SNP molecular marker for rapid identification of salt tolerance character of siniperca chuatsi and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for rapidly identifying the salt tolerance character of siniperca chuatsi, the SNP molecular marker is located at the 185th site of a sequence shown as SEQ ID NO: 1, and the mutation type of the SNP molecular marker is A / C; when the genotype of the SNP molecular marker is CC or AC, it can be determined that the siniperca chuatsi has excellent salt tolerance character potential. The invention further discloses a primer and a kit for detecting the SNP molecular marker, and a method for rapidly identifying the salt tolerance character of siniperca chuatsi. The invention further discloses application of the primer, the kit and the method in breeding the salt-tolerant siniperca chuatsi.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology for aquatic animals, specifically relating to SNP molecular markers and their applications for rapid identification of salt tolerance traits in mandarin fish. Background Technology

[0002] Salinity, as a key ecological factor in the aquatic environment, has a significant impact on the growth, survival, and homeostasis of fish. The salt content in a fish's body determines its adaptability to aquatic environments with varying salinity. While the salinity of both marine and freshwater fish is typically close to 7‰, the osmotic pressure of their body fluids differs considerably from that of the surrounding water at different salinities, forcing them to adjust their osmotic pressure to adapt. However, research on the salinity adaptation mechanisms of freshwater fish is relatively limited. Conducting research on fish salinity adaptation mechanisms, particularly elucidating their adaptation mechanisms in high and low salinity environments, is of great significance for breeding salt-tolerant species and achieving brackish water aquaculture of freshwater fish.

[0003] Mandarin fish with upturned beak ( Siniperca chuatsi ) belongs to the order Perciformes ( Perciformes Mandarin fish subfamily ( Sinipercinae ), Mandarin fish ( Siniperca The mandarin fish (Ctenopharynx gracilistylus) is highly prized by consumers for its delicious and nutritious flesh, making it a valuable freshwater aquaculture species. Currently, most freshwater fish are intolerant of salinity, resulting in a significant amount of brackish water resources in my country being unsuitable for aquaculture. Existing research indicates that the mandarin fish can not only survive in low-salinity conditions but also thrives at a salinity of 6 ppt. Therefore, the breeding of salt-tolerant mandarin fish is of great significance for both mandarin fish aquaculture and the utilization of brackish water resources in my country.

[0004] Molecular markers are specific DNA fragments that reflect certain differences in the genomes of individuals or populations. Single nucleotide polymorphisms (SNPs) refer to the presence of two different bases at a specific nucleotide position in the genome. Due to their abundant distribution, high information content, and ease of acquisition, SNP information has become an important molecular marker. By performing association analysis between SNP sites and salt tolerance traits in mandarin fish, and obtaining molecular markers closely related to salt tolerance for breeding purposes, this study is of great significance for developing new salt-tolerant varieties of mandarin fish and can greatly promote the growth and healthy development of the mandarin fish aquaculture industry. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker for rapid identification of salt tolerance in mandarin fish.

[0006] Another objective of this invention is to provide primers or kits for detecting the SNP molecular markers.

[0007] The present invention also aims to provide a method for rapid identification of the salt tolerance of mandarin fish.

[0008] The final objective of this invention is to provide the application of the above-described primers, kits, and methods in the breeding of mandarin fish with salt tolerance.

[0009] The first objective of the present invention can be achieved by the following technical solution: an SNP molecular marker for rapid identification of salt tolerance in mandarin fish, wherein the SNP molecular marker is located at position 185 of the sequence shown in SEQ ID NO:1 and its mutation type is A / C.

[0010] Specifically, the SNP molecular marker described in this invention is named SNP 23:22911985, which is located on chromosome 23 of the mandarin fish. SNP 23:22911985 is located at position 185 of the sequence shown in SEQ ID NO:1, and its mutation type is A / C.

[0011] By detecting the genotype of the SNP molecular markers, the salt tolerance trait of mandarin fish can be quickly identified, which helps to achieve the breeding of mandarin fish with salt tolerance.

[0012] The second objective of this invention is achieved through the following technical solution:

[0013] A primer for detecting the SNP molecular marker, the primer comprising a forward primer and a reverse primer, the sequences of the forward primer and the reverse primer being shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

[0014] The present invention further provides a kit for detecting the SNP molecular marker, the kit comprising the primers described above.

[0015] The kit also includes other related reagents such as 2X Taq PCR Master Mix.

[0016] The third objective of this invention is achieved through the following technical solution: a method for rapid identification of salt tolerance in mandarin fish, comprising the following steps:

[0017] (1) Extract genomic DNA from individual mandarin fish to be tested;

[0018] (2) The extracted DNA was amplified by PCR using the primers to obtain the amplification product;

[0019] (3) Sequencing analysis of the amplification products to determine the genotype of the SNP molecular marker, and then analysis to determine whether the tested mandarin fish individuals have the potential for excellent salt tolerance traits.

[0020] Specifically, in step (3), the “C” allele is the preferred gene, and individuals with the CC and AC genotypes containing this allele have significantly better salt tolerance than individuals with the AA genotype.

[0021] That is, when the genotype of the SNP molecular marker of the mandarin fish to be tested is detected to be CC or AC, it can be determined that the mandarin fish has the potential for excellent salt tolerance.

[0022] The last objective of this invention can be achieved through the following technical solution:

[0023] Application of the above primers, the above kits, and the above methods in the selection of mandarin fish with salt tolerance.

[0024] The present invention has the following advantages:

[0025] (1) This invention analyzes the salt tolerance trait of mixed families of mandarin fish through genome-wide association analysis, screens a candidate SNP locus associated with salt tolerance trait, namely SNP 23:22911985, and further verifies that this SNP locus is associated with salt tolerance trait by Sanger sequencing technology; by detecting the genotype of the SNP molecular marker, mandarin fish with salt tolerance advantage are screened to realize its production and breeding in brackish water environment.

[0026] (2) The SNP markers in this invention can be accurately determined by primers, and have the characteristics of simple operation and reliable results;

[0027] (3) The SNP molecular markers, primers and kits provided by the present invention have important application value in the breeding of salt-tolerant new varieties of mandarin fish. The SNP molecular markers are not affected by individual age, sex and other factors, and can be used to screen mandarin fish in the early stage, thereby significantly shortening the development cycle of salt-tolerant new varieties. Attached Figure Description

[0028] The present invention will now be further described with reference to the accompanying drawings and embodiments.

[0029] Figure 1 The image shows the SNP Manhattan plot obtained from the genome-wide association analysis (GWAS) in Example 1. The black arrows represent the SNP molecular markers in this invention.

[0030] Figure 2 The p-value of the genomic SNP for salt tolerance in mandarin fish in Example 1 is shown in the QQ diagram of the generalized linear model.

[0031] Figure 3 This is the verification result of Sanger sequencing of SNP 23:22911985 in Example 2. Note: Tolerance represents an extremely salt-tolerant population, Intolerance represents an extremely salt-intolerant population, the vertical axis Individual Number refers to the number of individuals, and the horizontal axis Sanger sequencing refers to Sanger sequencing. Detailed Implementation

[0032] The technical solution of the present invention will be described in detail below with reference to specific embodiments, so that those skilled in the art can better understand and implement the technical solution of the present invention. The following embodiments and drawings are for illustrative purposes only and should not be construed as limiting the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0033] Example 1: Screening of SNP molecular markers related to salt tolerance in mandarin fish

[0034] In this embodiment, approximately 1,000 individuals of mandarin fish were randomly selected to undergo acute salinity stress, and the coma time of the experimental fish under high salinity stress was recorded. The coma time was defined as the total time (s) from the start of the experiment to the loss of consciousness and coma of the experimental fish under acute high salinity stress.

[0035] The experimental method was as follows: by filling a cement pool (15 × 15 × 2m) with water... 3 Add sea salt to the culture medium and mix evenly in the water to gradually increase the salinity of the culture water. Increase the salinity in the cement tank at a uniform rate of 2‰ every 15 minutes, and monitor the salinity in real time using a salinity meter. When the salinity of the culture water reaches 25‰, stop adding sea salt and observe the swimming status of the mandarin fish. If a mandarin fish loses consciousness and becomes comatose, immediately remove it, record the coma time, and cut off its tail fin and place it in a 1.5mL centrifuge tube. After sampling, transfer the mandarin fish to a freshwater tank. Record the coma time for each mandarin fish used in the experiment.

[0036] The duration of coma in mandarin fish was used to represent their salt tolerance. Individuals who first experienced stress-induced coma were classified as extremely salt-intolerant, exhibiting poor salt tolerance; those who experienced stress-induced coma last were classified as extremely salt-tolerant, exhibiting strong salt tolerance. A total of 277 individuals were selected as experimental materials for genome-wide association analysis of salt tolerance in mandarin fish, including 138 extremely salt-tolerant individuals and 139 extremely salt-intolerant individuals.

[0037] The experimental procedure for genome-wide association analysis of salt tolerance in mandarin fish is as follows:

[0038] DNA was extracted from mandarin fish using the HiPure Tissue DNA Mini Kit, and the library was constructed and sequenced using ddRAD-seq. The sequence data were aligned with the mandarin fish reference genome (NCBIAssembly: GCA_011952085.1) using Bowtie (v2.0) software, achieving an alignment rate of 93.00%. Low-quality sequencing sites were filtered using BCFtools to generate VCF format files, identifying a total of 4,241,496 SNPs. To ensure the reliability of subsequent genome-wide association analysis (GWAS) results, PLINK was used for quality control of the VCF format files, resulting in 59,285 SNPs. Based on the quality-controlled VCF files, TASSEL 5.0 was used to perform GWAS on the tested individuals. Kinship was calculated using TASSEL 5.0, and principal component analysis (PCA) was performed on the tested population. The genomic inflation factor (λ) of the experimental population was calculated to estimate the population stratification of the individuals under test. Next, a generalized linear model (GLM) was used in conjunction with phenotypic data, PCA, and genotypic data for analysis. The Bonferroni method was used to select the significance threshold. Finally, data visualization was performed using R Studio, and the Manhattan plot and QQ plot were drawn using the R package "CMplot".

[0039] Based on the genome-wide association analysis (GWAS) described above, highly significant SNPs were obtained. Further screening revealed an SNP located at locus 22911985 on chromosome 23, denoted as SNP 23:22911985.

[0040] A Manhattan plot is a visualization chart that uses chromosome location as the horizontal axis and statistical significance as the vertical axis. It visually displays the gene regions associated with the target phenotype in a GWAS analysis. By observing... Figure 1 The peaks on the Manhattan plot can quickly identify the distribution of significant SNPs (single nucleotide polymorphisms, indicated by black arrows) located at position 22911985 on chromosome 23, which may reflect genetic variations associated with specific diseases or phenotypes.

[0041] SNP 23:22911985 is located at position 185 of the sequence shown in SEQ ID NO:1, and its mutation type is A / C. The specific sequence containing this SNP molecular marker is as follows:

[0042] TGAAAAACTAGATTGGTATGACGGACAACAGGCTTTAATTTGGATTTTCTTTCAATACTTCGTCTCCAGATAACAGATTCCATTCTCCATTCTGAGATTCAACCGATGCGGTAAACTGATTTTTCACCACTATAATACCTGAGAAGCTGTGATTTCTACCGAGAAGCTCTTTGAAACAAACATT A / C The SNP molecular marker is shown in italics and underline.

[0043] Figure 2 The generalized linear model (GLM) plot of the p-values ​​for the salt tolerance trait SNPs in the genomic genome of mandarin fish (Gardenia spp.) yields a genome inflation factor (λ) of 1.019, indicating that the results of this study have few false positives and are reliable. A detailed explanation follows: In this embodiment, a generalized linear model (GLM) was used to perform a genome-wide association analysis (GWAS) on the salt tolerance trait and genotype data of mandarin fish. The genome inflation factor is a commonly used statistical indicator in genome-wide association studies (GWAS) to assess whether there is excessive inflation of false positive association signals compared to expectations. The genome inflation factor is usually represented by the λ value. The λ value is the ratio between the median of the observed p-value distribution and the expected median. If the λ value equals 1, it indicates that there is no excessive inflation of false positive signals in the GWAS results. If the λ value is greater than 1, it indicates the presence of excessively inflated false positive signals. Generally, the larger the λ value, the greater the influence of false positive signals in the GWAS results. This study combined the Kinship+Q5 model with genome-wide association analysis of salt tolerance in mandarin fish to calculate the optimal λ value. The results showed that the genomic expansion factor (λ) for salt tolerance in mandarin fish was 1.019. These results indicate that the study had few false positives, was reliable, and has significant research value.

[0044] In this embodiment, primers for the SNP molecular marker were designed using the software Primer 5. These primers include a forward primer and a reverse primer, the sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. These primers can specifically amplify the target fragment.

[0045] Specifically:

[0046] The sequence of the forward primer is shown in SEQ ID NO:2, and is as follows:

[0047] 5'- GGTATGACGGACAACAGG -3';

[0048] The sequence of the reverse primer is shown in SEQ ID NO:3, and is as follows:

[0049] 5'- CTCGGAAGCAATGACAGC -3'.

[0050] Example 2: SNP molecular marker verification

[0051] Experimental materials: 1000 mandarin fish were randomly selected, and 96 individuals with extreme phenotypes were selected from them (48 individuals were extremely salt-tolerant and 48 individuals were extremely salt-intolerant). DNA was extracted from the 96 individuals using conventional methods to verify the effectiveness of the SNP markers.

[0052] The extracted DNA was amplified by PCR using the primers obtained in Example 1. Specifically, PCR amplification was performed in a 20 μL reaction system, which included 10 μL of 2X PCR Master Mix, 3 μL of 10 ng / μL genomic DNA, 5 μL of PCR-grade water, and 1 μL of forward and reverse primers. The PCR amplification reaction was performed using the following thermal cycling program: one cycle at 95°C for 3 min, followed by 36 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 30 s, and then a final extension at 72°C for 10 min. The PCR products were detected by 1.5% agarose gel electrophoresis, and qualified samples were used for subsequent sequencing.

[0053] The PCR amplification products were then sequenced using an ABI 3730XL sequencer; the genotypes of the SNPs in the 96 individuals were determined using the Snapgene software.

[0054] The results are as follows Figure 3 As shown, two alleles (A / C) and three genotypes (AA / AC / CC) were observed at this SNP locus. The results showed that the "C" allele was the dominant allele, while the "A" allele was the inferior allele. Individuals with the CC and AC genotypes had better salt tolerance. Figure 3 In the study, Sanger sequencing data of SNP genotyping showed that SNP 23:22911985 was significantly associated with salt tolerance (P = 0.019; Chi-square test). Within SNP 23:22911985, individuals with the CC or AC genotypes exhibited better salt tolerance. Individuals containing a C base at position 22911985 on chromosome 23 of the mandarin fish were likely to have even better salt tolerance; that is, mandarin fish individuals with the CC or AC genotypes were more tolerant of salinity, with the CC genotype showing the best salinity tolerance.

[0055] Therefore, correlation analysis between genotype and salt tolerance shows that individuals with the CC or AC genotype have significantly better salt tolerance than those with the AA genotype. The SNP molecular markers in this invention are significantly correlated with salt tolerance; by screening individuals with the CC or AC genotype, the desired salt-tolerant mandarin fish can be selected.

[0056] Example 3

[0057] The method for rapid identification of salt tolerance in mandarin fish provided in this embodiment includes the following steps:

[0058] (1) Extract genomic DNA from the fin rays of the individual mandarin fish to be tested;

[0059] (2) The extracted DNA was amplified by PCR using the primers obtained in Example 1 to obtain the amplification product;

[0060] (3) Sequencing analysis of the amplification products to determine the genotype of the SNP molecular marker SNP 23:22911985, and then analysis to determine whether the tested mandarin fish individuals have the potential for excellent salt tolerance traits.

[0061] When performing PCR amplification in step (2), the PCR amplification reaction system is as follows: based on a total reaction volume of 20 μL, it includes 10 μL of 2X Taq PCR Master Mix, 3 μL of genomic DNA, 1 μL each of forward and reverse primers, and 5 μL of PCR-grade water; the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 36 cycles, and finally 72℃ extension for 10 min, and stored at 4℃.

[0062] The "C" allele in the SNP molecular marker is the preferred gene, and individuals with the CC and AC genotypes containing this allele have significantly better salt tolerance than individuals with the AA genotype. That is, in step (3), the PCR amplification product is sequenced, and based on the sequencing results, it is determined whether the genotype of the SNP 23:22911985 of the mandarin fish to be tested is CC or AC, thereby determining whether it has the potential for excellent salt tolerance.

[0063] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. A SNP molecular marker for rapid identification of salt tolerance in mandarin fish, characterized in that, Located at position 185 of the sequence shown in SEQ ID NO:1, its mutation type is A / C.

2. A primer for detecting the SNP molecular marker of claim 1, characterized in that, It includes a forward primer and a reverse primer, the sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

3. A kit for detecting the SNP molecular marker of claim 1, characterized in that, Includes the primers described in claim 2.

4. A method for rapid identification of salt tolerance in mandarin fish, characterized in that, Includes the following steps: (1) Extract genomic DNA from individual mandarin fish to be tested; (2) The extracted DNA was amplified by PCR using the primers described in claim 2 to obtain the amplification product; (3) Sequencing analysis of the amplification products to determine the genotype of the SNP molecular marker described in claim 1, and then analyzing to determine whether the tested mandarin fish individual has the potential for excellent salt tolerance; specifically, when the genotype of the SNP molecular marker is detected to be CC or AC, it is determined that the mandarin fish has the potential for excellent salt tolerance.

5. The application of the primers of claim 2, the kit of claim 3, and the method of claim 4 in the selection of mandarin fish with salt tolerance.

Images