A microcapsule of a prophage lytic enzyme and a method for preparing the same

By preparing prephage lyase microcapsules, the problems of phage lyase inactivation in gastric acid and poor palatability in diseased fish have been solved, thereby improving enzyme stability and bioavailability, making it suitable for green prevention and control in aquaculture.

CN121221747BActive Publication Date: 2026-03-17XIAMEN OCEAN VOCATIONAL & TECH COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-28
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing phage lysins have poor stability in the acidic environment of the stomach, are easily degraded and inactivated, and have poor palatability in diseased fish in aquaculture, making drug administration difficult and resulting in unsatisfactory bioavailability.

Method used

The preparation method of prephage lysin microcapsules includes the efficient expression and purification of recombinant Sply181 lysin, the protection of enzyme activity by using sodium alginate-agarose coating, and the addition of palatability-enhancing ingredients such as scutellarin and vanillin to the outer coating to form a multilayer microcapsule structure.

Benefits of technology

It significantly improves enzyme stability and bioavailability, enhances the feeding willingness of diseased fish, ensures effective drug intake, is suitable for large-scale production, and avoids drug residues and drug resistance problems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121221747B_ABST
    Figure CN121221747B_ABST
Patent Text Reader

Abstract

The application provides a microcapsule of prophage lysozyme and a preparation method thereof, and the preparation method comprises the following steps: transforming an expression plasmid containing a recombinant Sply181 lysozyme gene into engineering bacteria, collecting bacterial bodies after culture induction, obtaining lysozyme through ultrasonic crushing, centrifugation and metal ion affinity chromatography purification; preparing the enzyme into a prophage lysozyme mother liquor by mixing with a calcium chloride solution, adding an emulsifier and an anti-acid antioxidant, homogenizing and emulsifying to form a core material suspension; mixing the core material suspension with a sodium alginate-agarose colloidal solution, homogenizing, dropping into a calcium lactate solution through a spraying or extrusion method, solidifying, collecting microcapsule primary bodies and performing low-temperature vacuum drying and shaping; and mixing the dried microcapsule primary bodies with talc, fishy peptide, vanillin and taurine, and then performing a powder coating operation to obtain the microcapsule of prophage lysozyme. The application has the effects of removing endotoxins in engineering bacteria and adding broad-spectrum attractants, and can significantly improve the feeding desire and intake of fish.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial preparation technology, specifically relating to a prephage lysin microcapsule and its preparation method. Background Technology

[0002] Pathogenic streptococci, especially Streptococcus paramammatidis ( Streptococcus parauberis This disease not only seriously endangers human public health and food safety, but also poses a continuous threat to the healthy development of global livestock and aquaculture industries, causing huge economic losses. Currently, the main treatment for this type of bacterial infection relies on antibiotics, but the overuse and residues of drugs have led to an increasing global problem of drug resistance. Therefore, there is an urgent need to find a green, antibiotic-free new biological agent to address this serious challenge.

[0003] In recent years, enzyme preparations, represented by bacteriophage lysins, have received widespread attention due to their efficient and specific bactericidal capabilities. However, there are still significant bottlenecks in the practical application of these biological agents: their protein structures are unstable in complex environments and are easily degraded and inactivated by gastric acid; in addition, when directly fed to aquatic fish, diseased fish often have low feeding willingness due to palatability issues, resulting in difficulty in administration and unsatisfactory bioavailability.

[0004] In view of this, the present invention proposes a prephage lysin microcapsule and its preparation method, which can effectively solve the problem of lysin inactivation in the gastric acid environment, and significantly improve the feeding willingness of target animals, providing a feasible new strategy for green prevention and control of streptococcal infection in aquaculture and animal husbandry. Summary of the Invention

[0005] The purpose of this invention is to address the problems of degradation and inactivation of lysin under gastric acid, poor palatability, and difficulty in administration, and to propose a prephage lysin microcapsule and its preparation method.

[0006] The technical solution adopted by this invention to solve its technical problem is as follows:

[0007] In a first aspect, the present invention provides a method for preparing prephage lysin microcapsules, the method comprising the following steps:

[0008] S1. The expression plasmid containing the recombinant Sply181 lyase gene was transformed into engineered bacteria. The transformed engineered bacteria were inoculated into liquid culture medium and cultured with shaking until the OD600 was 0.5–0.6. IPTG was added to induce expression. The bacterial cells were collected and the supernatant was obtained by ultrasonic disruption and centrifugation. The supernatant was purified by metal ion affinity chromatography to obtain the prophage lyase Sply181.

[0009] S2. Prepare a prephage lysin Sply181 with calcium chloride solution to form a prephage lysin stock solution, adjust the pH to 6.2–7.0, add emulsifier and anti-acid and antioxidant, and homogenize and emulsify to form a core material suspension;

[0010] S3. The core material suspension is mixed and homogenized with sodium alginate-agarose colloidal solution, and then dripped into calcium lactate solution by spraying or extrusion to solidify. The resulting microcapsule primary bodies are collected and shaped by low-temperature vacuum drying.

[0011] S4. The dried microcapsule precursor is mixed with talc, fish peptide, vanillin and taurine and then coated with powder to obtain prephage lysin microcapsules.

[0012] Preferably, in step S1, the expression plasmid containing the recombinant Sply181 lyase gene is transformed into engineered bacteria. The transformed engineered bacteria are inoculated into liquid culture medium and cultured with shaking until the OD600 (absorbance at 600 nm) reaches 0.5–0.6. IPTG (isopropyl-β-D-thiogalactoside) is added to induce expression. The bacterial cells are collected and disrupted by ultrasonication and centrifugation to obtain the supernatant. The prephage lyase Sply181 is purified by metal ion affinity chromatography. Specifically, the process includes the following sub-steps:

[0013] S11. Transform the expression plasmid containing the recombinant Sply181 lyase gene into engineered bacteria, and select single colonies for activation; inoculate the activated single colonies into LB liquid medium and culture with shaking at 35-38℃ and 120-150rpm until the OD600 is 0.5-0.6;

[0014] S12. Add IPTG to the culture system at a final concentration of 0.8-1.0 μmol / L and induce expression at 18-25℃ for 10-14 hours.

[0015] S13. Centrifuge at 4℃ and 5000-6000 rpm for 15-25 min, collect the induced bacterial cells, and resuspend the induced bacterial cells with Ni affinity column buffer A;

[0016] S14. The resuspended bacterial cells are disrupted by ultrasonic waves. After disruption, the bacterial cells are centrifuged at 4°C and 12,000-15,000 rpm for 20-30 minutes, and the supernatant is collected.

[0017] S15. Load the supernatant onto a Ni affinity column and elute with buffer B in a gradient to obtain the prophage lysin Sply181.

[0018] More preferably, buffer A contains 10% (w / v) glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-Cl and 50 mmol / L imidazole.

[0019] More preferably, buffer B contains 10% (w / v) glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-Cl and 500 mmol / L imidazole.

[0020] Preferably, in step S2, the prephage lysin Sply181 is prepared into a prephage lysin stock solution with calcium chloride solution, the pH is adjusted to 6.2–7.0, an emulsifier and an anti-acid and antioxidant are added, and the solution is homogenized and emulsified to form a core material suspension. Specifically, this includes the following sub-steps:

[0021] S21. Prepare a 30-40 μg / mL prephage lysin stock solution by mixing the prephage lysin Sply181 with a calcium chloride solution at a mass-to-volume ratio of 0.8-1.0%. Adjust the pH of the prephage lysin stock solution to 6.2-7.0. Add 0.1-0.5% Tween 80 and 0.05-0.2% magnesium stearate at a mass-to-volume ratio to emulsify into a suspension.

[0022] S22. Add xanthan gum (0.1-0.3% by mass / volume), ascorbic acid (0.05-0.15% by mass / volume), and tocopheryl acetate (0.3-0.7% by mass / volume) to the suspension. Homogenize and emulsify at 1000-1500 rpm for 20-30 minutes at 40-50°C to form a uniform and stable core material suspension.

[0023] Preferably, in step S3, the core material suspension is mixed and homogenized with the sodium alginate-agarose colloidal solution, then dripped into the calcium lactate solution by spraying or extrusion for solidification. The resulting microcapsule precursors are collected and then dried and shaped under low-temperature vacuum. Specifically, this includes the following sub-steps:

[0024] S31. Prepare a mixed colloidal solution of sodium alginate and agarose with a mass-to-volume ratio of 1.5-2.5% and stir in a water bath at 60-70℃ until completely dissolved.

[0025] S32. Mix the core material suspension and the mixed colloidal solution at a volume ratio of 1:2-1:4, and homogenize at 800-1200 rpm for 15-25 minutes at 45-55℃ to obtain the mixed solution.

[0026] S33. Using a spraying or squeezing device, spray the mixture into a 2-4 g / L calcium lactate solution to solidify, and collect the resulting microcapsule primary bodies;

[0027] S34. Soak the microcapsule precursor in a 15% (w / v) glycerol solution for 1-2 hours, rinse with water, and then vacuum dry at -5°C to -3°C for 6-10 hours to complete the curing and shaping.

[0028] Preferably, in step S4, the dried microcapsule precursor is mixed with talc, fish peptide, vanillin, and taurine, and then coated with powder to obtain prephage lysin microcapsules, specifically including the following sub-steps:

[0029] S41. The dried microcapsule primary body is mixed with talc, fish peptide, vanillin and taurine to obtain a mixture;

[0030] S42. Place the mixture in a fluidized bed coating device and perform a coating operation at a speed of 5-10 rpm for 10-15 minutes;

[0031] S43. Spray the powdered material with a 20-30% ethanol aqueous solution to moisten it, then coat the moistened material with powder again, and repeat the spraying and powdering process 2-3 times.

[0032] S44. Dry the final processed material at 30-35℃ for 1-2 hours to obtain prephage lysin microcapsules.

[0033] More preferably, in step S41, the mass ratio of talc, scutellarin, vanillin, and taurine is (8-12): (1-3): (0.5-1.5): (0.5-2).

[0034] More preferably, in step S43, the spraying rate is 5-15 mL / min, and the wetting operation time is 2-5 minutes.

[0035] Secondly, the present invention provides a prephage lysin microcapsule prepared by any of the above-described preparation methods, the prephage lysin microcapsule comprising a core material, an encapsulation layer, and a coating, wherein:

[0036] The core material contains prephage lysin Sply181, calcium chloride, emulsifier, antacid, and antioxidant; the coating layer contains sodium alginate and agarose; the coating contains talc, succinate, vanillin, and taurine; and the microcapsules have a particle size of 150-320 μm.

[0037] In summary, compared with the prior art, the prephage lysin microcapsules and their preparation method provided by the present invention have the following beneficial effects:

[0038] (1) High efficiency expression and high purity acquisition: By optimizing the induction expression conditions of recombinant engineered bacteria (such as IPTG concentration, temperature and time) and combining them with metal ion affinity chromatography purification process, this invention can efficiently and with high purity obtain the biologically active prophage lysin Sply181, providing high-quality core raw materials for microcapsule preparation.

[0039] (2) Significantly enhances enzyme stability and bioavailability: This invention constructs a microcapsule system with sodium alginate-agarose as the coating layer and supplements it with antacids and antioxidants (such as ascorbic acid and tocopheryl acetate), which effectively protects the activity of the lyase in the gastric acid environment and during storage, prevents it from being degraded and inactivated, and thus greatly improves its oral bioavailability.

[0040] (3) Excellent targeting and feeding ability and drug compliance: The present invention innovatively adds fish peptides, vanillin and taurine and other ingredients with broad-spectrum feeding effects to the microcapsule coating, which significantly improves palatability, solves the problem of drug administration caused by low feeding willingness of diseased fish, and ensures effective drug intake.

[0041] (4) The process is controllable, reproducible, and suitable for large-scale production: The entire preparation process of this invention is clear, and the parameters of key steps (such as concentration, temperature, rotation speed, time, etc.) have been precisely optimized and limited. The operation methods (such as spray / extrusion molding, fluidized bed coating) are mature and controllable, ensuring the stability and reproducibility of product quality, and making it easy to scale up and achieve large-scale production.

[0042] (5) Green and safe with broad application prospects: The prephage lysin microcapsule product of the present invention uses biological enzymes to replace antibiotics, which fundamentally avoids the problems of drug residues and drug resistance. It is a green and safe biological agent, which provides an effective solution for the green prevention and control of streptococcal infection in aquaculture and animal husbandry, and has huge market application potential. Attached Figure Description

[0043] Other features, objects, and advantages of this application will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0044] Figure 1 This is a flowchart of the preparation method of the prephage lysin microcapsules of the present invention;

[0045] Figure 2 This is a diagram of the predicted prophage in the genome of Streptococcus paramamosa KRS02083;

[0046] Figure 3 This is a predicted structural diagram of the prephage lysin Sply181;

[0047] Figure 4This is a diagram showing the expression and purification of the prophage lysin Sply181;

[0048] Figure 5 This is a schematic diagram illustrating the bactericidal activity of the prophage lysin Sply181 against different bacteria.

[0049] Figure 6 This is a schematic diagram illustrating the effect of pH on the bactericidal activity of the prephage lysin Sply181.

[0050] Figure 7 This is a schematic diagram illustrating the effect of temperature on the bactericidal activity of the prephage lysin Sply181. Detailed Implementation

[0051] The present application will now be described in further detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it. Furthermore, it should be noted that, for ease of description, only the parts relevant to the invention are shown in the accompanying drawings.

[0052] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. This application will now be described in detail with reference to the accompanying drawings and embodiments.

[0053] Figure 1 A flowchart illustrating the preparation method of the prephage lysin microcapsules of the present invention is shown, as follows: Figure 1 As shown, the method includes the following steps:

[0054] S1. Transform the expression plasmid containing the recombinant Sply181 lyase gene into engineered bacteria. Inoculate the transformed engineered bacteria into liquid culture medium and culture with shaking until the OD600 reaches 0.5–0.6. Add IPTG to induce expression, collect the bacterial cells, and obtain the supernatant by ultrasonic disruption and centrifugation. Purify the supernatant by metal ion affinity chromatography to obtain the prophage lyase Sply181. The specific steps include the following:

[0055] S11. Transform the expression plasmid containing the recombinant Sply181 lyase gene into engineered bacteria, and select single colonies for activation; inoculate the activated single colonies into LB liquid medium and culture with shaking at 35-38℃ and 120-150rpm until the OD600 is 0.5-0.6;

[0056] S12. Add IPTG to the culture system at a final concentration of 0.8-1.0 μmol / L and induce expression at 18-25℃ for 10-14 hours.

[0057] S13. Centrifuge at 4℃ and 5000-6000 rpm for 15-25 min, collect the induced bacterial cells, and resuspend the induced bacterial cells in Ni affinity column buffer A, which contains 10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-Cl and 50 mmol / L imidazole.

[0058] S14. The bacterial cells were disrupted and resuspended using ultrasound. After disruption, the bacterial cells were centrifuged at 4°C and 12,000-15,000 rpm for 20-30 minutes, and the supernatant was collected.

[0059] S15. Load the supernatant onto a Ni affinity column and elute with a gradient using buffer B to obtain the prophage lysin Sply181, where buffer B contains 10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-Cl, and 500 mmol / L imidazole.

[0060] S2. Prepare a prephage lysin Sply181 stock solution by mixing it with calcium chloride solution, adjust the pH to 6.2–7.0, add emulsifier and anti-acid and antioxidant agents, and homogenize and emulsify to form a core material suspension. This process includes the following sub-steps:

[0061] S21. Prepare a 30-40 μg / mL prephage lysin stock solution by mixing the prephage lysin Sply181 with a calcium chloride solution at a mass-to-volume ratio of 0.8-1.0%. Adjust the pH of the prephage lysin stock solution to 6.2-7.0. Add 0.1-0.5% Tween 80 and 0.05-0.2% magnesium stearate at a mass-to-volume ratio to emulsify into a suspension.

[0062] S22. Add xanthan gum (0.1-0.3% by mass / volume), ascorbic acid (0.05-0.15% by mass / volume), and tocopheryl acetate (0.3-0.7% by mass / volume) to the suspension. Homogenize and emulsify at 1000-1500 rpm for 20-30 minutes at 40-50°C to form a uniform and stable core material suspension.

[0063] S3. The core material suspension is mixed and homogenized with sodium alginate-agarose colloidal solution, and then dripped into calcium lactate solution by spraying or extrusion for solidification. The resulting microcapsule prototypes are collected and fixed by low-temperature vacuum drying. The specific steps include the following:

[0064] S31. Prepare a mixed colloidal solution of sodium alginate and agarose with a mass-to-volume ratio of 1.5-2.5% and stir in a water bath at 60-70℃ until completely dissolved.

[0065] S32. Mix the core material suspension and the mixed colloidal solution at a volume ratio of 1:2-1:4, and homogenize at 800-1200 rpm for 15-25 minutes at 45-55℃ to obtain the mixed solution.

[0066] S33. Using a spraying or squeezing device, spray the mixture into a 2-4 g / L calcium lactate solution to solidify, and collect the resulting microcapsule primary bodies;

[0067] S34. Soak the microcapsule precursor in a 15% (w / v) glycerol solution for 1-2 hours, rinse with water, and then vacuum dry at -5°C to -3°C for 6-10 hours to complete the curing and shaping.

[0068] S4. The dried microcapsule precursor is mixed with talc, fish peptide, vanillin, and taurine, and then coated with powder to obtain prephage lysin microcapsules. This process includes the following sub-steps:

[0069] S41. The dried microcapsule primary body is mixed with talc, fish peptide, vanillin and taurine to obtain a mixture, wherein the mass ratio of talc, fish peptide, vanillin and taurine is (8-12): (1-3): (0.5-1.5): (0.5-2);

[0070] S42. Place the mixture in a fluidized bed coating device and perform a coating operation at a speed of 5-10 rpm for 10-15 minutes;

[0071] S43. Spray the powdered material with a 20-30% ethanol aqueous solution to wet it. The spraying rate is 5-15 mL / min and the wetting time is 2-5 minutes. Then, coat the wetted material with powder again and repeat the spraying and coating process 2-3 times.

[0072] S44. Dry the final processed material at 30-35℃ for 1-2 hours to obtain prephage lysin microcapsules.

[0073] In one specific embodiment, prephage lysin microcapsules can be prepared by the following steps:

[0074] (1) Batch preparation and purification of the prophage lysin Sply181:

[0075] The recombinant pET28a(+)-Sply181 plasmid was transformed into *Escherichia coli* BL21(DE3) engineered bacteria, and single colonies were selected for activation. The activated single colonies were inoculated into LB liquid medium at a 1% (v / v) inoculum and cultured at 37°C and 150 rpm with shaking until the OD600 reached 0.5-0.6. IPTG was added to the culture system to a final concentration of 1 mmol / L, and expression was induced at 25°C for 12 hours. After induction, the bacterial cells were collected by centrifugation at 4°C and 6000 r / min for 20 minutes, and resuspended in buffer A (containing 10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-HCl pH 8.0, and 50 mmol / L imidazole). The bacterial cells were disrupted using an ultrasonic cell disruptor (20% power, 3 s sonication, 3 s interval). The disrupted bacterial suspension was then incubated at 4°C and 12000 r / min. Centrifuge at r / min for 20 minutes and collect the supernatant; use NCG™ Chromatography System to load the supernatant onto a Ni affinity chromatography column, and perform gradient elution with buffer B (containing 10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-HCl pH 8.0, and 500 mmol / L imidazole), collect the elution peaks, and obtain high-purity prophage lysin Sply181. (2) Preparation of core material suspension:

[0076] The purified prephage lysin Sply181 was prepared into a 35 μg / mL prephage lysin stock solution with 0.85% calcium chloride solution. The pH was adjusted to 6.2 with dilute hydrochloric acid or sodium hydroxide solution. 0.3% Tween 80 and 0.1% magnesium stearate were added to initially emulsify into a suspension. Xanthan gum (0.2% by volume) as a stabilizer, ascorbic acid (0.1% by volume) and tocopheryl acetate (0.5% by volume) were added to this suspension as acid and antioxidant agents. The mixture was homogenized and emulsified at 45℃ and 1200 rpm for 30 minutes to form a uniform and stable core material suspension.

[0077] (3) Formation and solidification of microcapsule prototypes:

[0078] A mixed colloidal solution of sodium alginate (2% by volume) and agarose (1% by volume) was prepared and stirred in a water bath at 65°C until completely dissolved. The core material suspension was mixed with the mixed colloidal solution at a volume ratio of 1:3 and homogenized at 50°C and 1000 rpm for 20 minutes. The mixture was then dripped into a 3 g / L calcium lactate solution using an extrusion device to solidify and shape the microcapsules. After standing, the microcapsule precursors were collected. The obtained microcapsule precursors were immersed in a 15% glycerol solution for 1.5 hours, washed three times with deionized water, and then dried at -4°C under vacuum for 8 hours to complete the shaping.

[0079] (4) Coating and finished product preparation:

[0080] The dried and shaped microcapsule precursors were mixed with talc, scutellarin, vanillin, and taurine at a mass ratio of 10:2:1:1. The mixture was placed in a fluidized bed coating apparatus and coated with powder at 8 rpm for 12 minutes. Subsequently, it was sprayed with a 25% ethanol aqueous solution at a rate of 10 mL / min for 2 minutes to moisten the microcapsules, and the powder coating process was repeated twice. Finally, the coated microcapsules were dried at 32℃ for 1.5 hours to obtain the final prephage lysin microcapsule product. The particle size of this product is mainly distributed in the range of 180-300 μm, with an encapsulation efficiency of over 90%, and it exhibits good sustained-release performance and enzyme activity retention in a simulated gastric acid environment.

[0081] This invention also proposes a prephage lysin microcapsule prepared by the above-described method, the prephage lysin microcapsule comprising a core material, a coating layer, and a coating, wherein:

[0082] The core material contains prephage lysin Sply181, calcium chloride, emulsifier, antacid, and antioxidant; the coating layer contains sodium alginate and agarose; the coating contains talc, succinate, vanillin, and taurine; and the microcapsules have a particle size of 150-320 μm.

[0083] Among them, sodium alginate microcapsules effectively overcome the technical bottlenecks of enzyme preparations, such as poor water solubility, easy precipitation, susceptibility of bactericidal effects to environmental factors (such as pH and temperature), and easy degradation and inactivation by gastric acid. Sodium alginate and trehalose can resist the digestive action of gastric acid, and the lipid emulsified core ensures slow absorption of the drug after reaching the intestine. With the addition of a disintegration system such as talc, it can achieve the dual effects of enteric-coated sustained release and water-based sustained release. In vitro simulation experiments show that the microcapsules can maintain structural integrity for 4 hours in a gastric acid environment and for 8 hours in water. After disintegration, they reach saturation concentration on average 19 hours. Due to their small size and poor solubility in water, these microcapsules are suitable for all growth stages from fry to adult fish. At the same time, the interior of the microcapsule can provide optimal bactericidal activity conditions for the lysin, such as suitable pH value, synergistic ion concentration, and temperature.

[0084] The outer coating of the microcapsules is composed of highly diffusive attractants. Fish peptides have an excellent attractant effect on carnivorous and omnivorous fish, while vanillin, as a volatile flavoring agent, can assist in attracting and stimulating herbivorous fish, thereby comprehensively improving the fish's willingness to feed.

[0085] In a specific embodiment, the product composition of the prephage lysin microcapsule includes, based on the total system, the following components in the following amounts: 1200 mL water, 5 g tocopheryl acetate, 3 g calcium lactate, 2 g xanthan gum, 2 g sodium alginate, 1 g ascorbic acid, 1 g agarose, 1 g magnesium stearate, 0.85 g calcium chloride, 0.8 g talc, 0.5 g succinate peptide, 0.5 g vanillin, and 0.035 g prephage lysin Sply181. Its product structure is a multilayer microcapsule system with a prephage lysin emulsion as the core material, a sodium alginate-agarose composite gel as the encapsulation layer, and talc and palatability enhancers (succinate peptide and vanillin) as the coating. Its physical properties are: microcapsule diameter 150-320 μm, encapsulation efficiency ≥90%, and sustained-release properties and high enzyme activity retention in a simulated gastric acid environment.

[0086] In the above specific embodiments, although only some specific parameters are used as examples for illustration, those skilled in the art will understand that other values ​​not explicitly illustrated in the claims of this invention can also achieve the technical effects of this invention and should all be considered to be included within the protection scope of this invention.

[0087] Example 1: Discovery of prophage lysin in Streptococcus paramamosain

[0088] Bioinformatics was used to predict the prophage of Streptococcus paramammatidis, locate the lysin within it, and perform homology alignment and structural prediction to identify candidate lysins. Whole-genome sequencing results showed that the total genome length of KRS02083 was 1830138 bp.

[0089] Figure 2 The diagram shows the predicted prophage in the genome of Streptococcus paramamosa KRS02083, as shown below. Figure 2 As shown, the PHASTER website predicts that its genome contains eight prephage regions: Region 1 (139-182 Kbp), Region 2 (246-252 Kbp), Region 3 (471-501 Kbp), Region 4 (715-761 Kbp), Region 5 (1.02-1.04 Mbp), Region 6 (1.14-1.15 Mbp), Region 7 (1.16-1.18 Mbp), and Region 8 (1.27-1.32 Mbp).

[0090] Region 1 encodes a 726 bp phage lyase. SMART analysis revealed that this lyase encodes an Amidase-5 catalytic domain (EAD) (14-153 aa) and an SH3b binding domain (CBD) (178-238 aa), which was named Sply181. Please refer to [link / reference needed]. Figure 3 , Figure 3 The predicted structure of the prephage lysin Sply181 is shown.

[0091] Example 2: Preparation of the lyase Sply181 via genetic engineering

[0092] Gene cloning of the prophage lysin Sply181: Using the genomic DNA of the host bacterium KRS02083 as a template, the gene Sply181 was amplified by 2×phanta mix PCR with primers F(5'-CATG). CCATGG ATGTCTAAAATTAAATCAAGT -3') and R (5'- CCG CTCGAG CATTTCCTCAGCATCAATAAG-3'), where the underlined sequences are the restriction enzyme sites of Nco I and Xho I, respectively. PCR reaction system: Primer F (10 μmol / L) 2 μL, primer R (10 μmol / L) 2 μL, KRS02083 genomic DNA (50 ng / μL) 2 μL, 2×phanta mix 25 μL, ddH2O 19 μL. PCR reaction conditions: 95 °C 5 min; 95 °C 30 s, 55 °C 30 s, 72 °C 1 min, 30 cycles, 72 °C 5 min. 2 μL of PCR amplification product was detected by 0.8% agarose gel electrophoresis, and the PCR product was recovered using a gel extraction kit.

[0093] Figure 4 The expression and purification diagrams of the prophage lysin Sply181 are shown, in conjunction with reference. Figure 4 ,

[0094] The recombinant pET28a(+)-Sply181 plasmid was transformed into engineered bacteria, and single colonies were activated. A 1% inoculum was inoculated into LB liquid medium and cultured at 37°C and 350 rpm in a PNZ-500CS (single-layer) large-scale shaking incubator until the OD600 reached 0.5-0.6. IPTG was added to a final concentration of 1 μmol / L, and the culture was brought to room temperature to induce protein expression for 12 h. The bacterial culture was collected, centrifuged at 4°C and 6000 rpm for 20 min, and the induced bacterial cells were collected. The supernatant was discarded, and the cells were resuspended in Ni affinity column buffer A solution (10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-Cl 8.0, 50 mmol / L imidazole). The cells were then disrupted by sonication (20% power, 3 s intervals). The disrupted cells were centrifuged at 4°C and 12000 rpm for 20 min, and the supernatant was collected. NCG was then used to analyze the protein expression. TM The chromatography system loads the supernatant onto a Ni affinity column, followed by gradient elution with Buffer B (10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-Cl 8.0, 500 mmol / L imidazole) to collect the prephage lysin protein fraction.

[0095] Example 3: Experiment on the bactericidal effect of the lysin Sply181 on different bacteria:

[0096] Fish-derived Streptococcus paramammatidis (KRS02083, NUF1003, NUF1071, NUF1032, NUF1095, 2007-1), Lactococcus gasseri (NUF18, NUF1134), Staphylococcus aureus ATCC 43300, Enterococcus faecalis ATCC 35667, Enterococcus faecium ATCC 51299, Bacillus subtilis ATCC 6633, Vibrio violaceus 12472, and Pseudomonas aeruginosa PAO1 cultured to the logarithmic growth phase (OD600 around 0.6) were centrifuged at 4°C, 5000 r / min for 10 min to collect bacterial cells. The cells were resuspended in 20 mmol / L ammonium acetate buffer (pH 6.2), centrifuged and resuspended three times, and the OD600 of the bacterial culture was adjusted to 0.5-0.6. The bactericidal activity of the lyase Sply181 was determined using a turbidity decrease assay. The specific method is as follows: 88 μL of the prepared bacterial culture and 2 μL of Ca were added to a 96-well plate. 2+10 μL of Sply181 lyase (final concentration 35 μg / mL) and 10 μL of ammonium acetate buffer were reacted at 28 °C for 30 min, and the OD value was measured at 600 nm using a microplate reader. The experiment was repeated 3 times, and the data were averaged. Figure 5 The diagram illustrates the bactericidal activity of the prephage lysin Sply181 against different bacteria, such as... Figure 5 As shown, the experimental results indicate that the enzyme exhibits significantly higher bactericidal activity against its host bacteria (Streptococcus paramammatidis) than against other bacteria. Specifically, the bactericidal efficiencies against type I KRS02083, NUF1003, NUF1071, type II NUF1032, untyped NUF1095, and 2007-1 are (62%±1%), (76%±3%), (60%±2%), (68%±2%), (71%±1%), and (68%±1%), respectively. The bactericidal efficiency against Enterococcus faecalis reaches 41±5%. However, the bactericidal efficiency against Enterococcus faecalis, Bacillus subtilis, Staphylococcus aureus, and two strains of Lactococcus grease is less than 10%. Furthermore, the enzyme has no bactericidal activity against Gram-negative violacea bacteria and Pseudomonas aeruginosa.

[0097] Example 4: Effect of pH on the bactericidal activity of the lysin Sply181

[0098] After adjusting the pH of the 20 mmol / L ammonium acetate buffer to 4.2, 5.2, 6.2, 7.2, 8.2 and 9.2 respectively (pH was adjusted with HCl for pH below 6.2 and with ammonia for pH above 6.2), the bactericidal activity of the lyase Sply181 against the host bacterium KRS02083 was tested under different pH conditions, referring to the turbidity reduction experiment method in Example 3. Figure 6 A schematic diagram illustrating the effect of pH on the bactericidal activity of the prephage lysin Sply181 is shown, as follows: Figure 6 As shown, the results indicate that the enzyme maintained more than 48% bactericidal activity at pH 5.2 and 7.2, with no significant difference between the two. The enzyme exhibited the best bactericidal effect at pH 6.2, with a 14% increase in bactericidal activity compared to pH 7.2. The bactericidal activities at pH 4.2, 8.2, and 9.2 were 19±2%, 17±2%, and 14±2%, respectively.

[0099] Example 5: Effect of temperature on the bactericidal activity and thermal stability of the lyase Sply181

[0100] Referring to the turbidity reduction experiment method in Example 3, using host bacterium KRS02083 as a substrate, the bactericidal activity of the lyase Sply181 was tested under different temperatures (4, 15, 28, 37, 45, 55℃). The enzyme was heat-treated at different temperatures (65, 70, 75, 80, 85, 90, and 95℃) for 30 min, and then reacted with host bacterium KRS02083 at 28℃ for 30 min to investigate the thermal stability of the lyase Sply181. The effect of temperature on the bactericidal effect of the lyase Sply181 is as follows: Figure 7 As shown in Figure A, when the reaction temperature is between 4-15℃, the bactericidal activity of this enzyme is less than 40%; when the reaction temperature is between 28-55℃, the bactericidal activity of this enzyme remains above 56%, with the highest bactericidal activity, maintained above 66%, at a temperature of 28℃. Thermostability results of the enzyme ( Figure 7 B) indicates that the bactericidal activity of the enzyme after treatment at 65-85℃ for 30 min was not significantly different from that of the enzyme without heat treatment, and the activity remained above 60%, indicating that the lyase Sply181 has good heat resistance.

[0101] Example 6: Preparation of pharmaceutical microcapsules of the lysin Sply181

[0102] Take 0.035g of purified lyase, homogenize it, add 1000ml of pure water and mix well. Add 5g of tocopheryl acetate, 2g of xanthan gum, 2g of sodium alginate, 1g of ascorbic acid, 1g of agarose, and 0.85g of calcium chloride. Stir magnetically at 45℃ for 20 minutes to prepare a micro-suspension. Mix 3g of calcium lactate and 1g of magnesium stearate, add 200ml of pure water and heat to 100℃ to dissolve. Then add 800ml of pure water and cool to 21℃. Spray 100ml of sodium alginate lyase micro-suspension into the calcium lactate solution from a height of 50cm. Repeat this operation 10 times. Remove the lower capsules, immerse them in 15% glycerol for 1 hour, and then wash them with water to obtain lyase microcapsules. Finally, vacuum dry the microcapsules at -4℃ to solidify them. Mix them with talc, fish peptides, vanillin, and taurine, coat them with powder, spray with water, and repeat the coating process twice to complete the final product preparation. The quality attributes of the microcapsules are as follows:

[0103] Table 1 Summary of Key Quality Attributes of Microcapsules

[0104]

[0105] Example 7: The therapeutic effect of lyase microcapsules on streptococcal paramammatidia infection in juvenile tilapia.

[0106] Three hundred healthy tilapia juveniles (average weight 10.0 ± 2.0 g) were selected and temporarily housed in a temperature-controlled (28 ± 1℃) recirculating aquatic system for one week. They were randomly divided into four groups: A (microcapsule treatment group), B (free lyase treatment group), C (antibiotic positive control group), D (infection negative control group), and E (blank control group), with 60 fish in each group (three replicates). The treatment involved intraperitoneal injection of a concentration of 1×10⁻⁶ g. 7 Fish in groups A, B, C, and D were artificially infected with 100 μL of a CFU / mL Streptococcus paramamosa suspension, while group E was injected with an equal volume of PBS. Fish were fed twice daily (09:00 and 17:00) at 3% of their body weight for 14 consecutive days. Mortality was observed and recorded for each group. Survival rate was calculated as (number of surviving fish at the end / initial number of fish) × 100%, and relative protection rate was calculated as [1 - (mortality rate in the treatment group / mortality rate in the infection control group)] × 100%. The experimental results are as follows:

[0107] Table 2. Statistical table of survival rate and relative protection rate of tilapia in each group

[0108]

[0109] Note: Different letters in the same column indicate significant differences (P<0.05). The relative protection rate was calculated based on the mortality rate of the infection control group (Group D).

[0110] In summary, the core of this invention lies in the application of prophage lyase. Compared to phage drugs, it poses no biosafety risks and is easier to store; compared to traditional antibiotics, its bactericidal mechanism is unique and less likely to induce drug resistance in bacteria. This invention optimizes the production process of prophage lyase, effectively removing the endotoxins inherent in engineered bacteria. Simultaneously, it constructs a microcapsule system and adds a broad-spectrum attractant, significantly increasing fish's willingness to consume and their feed intake, effectively overcoming the problem of drug refusal caused by loss of appetite in diseased fish. The microcapsule encapsulation technology maximizes the preservation of the activity of the prophage lyase, thereby ensuring optimal therapeutic effects. Furthermore, the product is a microcapsule dosage form, whose physicochemical properties overcome incompatibilities and interactions between different drugs. It can be mixed with antibiotics, non-injectable vaccines, and traditional Chinese medicines without causing antagonistic interactions.

[0111] The above description is merely a preferred embodiment of this application and an explanation of the technical principles employed. Those skilled in the art should understand that the scope of the invention involved in this application is not limited to technical solutions formed by specific combinations of the above-described technical features, but should also cover other technical solutions formed by arbitrary combinations of the above-described technical features or their equivalents without departing from the above-described inventive concept. For example, technical solutions formed by substituting the above features with (but not limited to) technical features with similar functions disclosed in this application.

Claims

1. A method for the preparation of a microcapsule of a prophage lytic enzyme, characterized by, The preparation method comprises the following steps: S1, transforming an expression plasmid containing a recombinant Sply181 lytic enzyme gene into an engineering bacterium, inoculating the transformed engineering bacterium into a liquid culture medium, and oscillating and culturing until OD600 is 0.5-0.6, then adding IPTG to induce expression, collecting bacterial bodies, and obtaining supernatant by ultrasonic crushing and centrifugation, and obtaining the prophage lytic enzyme Sply181 by metal ion affinity chromatography purification, wherein the prophage lytic enzyme Sply181 has an Amidase-5 catalytic domain and an SH3b binding domain, and the amino acid sequence of the prophage lytic enzyme Sply181 is shown as SEQ ID NO: 4; S2, preparing the prophage lytic enzyme Sply181 into a prophage lytic enzyme mother liquor with a calcium chloride solution, adjusting the pH to 6.2-7.0, adding an emulsifier and an anti-acid antioxidant, and homogenizing and emulsifying to form a core material suspension, specifically comprising the following sub-steps: S21, preparing the prophage lytic enzyme Sply181 and a calcium chloride solution with a mass-volume ratio of 0.8-1.0% into a prophage lytic enzyme mother liquor of 30-40 μg / mL, adjusting the pH of the prophage lytic enzyme mother liquor to 6.2-7.0, and adding Tween 80 with a mass-volume ratio of 0.1-0.5% and magnesium stearate with a mass-volume ratio of 0.05-0.2% to emulsify into a suspension sub-liquid; S22, adding xanthan gum with a mass-volume ratio of 0.1-0.3%, ascorbic acid with a mass-volume ratio of 0.05-0.15%, and tocopherol acetate with a mass-volume ratio of 0.3-0.7% to the suspension sub-liquid, and homogenizing and emulsifying at a speed of 1000-1500 rpm at 40-50°C for 20-30 minutes to form a uniform and stable core material suspension; S3, mixing and homogenizing the core material suspension with a sodium alginate-agarose colloidal solution, solidifying by dropping into a calcium lactate solution through a spraying or extruding method, collecting the obtained microcapsule primary body, and performing low-temperature vacuum drying and shaping, specifically comprising the following sub-steps: S31, preparing a mixed colloidal solution of sodium alginate with a mass-volume ratio of 1.5-2.5% and agarose with a mass-volume ratio of 0.8-1.2%, and stirring in a 60-70°C water bath until completely dissolved; S32, mixing the core material suspension and the mixed colloidal solution at a volume ratio of 1:2-1:4, and homogenizing at 800-1200 rpm at 45-55°C for 15-25 minutes to obtain a mixed liquid; S33, using a spraying device or an extruding device to spray the mixed liquid into a 2-4 g / L calcium lactate solution for solidification, and collecting the formed microcapsule primary body; S34, soaking the microcapsule primary body in a 15% glycerol solution for 1-2 hours, washing with clean water, and then placing it in a -5°C to -3°C environment for vacuum drying for 6-10 hours to complete solidification and shaping; S4, mixing the dried microcapsule primary body with talcum powder, fishy peptide, vanillin, and taurine, and then performing powder coating to obtain the prophage lytic enzyme microcapsule.

2. The method of claim 1, wherein the phage lytic enzyme microcapsules are prepared by the steps of: In step S1, the expression plasmid containing the recombinant Sply181 lytic enzyme gene is transformed into the engineering bacteria, the transformed engineering bacteria are inoculated in the liquid medium, and the bacteria are cultured at 35-38°C and 120-150 rpm until the OD600 is 0.5-0.

6. Then, IPTG is added to induce expression, and the bacteria are collected and broken by ultrasonic wave. The supernatant is obtained by centrifugation, and the pro-phage lytic enzyme Sply181 is obtained by metal ion affinity chromatography purification. The specific steps include the following sub-steps: S11, the expression plasmid containing the recombinant Sply181 lytic enzyme gene is transformed into the engineering bacteria, and the single colony is selected for activation; the activated single colony is inoculated in the LB liquid medium, and the bacteria are cultured at 35-38°C and 120-150 rpm until the OD600 is 0.5-0.6; S12, IPTG is added to the culture system to a final concentration of 0.8-1.0 μmol / L, and the expression is induced at 18-25°C for 10-14 hours; S13, the bacteria are collected by centrifugation at 4°C and 5000-6000 rpm for 15-25 min, and the bacteria are resuspended with Ni affinity column buffer A; S14, the resuspended bacteria are broken by ultrasonic wave, and the broken bacteria are centrifuged at 4°C and 12000-15000 rpm for 20-30 min to collect the supernatant; S15, the supernatant is loaded onto the Ni affinity column, and the pro-phage lytic enzyme Sply181 is obtained after gradient elution with buffer B.

3. The method for preparing prophage lysin microcapsules according to claim 2, characterized in that, The buffer A comprises 10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-HCl and 50 mmol / L imidazole.

4. The method of claim 2, wherein the phage lytic enzyme microcapsules are prepared by the steps of: The buffer B comprises 10% glycerol, 500 mmol / L NaCl, 20 mmol / L Tris-HCl and 500 mmol / L imidazole.

5. The method for preparing prophage lysin microcapsules according to claim 1, characterized in that, In step S4, the dried microcapsule primary body is mixed with talc, fishy peptide, vanillin and taurine, and then powder coating is performed to obtain the pro-phage lytic enzyme microcapsule. The specific steps include the following sub-steps: S41, the dried microcapsule primary body is mixed with talc, fishy peptide, vanillin and taurine to obtain a mixture; S42, the mixture is placed in a fluidized bed coating device, and powder coating is performed at a speed of 5-10 rpm for 10-15 min; S43, the powder-coated material is sprayed with 20-30% ethanol aqueous solution for wetting, and the wetted material is again subjected to powder coating, and the wetting and powder coating processes are repeated 2-3 times; S44, the finally treated material is dried at 30-35°C for 1-2 hours to obtain the pro-phage lytic enzyme microcapsule.

6. The method of claim 5, wherein the phage lytic enzyme microcapsules are prepared by the steps of: In step S41, the mass ratio of talc, fishy peptide, vanillin and taurine is (8-12) :(1-3) :(0.5-1.5) :(0.5-2).

7. The method of producing phage lytic enzyme microcapsules according to claim 5, characterized by, In step S43, the spraying rate is 5-15 mL / min, and the wetting time is 2-5 min.

8. Prophage lysing enzyme microcapsules produced by the production process according to any one of claims 1 to 7, characterized in that The pro-phage lytic enzyme microcapsule comprises a core material, a wrapping layer and a coating. The core material comprises pre-phage lytic enzyme Sply181, calcium chloride, emulsifier, antacid and antioxidant; the coating layer comprises sodium alginate and agarose; the coating comprises talc, fishy peptide, vanillin and taurine; the particle size of the microcapsule is 150-320 μm.