Use of molecular markers associated with average daily feeding time traits in finishing swine

Abstract

The application discloses application of a molecular marker related to a pig fattening period average daily feeding time trait, relates to the technical field of biology, and is characterized in that the application is any one of A1) to A4) below: A1) detecting or assisting in detecting a pig fattening period average daily feeding time; A2) identifying, assisting in identifying a pig fattening period average daily feeding time; A3) preparing a product for detecting or assisting in detecting a pig fattening period average daily feeding time; and A4) preparing a product for identifying, assisting in identifying a pig fattening period average daily feeding time. The application of the molecular marker related to the pig fattening period average daily feeding time trait discovers that a site of A / C at 270462812 of a chromosome 1 in a pig reference genome Sus_scrofa.Sscrofa11.1 has a significant influence on the pig fattening period average daily feeding time.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of molecular markers related to the trait of average daily feed intake time during the fattening period of pigs. Background Technology

[0002] In the pig farming industry, feed costs account for more than 60%, and feed conversion ratio (FCR) is the core indicator that determines farming profits. Studies have shown that the average daily feeding time (TFD) during the fattening period of pigs is positively correlated with feed conversion ratio. That is, the shorter the average daily feeding time, the higher the feed conversion ratio. Incorporating this feeding behavior characteristic into the breeding selection index can increase the selection response of feed conversion ratio by 4% (Reference: Kavlak AT, Strandén I, Lidauer MH, Uimari P.Estimation of social genetic effects on feeding behaviour and productiontraits in pigs. Animal. 2021 Mar;15 (3):100168. doi: 10.1016 / j.animal.2020.100168.).

[0003] Currently, the determination of average daily feed intake time relies on dedicated automated measurement equipment, which is expensive and spans a long period, leading to a significant increase in breeding costs and making practical operation difficult. With the development of molecular biotechnology and porcine genome association analysis technology, it has become possible to discover molecular markers related to average daily feed intake time and achieve precise and efficient breeding. However, to date, there are no reports on molecular markers related to average daily feed intake time during the fattening period of pigs. Therefore, it is necessary to develop specific molecular markers to meet the needs of breeding practice. Summary of the Invention

[0004] The purpose of this invention is to provide the application of molecular markers related to the average daily feed intake trait during the fattening period of pigs, in order to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: the application of molecular markers related to the average daily feed intake time trait during the fattening period of pigs, wherein the application is any one of A1 to A4 below:

[0006] A1. To detect or assist in detecting the average daily feeding time of pigs during the fattening period;

[0007] A2. Identification and auxiliary identification of the average daily feeding time of pigs during the fattening period;

[0008] A3. Prepare products for detecting or assisting in the detection of average daily feeding time during the fattening period of pigs;

[0009] A4. Products for the preparation, identification, and auxiliary identification of average daily feeding time during the fattening period of pigs;

[0010] The molecular marker corresponds to the SNP site at position 270462812 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1. This site corresponds to the nucleotide at position 119 bp in the sequence SEQ ID NO:1, and the nucleotide type is A or C.

[0011] Furthermore, a method for identifying or assisting in the identification of the average daily feeding time of pigs during the fattening period is characterized by comprising the following steps:

[0012] S1) Extract genomic DNA from the pig to be tested as a template;

[0013] S2) Design specific primers for the 119bp site of the DNA molecule shown in SEQ ID NO:1 and perform PCR amplification;

[0014] S3) Detect the genotype at the 119bp site of the pig sequence SEQ ID NO:1;

[0015] S4) Based on the genotype identification or auxiliary identification obtained in step S3, the average daily feeding time of the pigs during the fattening period is as follows: the average daily feeding time of individuals with the AA genotype is greater than that of individuals with the AC genotype, and the average daily feeding time of individuals with the AC genotype is greater than that of individuals with the CC genotype.

[0016] Furthermore, the sequences of the specific primers in step S2 are SEQ ID NO:2 and SEQ ID NO:3, wherein SEQ ID NO:2 is 5'-GCTCTTGTGTCTAAATGGAAACC-3' and SEQ ID NO:3 is 5'-GGCTTGTTGTCTGGATGATGA-3'.

[0017] Furthermore, a breeding method for selecting pigs with a short average daily feeding time during the fattening period was adopted. The genotype of the pigs to be tested was identified according to the method described above, and the pigs to be tested with the C homozygous genotype at position 119bp of SEQ ID NO:1 were selected as parents for breeding.

[0018] Furthermore, the product is a reagent kit.

[0019] This invention provides the application of molecular markers related to the trait of average daily feed intake time during the fattening period of pigs, with the following beneficial effects: This invention discovers the A / C locus at position 270462812 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, which has a significant impact on the average daily feed intake time during the fattening period of pigs; based on this SNP locus, a method is provided to identify or assist in identifying the average daily feed intake time during the fattening period of pigs; it provides a new molecular breeding marker for marker-assisted breeding of the trait of average daily feed intake time during the fattening period of pigs, which is beneficial to improving breeding efficiency, effectively shortening the breeding cycle, and is of great significance for selecting superior pig breeds;

[0020] The A270462812C gene sequencing method requires only a PCR reaction; sequencing alone can determine the genotype of an individual. Genotyping is highly accurate and inexpensive, making it valuable for breeding practice. Using this invention to select pigs for the average daily feeding time trait reduces the average daily feeding time of CC genotype pigs by approximately 8.2 minutes compared to AA genotype pigs. Applying this method to pig breeding allows for early screening of potential pigs, effectively alleviating the problem of long selection times for superior breeding stock in actual production, reducing breeding costs, and effectively improving pig feeding behavior in actual production. The detection method of this invention is simple to operate, inexpensive, highly accurate, and can be automated for direct detection. This invention will play a significant role in pig breeding. Attached Figure Description

[0021] Figure 1 This is the Manhattan plot of the genome-wide association analysis in Embodiment 1 of the present invention.

[0022] Figure 2 This is a QQ diagram representing the data structure of the genome-wide association analysis in Embodiment 1 of the present invention. Detailed Implementation

[0023] The embodiments of the present invention will be described in further detail below with reference to examples. These examples are for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0024] This application provides the application of molecular markers related to the trait of average daily feed intake time during the fattening period of pigs. The invention is further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the invention and are not intended to limit the scope of the invention. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0026] The following examples used SAS 9.0 statistical software to process the data. Experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 was observed. This indicates a significant difference.

[0027] All animals in the following examples were sourced from Henan Yifa Animal Husbandry Co., Ltd.

[0028] The average daily feeding time of pigs during the fattening period in the following examples refers to the average daily feeding time during the fattening stage.

[0029] Example 1: Determination of SNP sites on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1

[0030] The inventors previously conducted whole-genome sequencing on 560 pigs and a genome-wide association study (GWAS) of the average daily feed intake trait during the fattening period. The model used was: Y = μ + G + B + P + e, where Y is the trait value; μ is the population mean; G is the genotype effect; B is the batch effect; and P is the farm-year-season effect. The results identified 20 SNP loci significantly associated with the average daily feed intake during the fattening period, such as... Figure 1 and Figure 2 As shown, the inventors designed primers for amplification within a 200bp range upstream and downstream of the five most prominent sites, and found that only the sequence containing one site on stain 1 could be amplified well.

[0031] After amplification, alignment was performed using Seqman software, revealing a differentially expressed site (SNP) named A270462812C. This site is located at nucleotide 270462812 on chromosome 1 of the porcine reference genome Sus_scrofa.Sscrofa11.1, which is nucleotide 119 of sequence SEQ ID NO:1. The nucleotide type of A270462812C is either A or C, and the genotype is AA, CC, or AC. The AA genotype at A270462812C is homozygous for A. The CC genotype at A270462812C is homozygous for C. The AC genotype at A270462812C is heterozygous for both A and C.

[0032] Example 2: Correlation analysis of the A270462812C locus on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 with the average daily feed intake time during the fattening period of pigs.

[0033] To determine whether the A270462812C locus on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 is related to the average daily feed intake time during the fattening period of pigs, 1012 Large White pigs were used as experimental materials. The genotype of the SNP locus in Example 1 and the average daily feed intake time during the fattening period of each individual were measured, and correlation analysis was performed.

[0034] I. Genotype Identification

[0035] 1. PCR amplification

[0036] Based on the SNP information on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, a pair of primers was designed as follows:

[0037] Upstream primer F: 5'-GCTCTTGTGTCTAAATGGAAACC-3' (SEQ ID NO:2);

[0038] Downstream primer R: 5'- GGCTTGTTGTCTGGATGATGA-3' (SEQ ID NO:3).

[0039] Using the genomic DNA of each Large White pig as a template, PCR amplification was performed using the above-mentioned materials to obtain PCR products.

[0040] 2. Cloning, sequencing, and sequence analysis

[0041] The PCR products of each individual were purified using an agarose gel extraction kit (Tiangen Biotech Co., Ltd.). The recovered DNA fragments were ligated into the pGEM-T vector (Promega), and the ligation product was transformed into E. coli DH5α competent cells (Mingri Biotech (Beijing) Co., Ltd.). Positive clones were screened based on the carbenicillin resistance marker on the vector to obtain recombinant plasmids containing the recovered fragments. The nucleotide sequence of this recombinant plasmid vector was determined using the T7 and SP6 promoter sequences as primers (Invitrogen (Shanghai) Trading Co., Ltd.).

[0042] The genotypes of the pigs to be tested are as follows:

[0043] AA genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains only a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide A at position 119 of SEQ ID NO:1, and does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide C at position 119 of SEQ ID NO:1, then the genotype of chromosome A270462812C in the aforementioned pig reference genome Sus_scrofa.Sscrofa11.1 of the pig to be tested is AA.

[0044] CC genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide C at position 119 of SEQ ID NO:1, and only contains a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide A at position 119 of SEQ ID NO:1, then the genotype of the A270462812C position on chromosome 1 of the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is CC.

[0045] AC genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains both a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide 119 of SEQ ID NO:1 being A, and a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and nucleotide 119 of SEQ ID NO:1 being A, then the genotype of the A270462812C position on chromosome 1 of the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is AC.

[0046] The results are shown in Table 1. Genotyping of the A270462812C locus in 1024 Large White pigs showed that 232 pigs had the AA genotype, 324 had the CC genotype, and 456 had the AC genotype. The genotype and allele frequencies of the A270462812C locus in the pig population are shown in Table 1. As can be seen from Table 1, this locus has a high heterozygosity and great potential for breeding.

[0047] Table 1. Genotype and allele frequencies of locus A270462812C in the tested pig population.

[0048]

[0049] II. Correlation Analysis between Pig Genotype and Average Daily Feeding Time During Pig Fattening Period

[0050] The average daily feed intake time during the fattening stage of pigs was measured using the Osborn automated measurement device. SAS software was used for genotype-phenotype association analysis, and Duncan's multiple test was used for significance testing (P<0.05). Data are expressed as mean ± standard error, and P<0.05 was considered statistically significant.

[0051] The results are shown in Table 2. The SNP (A270462812C) locus significantly affected the average daily feed intake time during the fattening period of pigs. Pigs with the AA genotype had a longer average daily feed intake time during the fattening period than those with the AC genotype, and pigs with the AC genotype had a longer average daily feed intake time during the fattening period than those with the CC genotype. Furthermore, the average daily feed intake time during the fattening period of pigs with the AA genotype was significantly longer than that of pigs with the CC genotype (P<0.05). In actual pig breeding, the SNP (A270462812C) locus genotyping results can be used as an auxiliary selection method for the average daily feed intake time during the fattening period.

[0052] Table 2. Association analysis between single nucleotide polymorphisms on chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) and average daily feed intake during the fattening period.

[0053]

[0054] Note: Different lowercase letters in the table indicate significant differences (P<0.05), and the same letter indicates no significant differences (P>0.05). Values ​​are expressed as mean ± standard error.

[0055] In summary, determining the genotype of the A270462812C locus on chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) can help identify the average daily feed intake during the fattening period of pigs: pigs with the AA genotype have a longer average daily feed intake during the fattening period than pigs with the CC genotype, and pigs with the AC genotype have a longer average daily feed intake during the fattening period than pigs with the CC genotype. In practical breeding work, pigs with the CC genotype at the SNP (A270462812C) locus can be selected as parents for breeding.

[0056] SEQ ID NO:1

[0057] 5'- GCTCTTGTGTCTAAATGGAAACCTGTTTCCACCTACTTGTCTGGCCAGGATGAAATTAAATATCCCAGCCTTGTAAAAATCATTCCAGAAAATAAAATCAGGAAAAGTACTGTTCAGCWTCGTGGGGAGAAGCCCA CCTGTGGAATAATCCCCCCACCACAACCAGTCCTAACAACTGTGGAAGTTCTGGGAGGCCTCTGGTTCCCGAGGGGGAAAAATCCCACACAGACCTCACGGGCTGTGCTGTGAGCTCATCATCCAGACAACAAGCC -3'.

[0058] The W is either A or C.

[0059] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

[0060] The embodiments of the present invention are given for illustrative and descriptive purposes only, and are not intended to be exhaustive or to limit the invention to the forms disclosed. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described in order to better illustrate the principles and practical application of the invention, and to enable those skilled in the art to understand the invention and to design various embodiments with various modifications suitable for a particular purpose.

Claims

1. The application of molecular markers related to the trait of average daily feed intake time during the fattening period of pigs, characterized in that, The application is any one of the following A1 to A4: A1. To detect or assist in detecting the average daily feeding time of pigs during the fattening period; A2. Identification and auxiliary identification of the average daily feeding time of pigs during the fattening period; A3. Prepare products for detecting or assisting in the detection of average daily feeding time during the fattening period of pigs; A4. Products for the preparation, identification, and auxiliary identification of average daily feeding time during the fattening period of pigs; The molecular marker corresponds to the SNP site at position 270462812 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.

1. This site corresponds to the nucleotide at position 119 bp in the sequence SEQ ID NO:1, and the nucleotide type is A or C.

2. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 1, characterized in that, Methods for identifying or assisting in the identification of the average daily feeding time of pigs during the fattening period include the following steps: S1) Extract genomic DNA from the pig to be tested as a template; S2) Design specific primers for the 119bp site of the DNA molecule shown in SEQ ID NO:1 and perform PCR amplification; S3) Detect the genotype at the 119bp site of the pig sequence SEQ ID NO:1; S4) Based on the genotype identification or auxiliary identification obtained in step S3, the average daily feeding time of the pigs during the fattening period is as follows: the average daily feeding time of individuals with the AA genotype is greater than that of individuals with the AC genotype, and the average daily feeding time of individuals with the AC genotype is greater than that of individuals with the CC genotype.

3. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 2, characterized in that, The specific primers in step S2 have sequences of SEQ ID NO:2 and SEQ ID NO:3, where SEQ ID NO:2 is 5'-GCTCTTGTGTCTAAATGGAAACC-3' and SEQ ID NO:3 is 5'-GGCTTGTTGTCTGGATGATGA-3'.

4. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 3, characterized in that, A breeding method for selecting pigs with a short average daily feeding time during the fattening period, wherein the genotype of the pig to be tested is identified according to the method described in claim 3, and the pig to be tested with the C homozygous genotype at position 119bp of SEQ ID NO:1 is selected as the parent for breeding.

5. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 4, characterized in that, The product in question is a reagent kit.

Images