrogen on the 2'-hydroxyl group of ribonucleotides with a methoxy group (-OCH3). This modification enhances the resistance of oligonucleotides to nucleases, thereby improving their stability.

[0108] In the present invention, 2'-MOE modification replaces a hydrogen atom in a nucleotide with a methoxyethyl group (-OCH2CH2OCH3) at the 2'-position. This modification makes the nucleotide more stable and improves its ability to resist nuclease degradation, thereby prolonging its half-life in the body.

[0109] In the present invention, phosphorothioate modification replaces a non-bridging oxygen atom in the phosphate backbone with a sulfur atom. This modification causes less disturbance to the structure of nucleic acids than base functionalization, and does not involve base pairing.

[0110] In the present invention, "treatment" refers to surgical or therapeutic treatment, the purpose of which is to prevent, slow down (reduce), or halt an unwanted physiological change or pathological condition, such as cancer and tumors, in a subject. Beneficial or desired results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilization (i.e., not worsening) of the state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Subjects in need of treatment include those already with a condition or disease as well as those in which a condition or disease is to be prevented, or those intending to prevent a condition or disease. When referring to the terms slow down, reduce, diminish, palliate, alleviate, and the like, the meaning also includes elimination, disappearance, nonoccurrence, and the like.

[0111] In the present invention, "drug" refers to a preparation that exists in a form effective for the biological activity of the active ingredient contained therein, and does not contain additional components that have unacceptable toxicity to a subject to which the pharmaceutical composition is administered.

[0112] In the present application, the "drug" can be preferably administered by any of the following modes, such as injection, enteral administration, and topical administration. For example, the injection includes subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, and / or intracranial injection. The enteral administration mainly includes oral and / or rectal administration. The topical administration includes, but is not limited to, spray inhalation, nasal administration, buccal administration, vaginal administration, and the like.

[0113] In the present application, the "subject" refers to an organism receiving treatment for a particular disease or disorder as described in the present application. Exemplarily, the "subject" includes a mammal receiving treatment for a disease or disorder, which mammal includes bovine, equine, ovine, porcine, canine, feline, rodent, primate, and preferably the mammal is human, cat, dog, or pig.

[0114] In the present application, the "effective amount" refers to the amount of a therapeutic agent that, when administered alone or in combination with another therapeutic agent, is effective in preventing or alleviating the disease condition or the progression of the disease in a cell, tissue, or other subject. The "effective amount" also refers to the amount of a compound sufficient to alleviate symptoms, such as to treat, cure, prevent, or alleviate the relevant medical condition, or to increase the speed of treating, curing, preventing, or alleviating such conditions. When the active ingredient is administered alone, the therapeutically effective dose refers only to that ingredient. When a combination is used, the therapeutically effective dose refers to the combined amounts of active ingredients that result in the therapeutic effect, whether administered in combination, serially, or simultaneously.

[0115] In the present application, the medicament can be formulated into any dosage form known in the medical field, for example, tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injection solutions, sterile powders for injection, and concentrated solutions for injection), inhalants, sprays, and the like. Preferably, the dosage form of the medicament depends on the intended administration method and therapeutic use. The pharmaceutical composition of the present application should be sterile and stable under the conditions of production and storage. A preferred dosage form is an injection. Such an injection can be a sterile injection solution. For example, a sterile injection solution can be prepared by incorporating the necessary dosage of the ASO of the present application in an appropriate solvent, and optionally, simultaneously incorporating other desired ingredients (including, but not limited to, pH adjusters, surfactants, adjuvants, ionic strength enhancers, isotonic agents, preservatives, diluents, or any combination thereof), followed by sterilization by filtration. In addition, a sterile injection solution can be prepared as a sterile lyophilized powder (e.g., by vacuum drying or freeze-drying) to facilitate storage and use. Such a sterile lyophilized powder can be dispersed in a suitable carrier prior to use, such as water for injection (WFI), bacteriostatic water for injection (BWFI), sodium chloride solution (e.g., 0.9% (w / v) NaCl), dextrose solution (e.g., 5% dextrose), surfactant-containing solution (e.g., 0.01% polysorbate 20), pH-buffered solution (e.g., phosphate-buffered solution), Ringer's solution, and any combination thereof.

[0116] In the present application, "cancer" and "tumor" are not mutually exclusive. "Cancer" refers to or describes a physiological condition typically characterized by unregulated cell growth in a mammal. This definition includes both benign and malignant cancers. "Tumor" or "neoplasm" refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. More specifically, the tumor or neoplasm refers to a tumor or neoplasm associated with RNA modification.

[0117] The materials employed in the present application are all commercially available and can be purchased in the market. The sequence information involved in the examples includes:

[0118] Sequence information:

[0119] YTH

[0120] CCCCACCCAGTGTTGGAGAAGCTTCGGTCCATTAATAACTATAACCCCAAAGATTTTGACTGGAATCTGAAACATGGCCGGGTTTTCATCATTAAGAGCTACTCTGAGGACGATATTCACCGTTCCATTAAGTATAATATTTGGTGCAGCACAGAGCATGGTAACAAGAGACTGGATGCTGCTTATCGTTCCATGAACGGGAAAGGCCCCGTTTACTTACTTTTCAGTGTCAACGGCAGTGGACACTTCTGTGGCGTGGCAGAAATGAAATCTGCTGTGGACTACAACACATGTGCAGGTGTGTGGTCCCAGGACAAATGGAAGGGTCGTTTTGATGTCAGGTGGATTTTTGTGAAGGACGTTCCCAATAGCCAACTGCGACACATTCGCCTAGAGAACAACGAGAATAAACCAGTGACCAACTCTAGGGACACTCAGGAAGTGCCTCTGGAAAAGGCTAAGCAGGTGTTGAAAATTATAGCCAGCTACAAGCACACCACTTCCATTTTTGATGACTTCTCACACTATGAGAAACGCCAAGAGGAAGAAGAAAGTGTTAAAAAGGAACGTCAAGGTCGTGGGAAA (SEQ ID NO: 71)

[0121] 15A A linker

[0122] AGCGGCAGCGAGACTCCCGGGACCTCAGAGTCCGCCACACCAGAA (SEQ ID NO: 72)

[0123] TadA max 10

[0124] TCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAAC (SEQ ID NO:73)

[0125] YTH-TadA

[0126]

[0127] 1.ASO(Antisense Oligonucleotide): Antisense Oligonucleotide, a short DNA or RNA sequence that can pair with a specific sequence of target RNA, thereby affecting or regulating the expression or function of target RNA.

[0128] 2.m5C: 5-methylcytosine, a common RNA modification, indicating that the cytosine (C) base on the RNA molecule is methylated.

[0129] 3.m6A: N6-methyladenosine, a common RNA modification, indicating that the adenine (A) base on the RNA molecule is methylated.

[0130] 4.pseuU: pseudouridine, a common RNA modification, indicating that the uracil (U) base on the RNA molecule is isomerized to pseudouridine.

[0131] 5.OMe modification(2'-O-methyl ether modification): a chemical modification that replaces the hydrogen atom on the 2' oxygen atom of RNA or DNA molecules with a methyl oxygen group.

[0132] 6.MOE modification(2'-O-methoxyethyl modification): a chemical modification that replaces the hydrogen atom on the 2' oxygen atom of RNA or DNA molecules with a methoxyethyl group.

[0133] 7.LNA modification(Locked Nucleic Acid modification): Locked Nucleic Acid, a chemical modification of RNA or DNA, by connecting the 2', 4' sites of the carbon and oxygen of the nucleic acid enzyme to form a ring structure, making the nucleic acid molecule more stable.

[0134] 8. Phosphorothioate (PS) modification: the oxygen atom on the phosphate group is replaced by a sulfur atom, increasing the anti-nuclease degradation ability of DNA or RNA molecules.

[0135] 9. BS treatment of RNA(Bisulfite treatment of RNA): by treating RNA molecules with bisulfite, unmethylated cytosine (C) is converted to uracil (U), which is used to analyze the methylation status of RNA.

[0136] 10. CRISPR-Cas system (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR associated proteins): CRISPR is a natural immune system, and the CRISPR-Cas system can be used for genome editing, which can achieve precise editing of specific sites on the genome by guiding RNA to complementarily pair with the target DNA sequence.

[0137] The application is further described below in conjunction with examples:

[0138] Examples

[0139] I. ERASER antisense oligonucleotide design

[0140] The design principle of ERASER is based on the need for precise intervention of RNA modification sites. By designing antisense oligonucleotides (ASOs) targeting specific RNA modification sites, ASOs are used to bind to target RNAs to form double-stranded structures, thereby interfering with the recognition and action of RNA modification enzymes, and achieving precise erasure of RNA modification sites. Figure 1 In the schematic diagram A, the structural characteristics of RNAs of different modification types and the corresponding modification sites mediated by modification enzymes are shown. Figure 1 In the schematic diagram A, the structural characteristics of RNAs of different modification types and the corresponding modification sites mediated by modification enzymes are shown.

[0141] The design of ASO is carried out for the following RNA modification sites:

[0142] Table 1 m5C site

[0143] Chromosome Position Strand Gene name Motif(+1 to +4) 1 156713158 - chr 15 VPS18 9 135984141 - chr 9 TUSC1 19 48389569 - chr 6 FBXO30

[0144] Table 2 m6A site

[0145] chr 1 H6PD chr 6 SOX4 Figure 1 40903256 + Figure 1 Gene 25677538 - psiCHECK-BSP-F TGTGGAGTGTGTGTTGAAGAATGAGTAG (SEQ ID NO: 29) 145806215 - psiCHECK-BSP-R ACAACCAACAACCACTCTAAATTTAAAC (SEQ ID NO: 30) 9264847 + HDGF-BSP-F GTTATTAAGGAAGATGTTGAGGTTTTAGGTAT (SEQ ID NO: 31) 21595877 + HDGF-BSP-R

[0146] First, the sequence of the modification site and its surrounding 40 bases is obtained. Next, we use Soligo to predict the accessibility of the target and design antisense oligonucleotides. Finally, the candidate antisense oligonucleotides are selected according to the following criteria: 1. Cover the specified site of interest; 2. GC content is between 30%≤GC%≤70%; 3. Binding energy ≤-8 kcal / mol; No GGGG in the target sequence. In the case of similar binding energies of multiple antisense oligonucleotides, we select the antisense oligonucleotide centered on the modification site for experiments.

[0147] Furthermore, chemical modifications can endow oligonucleotides with drug-like properties. Therefore, we employed the backbone and 2' modification widely used in ASOs to improve binding affinity to RNA targets, enhance selectivity, and strengthen resistance to nuclease degradation. We evaluated two ASO lengths, 17nt and 21nt, and modified the three bases at both ends with LNA, the middle portion with 2'OMe or MOE, and the entire structure with complete phosphate thioester (PS). Since the NSUN6-mediated m5C modification site is located in the loop region of the hairpin structure, we designed an ERASER ASO targeting NSUN6 m5C, offsetting it from the center of the modification site to more effectively untangle the stem region structure. Similarly, the three bases at both ends of the ASO were modified with LNA, and the middle region was modified with either 2'OMe or MOE.

[0148] The ASO obtained in this embodiment includes:

[0149] Table 3 shows the ERASER ASO results for the m5C site in Table 1.

[0150]

[0151]

[0152] Table 4 shows the ERASER ASO results for the m6A site in Table 2.

[0153]

[0154] Note: In Tables 3 and 4, A, U, C, and G represent four different bases, L represents LNA modification, m represents 2'OMe modification, e represents MOE modification, and * represents PS modification.

[0155] II. ERASER antisense oligonucleotides for the erasure of RNA modifications

[0156] To establish our system, we selected mRNA modification m5C, a functionally important and well-studied mRNA, as a target. To test the system, we selected three m5C methylation sites mediated by NSUN2 or NSUN6 RNA methyltransferases and constructed them into the psiCHECK2 reporter system, where the m5C modification site and its preceding and following 40 nt sequences were inserted into the 3'UTR region of hRluc. CCTAAAAATAAAAACCAAATAACCTACCCCATC (SEQ ID NO: 32) (C). ASO and reporter plasmid were co-transfected into cells, and the m5C level of the substrate was detected by targeted BS-PCR 48 hours later. Notably, we found that the m5C level in cells transfected with ERASER ASO decreased in all cases. RALGDS-BSP-F (D). Details are as follows:

[0157] 1. Cell culture

[0158] HEK293T and HeLa cell lines were provided by the Chinese Academy of Sciences Cell Bank and verified by STR analysis, and the Chinese Academy of Sciences Cell Bank checked whether they were contaminated by mycoplasma. The cell lines were maintained in culture in DMEM medium (Gibco) containing 10% FBS and 1% double antibody, and the cell incubator was set at 37 degrees Celsius, 5% CO2 and 95% humidity.

[0159] 2. m5C reporter plasmid construction

[0160] To construct the reporter plasmid, primers (Table 6) were designed to amplify the methylation site and the surrounding 40 nt sequence, and the fragment was cloned into the psiCHECK2 hRluc 3'UTR region using homologous recombination.

[0161] Table 5 Primers for constructing m5C site reporter plasmid

[0162]

[0163] 3. ERASER ASO and plasmid transfection

[0164] Cells were grown in 12-well plates for 24 hours to reach 70% confluence, and then cell transfection experiments were performed. Transfection reagent mixture was prepared according to the instructions provided by the transfection reagent Lipo8000, 500 ng of m5C reporter plasmid and 40 pmol of ERASER ASO targeting m5C were transfected into each well, and the transfection solution was added to the cells, gently mixed and then placed in the incubator. Cells were collected 48 hours after transfection for further analysis.

[0165] Cells were grown in 12-well plates for 24 hours to reach 70% confluence, and then cell transfection experiments were performed. Transfection reagent mixture was prepared according to the instructions provided by the transfection reagent RNAiMAX, 40 pmol of ERASER ASO was transfected into each well, and the transfection solution was added to the cells, gently mixed and then placed in the incubator. Cells were collected 48 hours after transfection for further analysis.

[0166] After 12 hours of transfection of ERASER ASO targeting m6A, transfection reagent mixture was prepared according to the instructions provided by the transfection reagent Lipo3000, 3 ug of YTH-TadA plasmid was transfected into each well, and the transfection solution was added to the cells, gently mixed and then placed in the incubator. Cells were collected 48 hours after transfection for further analysis.

[0167] 4. BS-PCR

[0168] Total RNA was extracted using TRIzol method, treated with DNase I, BS conversion was performed using EZ RNA Methylation Kit (ZYMOresearch) (sulfonation: 3 cycles, 70°C, 10 min, 64°C, 45 min; desulfonation: 25°C, 30 min.), and reverse transcription was performed using HiScript II Q RT SuperMix (Vazyme) and random primers. The target sequence was amplified using STARmix Taq DNA Polymerase (GenStar) with the following program: 94°C, 3 min; 94°C, 30 s, 52°C, 30 s, 72°C, 20 s, 30 cycles; 72°C, 1 min. For BS-PCR, Sanger sequencing of PCR products was used to measure the methylation level of mRNA substrates.

[0169] Table 6 BS-PCR primers

[0170] TTGGGTATTTGGTTGGATTAGTATTT (SEQ ID NO: 33) 5'-3' RALGDS-BSP-R AACCTCAAACTCTACCTCAATAAATT (SEQ ID NO: 34) Figure 1 Figure 2 Figure 1 Figure 2 Figure 2 Figure 2 Figure 2 Figure 3 Figure 3 Figure 3

[0171] 5. Construction of YTH-TadA fusion protein

[0172] TadA was amplified from ABE8e (addgene #138489), YTH fragment was amplified from genome, both fragments were cloned into pcDNA3.1 plasmid vector by homologous recombination.

[0173] Table 7 Primers for constructing YTH-TadA fusion protein

[0174]

[0175] 6. Cell experimental method for evaluating RNAm6A level

[0176] ERASER ASO was transfected into HEK293T cells using Lipofectamine RNAiMAX, 12 hours later, YTH-TadA fusion protein was further transfected, cells were collected 48 hours later, RNA was extracted using RNA isolation kit (Vazyme), followed by reverse transcription using reverse transcription kit (YESEN), and the RNA editing level of the substrate was evaluated by PCR amplification and Sanger sequencing using EditR.

[0177] Table 8 m6A Sanger sequencing primers

[0178]

[0179]

[0180] 7. ERASER ASO effectively erased RNAm5C modification

[0181] First, we evaluated the inhibitory effect of ERASER ASOs in m5C reporter plasmids, and the results showed that ERASER ASOs of different modifications and lengths all exhibited significant inhibition. Whether targeting class I m5C sites located at the 5' end of the hairpin structure (e.g., HDGF and RALGDS) mediated by NSUN2, or class II m5C sites located in the loop of the hairpin structure (e.g., SULT2A1) mediated by NSUN6, ERASER ASOs could significantly reduce the modification level of these m5C sites (see ​ Fig. D).

[0182] Subsequently, we detected two m5C sites (HDGF and RALGDS) distributed in different functional regions of endogenous genes in HEK293T cells, and observed effective inhibition of ERASER ASOs on these m5C endogenous sites, with an inhibition rate of 80% to 95% (see ​ Fig. A). This result indicates that ERASER ASOs have high efficiency in inhibiting m5C modification in cells.

[0183] 8. ERASER ASOs effectively erase RNA m6A modification

[0184] To explore whether ERASER ASOs can form dsRNA with the target to destroy the single-stranded environment preferred by METTL3 / 14 and inhibit m6A methylation, we selected five m6A sites identified by the GLORI method in HEK293T cells. We designed 17nt ASOs modified with OMe or MOE, because 17nt ERASER exhibited more robust inhibition in m5C (see ​ Fig. D, ​ Fig. A) to introduce dsRNA structure to inhibit m6A methylation.

[0185] YTH-TadA is composed of YTH domain-containing protein and TadA (Tetanus toxin Adeaminase), YTH domain-containing protein is usually used to recognize and bind m6A modified sites, while TadA is a deaminase that can catalyze the deamination reaction of adenine (A) base in RNA. In the system of converting m6A modification to adenine (A) base, the m6A level can be explained as the RNA editing level by PCR amplification and Sanger sequencing (see ​ Fig. C). The results show that ERASER ASOs effectively inhibit YTH-TadA8.20-mediated RNA editing, and OMe-modified ERASER ASOs have more robust and significant inhibition than MOE (see ​Figure 6. ERASER ASO inhibits the expression of hRluc in T24 cells. A) The sequence of the 3'UTR of hRluc. The m5C modification site is underlined. B) The sequence of the 5'UTR of hRluc. The m6A modification site is underlined. C) The expression of hRluc in T24 cells treated with ERASER ASO. The expression of hRluc was normalized to the expression of Renilla luciferase. The data are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, Student's t test. ​ Figure 7. ERASER ASO inhibits the expression of hRluc in A549 cells. A) The sequence of the 3'UTR of hRluc. The m5C modification site is underlined. B) The sequence of the 5'UTR of hRluc. The m6A modification site is underlined. C) The expression of hRluc in A549 cells treated with ERASER ASO. The expression of hRluc was normalized to the expression of Renilla luciferase. The data are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, Student's t test.

[0186] 9. Application potential of ERASER ASO in tumor therapy

[0187] To verify the potential of ERASER ASO in tumor therapy, we designed the corresponding ASO targeting the RNA methylation high-level modification sites of tumor development and proliferation related genes, and detected the m5C or m6A modification level in RNA. The results showed that the inhibition efficiency of ERASER ASO on RNA modification of these sites reached 50-95% (see ​ Figure 8. ERASER ASO inhibits the expression of hRluc in T24 cells. A) The sequence of the 3'UTR of hRluc. The m5C modification site is underlined. B) The sequence of the 5'UTR of hRluc. The m6A modification site is underlined. C) The expression of hRluc in T24 cells treated with ERASER ASO. The expression of hRluc was normalized to the expression of Renilla luciferase. The data are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, Student's t test.

[0188] Then, we constructed psiCHECK2 plasmid reporter system containing the high-level HDGF m5C modification and MYC m6A modification in bladder cancer, and the high-level VEGFA and MCM5 m6A modification in lung cancer, and constructed the reporter plasmid in the 3'UTR or 5'UTR of hRluc in psiCHECK2 plasmid, in which the sequence of 40 nt before and after the m5C / m6A modification site was included (see ​ Figure 9. ERASER ASO inhibits the expression of hRluc in A549 cells. A) The sequence of the 3'UTR of hRluc. The m5C modification site is underlined. B) The sequence of the 5'UTR of hRluc. The m6A modification site is underlined. C) The expression of hRluc in A549 cells treated with ERASER ASO. The expression of hRluc was normalized to the expression of Renilla luciferase. The data are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, Student's t test. ​ Figure 10. ERASER ASO inhibits the expression of hRluc in T24 cells. A) The sequence of the 3'UTR of hRluc. The m5C modification site is underlined. B) The sequence of the 5'UTR of hRluc. The m6A modification site is underlined. C) The expression of hRluc in T24 cells treated with ERASER ASO. The expression of hRluc was normalized to the expression of Renilla luciferase. The data are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, Student's t test.

[0189] Table 9 Primers for constructing tumor RNA modification related site reporter plasmid

[0190]

[0191] Table 10 ERASER ASO targeting m5C or m6A sites in Table 5

[0192]

[0193]

[0194] Note: A, U, C, G in Table 6 represent four different bases, L represents LNA modification, m represents 2'OMe modification, e represents MOE modification, and * represents PS modification.

[0195] The above merely preferred embodiments of the present application, it should be noted that for those of ordinary skill in the art, without departing from the principles of the present application, can also make a number of improvements and refinements, these improvements and refinements should also be considered within the scope of the present application.

Claims

1. Methods targeting RNA modification regulation, including: Blocking the recognition and / or action of RNA-modifying enzymes on modification sites by antisense oligonucleotides targeting modification sites; The antisense oligonucleotides targeting the modification site are inversely complementary to the modification site and its upstream and downstream fragments.

2. The method according to claim 1, characterized in that, The RNA-modifying enzymes include, but are not limited to, any one of the following enzymes: methyltransferase, phosphorylase, acetyltransferase, glycosyltransferase, oxidoreductase, adenylate acylase, hydroxymethylase, and RNA deaminase.

3. The method according to claim 1, characterized in that, The targeted RNA is selected from at least one of the following: premessenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long noncoding RNA, micro-interfering RNA, and Piwi-interacting RNA.

4. The method according to any one of claims 1 to 3, characterized in that, The RNA modification includes, but is not limited to, any one of the following: 5-methylcytosine modification, 5-hydroxymethylcytosine modification, N6-methyladenine modification, 7-methylguanine modification, N6,2'-O-dimethyladenine modification, 2-oxymethylation modification, N1-methyladenine modification, pseudouracil modification, hypoxanthine modification, 5-methoxycytosine modification, 5-methyluracil modification, N4-acetylcytosine modification, 5-fluorouracil modification, N7-methylguanine modification, and 2'-O-methylation modification.

5. The method according to claim 1 or 4, characterized in that, The modified site is an integer of 1 or greater than 1; preferably, the number of modified sites is 1, 2, 3, 4 or 5.

6. The method according to claim 5, characterized in that, The antisense oligonucleotide targeting the modification site includes a nucleotide opposite to the modification site, an upstream homologous fragment, and a downstream homologous fragment; Preferably, the length difference between the upstream homologous fragment and the downstream homologous fragment is 0–15 bp; Preferably, the length difference between the upstream homologous fragment and the downstream homologous fragment is 0 to 10 bp; Preferably, the length difference between the upstream homologous fragment and the downstream homologous fragment is 0 to 5 bp.

7. The method according to claim 6, characterized in that, The full-length antisense oligonucleotide at the target modification site is not less than 10 bp; Preferably, the antisense oligonucleotide targeting the modification site has a length of 10–50 bp; Preferably, the antisense oligonucleotide at the target modification site has a length of 12–40 bp; Preferably, the antisense oligonucleotide at the target modification site has a length of 14–30 bp; Most preferably, the antisense oligonucleotide at the target modification site has a length of 17–21 bp.

8. The method according to any one of claims 6 to 7, characterized in that, At least one base of the antisense oligonucleotide at the target modification site is chemically modified, wherein the chemical modification is selected from one or more of the following groups: LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, PNA, Morpholino, BNA, methylation modification, thiophosphate modification, and DNA base substitution modification. Preferably, the 3' and 5' ends of the antisense oligonucleotide targeting the modification site are modified by 1 to 5 bases; Preferably, the 3' and 5' ends of the antisense oligonucleotide targeting the modification site are modified by 1 to 3 bases.

9. The method according to claim 8, characterized in that, The antisense oligonucleotide at the target modification site is 17–21 nt in length, with the 3' end 3 bases modified by LNA, the 5' end 3 bases modified by LNA, the remaining bases modified by 2'OMe or MOE, and all bases modified by full-thiophosphate.

10. The method according to any one of claims 1 to 9, characterized in that, The antisense oligonucleotide targeting the modification site has a nucleic acid sequence as shown in any one of SEQ ID NO:1~22 or 65~70.

11. The method according to any one of claims 1 to 10, characterized in that, The method includes: transferring the antisense oligonucleotide into cells to inhibit RNA modification in the cells.

12. The method according to claim 11, characterized in that, The cells are human cells and / or animal cells, and the animal is a human, primate, rodent, feline, and / or canine.

13. The antisense oligonucleotide targeting the modification site as described in any one of claims 1 to 12.

14. A complex comprising Galnac conjugated with the antisense oligonucleotide of claim 13 or encapsulated with LNP.

15. A composition comprising the antisense oligonucleotide of claim 13 and the complex of claim 13.

16. A host cell comprising the antisense oligonucleotide of claim 12 and / or the complex of any one of claims 13.

17. A reagent for targeting RNA modification regulation, comprising an antisense oligonucleotide targeting a modification site as described in any one of claims 1 to 12, or the complex as described in claim 14, or the composition as described in claim 15, or the host cell as described in claim 16.

18. The reagent according to claim 17, characterized in that, It also includes reagents, adjuvants, or excipients required for transfection and / or transformation; The reagents include electroporation transfection reagents, iontophoresis transfection reagents, and / or liposome transfection reagents; The adjuvants include at least one of the following: cytokines, co-stimulatory molecules, emulsifying adjuvants, Freund's adjuvants, saponins, monophosphate acyl lipids, TLR agonists, CpG oligonucleotides, oligodeoxynucleotides, and / or immunomodulatory proteins. The excipients include polyethylene glycol and / or polylysine.

19. The use of the antisense oligonucleotide of claim 13, or the complex of claim 14, or the composition of claim 15, the host cell of claim 16, or the reagent of claim 17 or 18, in the preparation of a medicament for the prevention and treatment of diseases related to RNA modification.

20. The application according to claim 19, characterized in that, The diseases associated with RNA modification include: tumors, nervous system diseases, immune system diseases, metabolic diseases, and / or infectious diseases.

21. The application according to claim 20, characterized in that, The tumors include malignant tumors and benign tumors, selected from at least one of breast cancer, lung cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, ovarian cancer, prostate cancer, bladder cancer, and skin melanoma; The neurological diseases include at least one of Parkinson's disease, Alzheimer's disease, stroke, multiple sclerosis, meningitis, spinal cord injury, and brain tumor; The immune system diseases mentioned include at least one of rheumatoid arthritis, systemic lupus erythematosus, autoimmune thyroid disease, ulcerative colitis, Crohn's disease, scleroderma, and systemic sclerosis; The metabolic diseases mentioned include at least one of diabetes, obesity, hypertension, hyperlipidemia, hyperthyroidism, hypothyroidism, and osteoporosis. The infectious diseases mentioned include at least one of the following: AIDS, hepatitis B, hepatitis C, tuberculosis, malaria, dengue fever, cholera, influenza, and pneumonia.

22. A medicament for the prevention and treatment of diseases related to RNA modification, comprising an antisense oligonucleotide targeting a modification site as described in any one of claims 1 to 12, or the complex as described in claim 14, or the composition as described in claim 15, or the host cell as described in claim 16.

Images