Primer probe combination for detecting Klebsiella aerogenes, Klebsiella oxytoca complex and proteus mirabilis as well as application and kit of primer probe combination

Abstract

The invention provides a primer probe combination for detecting Klebsiella aerogenes, a Klebsiella oxytoca complex and proteus mirabilis as well as application and a kit of the primer probe combination, and relates to the technical field of biology. Primer probes are respectively designed aiming at a conserved gene (chbr gene) of klebsiella aerogenes, a conserved gene (fusC gene) of a klebsiella oxytoca complex and a conserved gene (gntr gene) of proteus mirabilis. The designed primer probe has strong specificity and high sensitivity, can accurately detect the Klebsiella aerogenes, the Klebsiella oxytoca complex and the proteus mirabilis in the same amplification system, improves the detection efficiency, and provides reference for auxiliary diagnosis of related bacterial infection.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a primer-probe combination for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis, as well as their applications and kits. Background Technology

[0002] Klebsiella pneumoniae ( Klebsiella aerogens *Bacillus subtilis* (Ka), belonging to the Enterobacteriaceae family, is a facultative Gram-negative anaerobic bacterium and a significant pathogen causing nosocomial infections, especially in mechanically ventilated patients. This bacterium can be transmitted via aerosols and colonize the respiratory tract of patients with chronic lung disease, leading to acute exacerbations of structural lung disease (such as bronchiectasis complicated by infection).

[0003] Klebsiella acidogenic complex ( Klebsiella oxytoca complex Klebsiella pneumoniae (KoC) is a genus and species of Enterobacteriaceae, belonging to the family Enterobacteriaceae. It is a Gram-negative bacterium and includes Klebsiella acidogenic bacteria. Klebsiella oxytoca Ko), Klebsiella Michigani ( Klebsiella michiganensis ) 、 Klebsiella pneumoniae ( Klebsiella grimontii ) 、 Pasteurella multocida ( Klebsiella pasteurii This bacterium, along with several other species, is found in humus-rich soils, freshwater, and medical environments. Its secreted cytotoxins induce apoptosis of colonic crypt cells by inhibiting microtubule polymerization, leading to antibiotic-associated hemorrhagic colitis. It can also colonize the respiratory epithelium through aspiration (especially in alcoholic or diabetic patients), causing aspiration pneumonia.

[0004] Proteus mirabilis ( Proteus mirabilis *Proteus mirabilis* (Pm) is a species of *Proteus* in the family Enterobacteriaceae, and is a Gram-negative bacterium. This bacterium produces ammonia by breaking down urea with urease, which forms struvite-like biofilms in the urinary system, causing urinary tract infections. Simultaneously, this bacterium can colonize the respiratory tract through aspiration or aerosol, leading to pneumonia in immunocompromised patients.

[0005] Klebsiella pneumoniae, Klebsiella pneumoniae complex, and Proteus mirabilis all belong to the Enterobacteriaceae family and are opportunistic pathogens that can colonize the respiratory tract. They are important pathogens causing nosocomial infections, especially in mechanically ventilated patients in intensive care units, where they are prone to causing ventilator-associated pneumonia. All three are key bacteria under surveillance for drug resistance, but their resistance mechanisms differ. Klebsiella pneumoniae complex and Klebsiella pneumoniae primarily produce ESBLs or carbapenemases, so third-generation cephalosporins should be avoided. Carbapenems (such as meropenem) or enzyme inhibitor combination preparations (such as cefoperazone / sulbactam) are recommended. Proteus mirabilis is highly sensitive to piperacillin / tazobactam. Therefore, detection of these three bacteria can rapidly differentiate drug resistance phenotypes and guide precise medication.

[0006] Currently, the most common method for bacterial detection in clinical practice is isolation and culture. However, this method is time-consuming, cumbersome, and has low sensitivity, which cannot meet the needs of rapid clinical diagnosis. Furthermore, Proteus mirabilis, due to its peritrichous flagella, exhibits a unique biological behavior of migrating and growing on the culture medium, which can easily contaminate the experimental environment and further increases the difficulty of operation for medical staff.

[0007] In view of this, the present invention is hereby proposed. Summary of the Invention

[0008] The first objective of this invention is to provide a primer probe for detecting Klebsiella acidogenic complexes, thereby solving at least one of the aforementioned technical problems.

[0009] A second objective of this invention is to provide the application of the above-mentioned primers and probes in the preparation of products for detecting Klebsiella acidogenic complexes.

[0010] A third objective of this invention is to provide a primer-probe combination to solve the aforementioned technical problems.

[0011] The fourth objective of this invention is to provide the application of the above-mentioned primer-probe combination in the preparation of products for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis.

[0012] The fifth objective of this invention is to provide a kit for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis.

[0013] The sixth objective of this invention is to provide a method for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis for purposes other than disease diagnosis and treatment.

[0014] To achieve the above objectives, the following technical solution is adopted: In a first aspect, the present invention provides a primer and probe for detecting Klebsiella acidogenic complex, wherein the primer for detecting Klebsiella acidogenic complex has nucleotide sequences as shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe for detecting Klebsiella acidogenic complex has nucleotide sequences as shown in SEQ ID NO.6.

[0015] As a further technical solution, the Klebsiella acidogenic complex includes at least one of Klebsiella acidogenic, Klebsiella micrantha, Klebsiella gravidii, and Klebsiella pastoris.

[0016] Secondly, the present invention provides the application of the above-mentioned primers and probes in the preparation of products for detecting Klebsiella acidogenic complexes.

[0017] Thirdly, the present invention provides a primer-probe combination comprising primers and probes for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis; The primers used to detect Klebsiella pneumoniae have nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe used to detect Klebsiella pneumoniae has nucleotide sequences as shown in SEQ ID NO.3; The primers used to detect the Klebsiella acidogenic complex have nucleotide sequences as shown in SEQ ID NO.4 and SEQ ID NO.5, and the probes used to detect the Klebsiella acidogenic complex have nucleotide sequences as shown in SEQ ID NO.6; The primers used to detect Proteus mirabilis have nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, and the probes used to detect Proteus mirabilis have nucleotide sequences as shown in SEQ ID NO.9.

[0018] As a further technical solution, primers and probes for detecting internal standard genes are also included; The primers used to detect the internal standard gene have nucleotide sequences as shown in SEQ ID NO.10 and SEQ ID NO.11, and the probes used to detect the internal standard gene have nucleotide sequences as shown in SEQ ID NO.12.

[0019] As a further technical solution, the probe is provided with a fluorescent reporter group and a fluorescent quencher group at its two ends, respectively. The fluorescent reporter group includes FAM, ROX, CY5, or HEX; The fluorescence quenching group includes TAMRA, BHQ1, or BHQ2; Preferably, the fluorescent reporter groups of each probe are different.

[0020] Fourthly, the present invention provides the application of the above-mentioned primer-probe combination in the preparation of products for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis.

[0021] Fifthly, the present invention provides a kit for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis, comprising the aforementioned primer-probe combination.

[0022] As a further technical solution, the kit also includes a PCR premix; The PCR premix includes 40-120 mM Tricine, 50-150 mM potassium acetate, 1-3 U rTth enzyme, 0.16-0.48 mM dNTPs, and 2-6 mM MgCl2, with water as the solvent. Preferably, the kit further includes negative control and positive control; The negative control was physiological saline. The positive control is a plasmid containing the target sequence of Klebsiella pneumoniae, Klebsiella acidogenetic complex, or Proteus mirabilis.

[0023] In a sixth aspect, the present invention provides a method for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis for purposes other than disease diagnosis and treatment, comprising the following steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the primer and probe combination or the kit described above. The Ct value of the amplification is used to determine whether the sample to be tested contains Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis.

[0024] Compared with the prior art, the present invention has the following beneficial effects: This invention designs primers and probes targeting conserved genes (chbr gene) of *Klebsiella pneumoniae*, *Klebsiella acidogenic complex* (fusC gene), and *Proteus mirabilis* (gntr gene). The designed primers and probes exhibit high specificity and sensitivity, enabling the detection of multiple *Klebsiella acidogenic* cells. A single target can actually detect the *Klebsiella acidogenic complex*. Furthermore, it allows for accurate detection of *Klebsiella pneumoniae*, *Klebsiella acidogenic complex*, and *Proteus mirabilis* within the same amplification system, improving detection efficiency and providing a reference for the auxiliary diagnosis of related bacterial infections. Attached Figure Description

[0025] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0026] Figure 1 The result was a positive sample test result; Figure 2 For sensitivity verification; Figure 3 For precision verification; Figure 4 For sensitivity comparison. Detailed Implementation

[0027] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0028] In a first aspect, the present invention provides a primer probe for detecting Klebsiella acidogenic complexes, wherein the primers for detecting Klebsiella acidogenic complexes have nucleotide sequences as shown in SEQ ID NO.4 and SEQ ID NO.5: CTGGCGGTTCCAGCAG (SEQ ID NO.4); GCCCAGTCGCCGTCTG (SEQ ID NO. 5).

[0029] The probe used to detect the Klebsiella acidogenic complex has the nucleotide sequence shown in SEQ ID NO. 6: ATCGTCGGTATATTGTGCGGCGGG (SEQ ID NO. 6).

[0030] Secondly, the present invention provides the application of the above-mentioned primers and probes in the preparation of products for detecting Klebsiella acidogenic complexes.

[0031] This invention designs primers and probes targeting the conserved gene (fusC gene) of the Klebsiella acidogenic complex. The designed primers and probes are highly specific and sensitive, enabling accurate detection of the Klebsiella acidogenic complex (at least one of Klebsiella acidogenic, Klebsiella micrantha, Klebsiella grescoliosis, and Klebsiella pastoris), improving detection efficiency and providing a reference for the auxiliary diagnosis of related bacterial infections.

[0032] Thirdly, the present invention provides a primer-probe combination comprising primers and probes for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis; The Klebsiella acidogenic complex includes Klebsiella acidogenic and Klebsiella micranthae. 、 At least one of Klebsiella glaucoma and Klebsiella pastoris; The primers used to detect Klebsiella pneumoniae have the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2: AAGCAATAACCGACTCGATATAGC(SEQ ID NO.1); GGTGCGACGCGCATTCTTAACG (SEQ ID NO. 2).

[0033] The probe used to detect Klebsiella pneumoniae has the nucleotide sequence shown in SEQ ID NO.3: GCGCTTTGCACCGCATAGACCTGAGAG (SEQ ID NO. 3).

[0034] The primers used to detect the Klebsiella acidogenic complex have the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5: CTGGCGGTTCCAGCAG (SEQ ID NO.4); GCCCAGTCGCCGTCTG (SEQ ID NO. 5).

[0035] The probe used to detect the Klebsiella acidogenic complex has the nucleotide sequence shown in SEQ ID NO. 6: ATCGTCGGTATATTGTGCGGCGGG (SEQ ID NO. 6).

[0036] The primers used to detect Proteus mirabilis have nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.8: ATCCTTTGATTACAACAGGGCTACT (SEQ ID NO.7); AATACGCTGTGGGATCTGTCT (SEQ ID NO. 8).

[0037] The probe used to detect Proteus mirabilis has the nucleotide sequence shown in SEQ ID NO. 9: CGCGATTTAGGTGCTGTTGGTGTCA (SEQ ID NO. 9).

[0038] This invention designs primers and probes targeting conserved genes (chbr gene) of Klebsiella pneumoniae, Klebsiella acidogenic complex (fusC gene), and Proteus mirabilis (gntr gene). The designed primers and probes exhibit high specificity and sensitivity, enabling accurate detection of Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis in the same amplification system, thus improving detection efficiency and providing a reference for the auxiliary diagnosis of related bacterial infections.

[0039] The primer-probe combination described in this invention is applicable not only to fluorescent probe methods but also to digital PCR methods. By changing the components of the PCR reaction solution, digital PCR can be used to detect Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis.

[0040] In this invention, the sequence of the Klebsiella pneumoniae chbr gene fragment is shown in SEQ ID NO.13: AAGCAATAACCGACTCGATATAGCTGAGAAAGGCGCTTTGCACCGCATAGACCTGAGAGGCGACCAGCCCGAACGGCAGCAGCGGCAGATAATGTTTCTCAAAGAAGCGTCTGCTGATGCCAACGTTAAGAATGCGCGTCGCACC (SEQ ID NO. 13).

[0041] The sequence of the amplified fragment of the fusC gene of the Klebsiella acidogenic complex is shown in SEQ ID NO.14: CTGGCGTGTTCCAGCAGGCGGGCATGCATATTTTTTAGCGCGCTCAGTAGCGTGGTGCCGTCGGAGGTACTCGGTAAAATCATCATCATTAGCCCGCCGCACAATATACCGACGATAACCTCGCAGACGCGCGACTGGGC (SEQ ID NO.14).

[0042] The sequence of the amplified fragment of the Proteus mirabilis gene gntr is shown in SEQ ID NO.15: AATACGCTGTGGGATCTGTCTTAACTGTGCAAGACTAATTCCCATAATTCTAAGGTCGATATCAGAAAGCAGAGGATTACCTTGTGCATCATAGAATCGACCACAAATGACACCAACAGCACCTAAATCGCGATATTGTGCCATCTCATTTGTGGTGAGTACGCCTGTTGTAATCAAAGGAT (SEQ ID NO.15).

[0043] In some optional implementations, primers and probes for detecting internal standard genes are also included; The primers used to detect the internal standard gene have the nucleotide sequences shown in SEQ ID NO.10 and SEQ ID NO.11: AGTGCAGCCACACTATCA (SEQ ID NO. 10); AGAATCCAGATGCTCAAGGCC (SEQ ID NO. 11).

[0044] The probe used to detect the internal standard gene has the nucleotide sequence shown in SEQ ID NO.12: TGTGGCTAATGCCCTGGCCCACAAG (SEQ ID NO. 12).

[0045] Improve detection accuracy by designing primers and probes for detecting internal standard genes.

[0046] In some optional embodiments, the probe has a fluorescent reporter group and a fluorescent quencher group attached to its two ends, respectively; The fluorescent reporter group includes, but is not limited to, FAM, ROX, CY5 or HEX, or other fluorescent reporter groups well known to those skilled in the art; The fluorescence quenching group includes TAMRA, BHQ1 or BHQ2, or other fluorescence quenching groups well known to those skilled in the art.

[0047] In some alternative embodiments, the probe has a fluorescent reporter group attached to its 5' end and a fluorescent quencher group attached to its 3' end.

[0048] In some alternative implementations, the fluorescent reporter groups of each probe are different.

[0049] Fourthly, the present invention provides the application of the above-mentioned primer-probe combination in the preparation of products for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis.

[0050] The primer-probe combination provided by this invention can specifically identify and amplify the gene sequences of Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis, and can be used to prepare products for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis.

[0051] The Klebsiella acidogenic complex includes Klebsiella acidogenic and Klebsiella micranthae. 、 At least one of Klebsiella gravidae and Klebsiella pastoris.

[0052] Fifthly, the present invention provides a kit for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis, comprising the aforementioned primer-probe combination.

[0053] The kit described in this invention is suitable for the detection of a variety of samples. It can be used for diagnostic purposes, such as the detection of sputum and other samples; it can also be used for non-diagnostic purposes, such as the detection of environmental samples, such as the detection of water bodies.

[0054] The Klebsiella acidogenic complex includes Klebsiella acidogenic and Klebsiella micranthae. 、 At least one of Klebsiella gravidae and Klebsiella pastoris.

[0055] In some alternative implementations, the kit further includes a PCR premix; The PCR premix solution includes 40-120 mM Tricine (pH 8.3), 50-150 mM potassium acetate, 1-3 U rTth enzyme, 0.16-0.48 mM dNTPs, and 2-6 mM MgCl2, with water as the solvent.

[0056] In some optional embodiments, the kit further includes negative and positive controls; The negative control was physiological saline. The positive control is a plasmid containing target sequences of Klebsiella pneumoniae, Klebsiella oxytocinae, and Proteus mirabilis.

[0057] The kit provided by this invention can be stored at 2-8℃, and is easy to operate, has good specificity, no mutual interference, strong repeatability, and the detection method is less time-consuming.

[0058] In a sixth aspect, the present invention provides a method for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis for purposes other than disease diagnosis and treatment, comprising the following steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the primer and probe combination or the kit described above. The Ct value of the amplification is used to determine whether the sample to be tested contains Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis.

[0059] This detection method is simple and can achieve rapid and accurate detection of, for example, Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis in water.

[0060] The Klebsiella acidogenic complex includes Klebsiella acidogenic and Klebsiella micranthae. 、 At least one of Klebsiella gravidae and Klebsiella pastoris.

[0061] In some optional embodiments, the PCR amplification program is as follows: 50℃ (1~3) min; 94℃ (2~5) min; 94℃ denaturation (5~15) sec; 60℃ annealing (20~40) sec; 45 cycles.

[0062] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0063] Example 1: Preparation of a kit for simultaneous detection of Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis The primer and probe sequences in the kit are shown in Table 1 below.

[0064] Table 1 Primer and probe sequences

[0065] Among them, as shown in SEQ ID NO.3, the 5' end of the probe is connected to the FAM fluorescent group, and the 3' end is connected to the fluorescence quenching group BHQ1; As shown in SEQ ID NO.6, the probe has a ROX fluorescent group attached to its 5' end and a fluorescence quenching group BHQ2 attached to its 3' end. As shown in SEQ ID NO.9, the probe has a CY5 fluorescent group attached to its 5' end and a BHQ3 fluorescent quencher attached to its 3' end. As shown in SEQ ID NO.12, the probe has a HEX fluorescent group attached to its 5' end and a fluorescence quencher group BHQ1 attached to its 3' end.

[0066] The kit also includes PCR reaction solution, negative control and positive control; The components of the PCR reaction solution are shown in Table 2.

[0067] Table 2 Composition of PCR reaction solution

[0068] Negative control: physiological saline; positive control: artificially synthesized plasmid (containing target sequences of Klebsiella pneumoniae, Klebsiella oxytocinae, and Proteus mirabilis).

[0069] Example 2: Detection method of the kit of the present invention (1) Reagent preparation Samples were tested using the nucleic acid detection reagents for Klebsiella pneumoniae, Klebsiella acidogenetic complex, and Proteus mirabilis prepared in Example 1.

[0070] (2) Sample processing Take 200 μL of the sputum sample to be tested, add 4 times the volume of 4% NaOH, shake to mix, and let stand at room temperature for 10 minutes to liquefy until there is no obvious stringiness when the pipette is aspirated (the liquefaction time can be increased appropriately until liquefaction is complete). Then add 1 volume of 10% (v / v) acetic acid solution for neutralization. Take 800 μL of the processed sample and use the nucleic acid extraction or purification reagent of Zhengzhou Antu Biotechnology Co., Ltd. (registration number: Yu Zheng Xie Bei 20180037) to complete the subsequent automated reaction process using the fully automated nucleic acid purification and amplification instrument (Zhengzhou Antu Biotechnology Co., Ltd., AutoMolec3000 fully automated nucleic acid purification and real-time fluorescence PCR analysis system) to complete the automated reaction process.

[0071] (3) Amplification procedure Based on the length of the amplified fragment, the annealing temperature of the primers and probes, and the characteristics of the enzyme, this invention optimized the reaction annealing temperature and extension time. The final cycle parameters were determined as follows: 50℃ for 2 min; 94℃ for 3 min; 94℃ denaturation for 10 sec, 60℃ annealing for 30 sec, for 45 cycles. Fluorescence signals were collected during the annealing phase of each cycle.

[0072] (4) Results Analysis After the reaction is complete, the instrument automatically saves the results and performs automatic analysis using its built-in software, determining the detection results based on the Ct value. Specific test result analysis is as follows: 1. When the FAM / CY5 / ROX channels have no value and the Ct value of the HEX channel is ≤35, the test result can be reported as negative.

[0073] 2. When the Ct value of the FAM / CY5 / ROX channel is ≤36 and the Ct value of the HEX channel is ≤35, the test result can be reported as positive for Klebsiella gas-producing / Klebsiella acid-producing complex / Proteus mirabilis.

[0074] 3. When the Ct value of the FAM / CY5 / ROX channel is >36 and the Ct value of the HEX channel is ≤35, the sample concentration can be reported as being below the detection limit. The results are for reference only.

[0075] 4. When the Ct value of the HEX channel is greater than 35, the test result is invalid. The cause should be found and eliminated, and the test should be repeated.

[0076] Positive results for the detection of Klebsiella pneumoniae / Klebsiella acidogenic complex / Proteus mirabilis are as follows: Figure 1 As shown.

[0077] Example 3 Identification of Klebsiella pneumoniae, Klebsiella acidogenic bacteria, and Proteus mirabilis PCR reaction solutions were prepared according to Table 3. The primers and probes described in Example 1 were used to detect *Klebsiella pneumoniae*, *Klebsiella acidogenae*, and *Proteus mirabilis* using the method described in Example 2. The experimental results are shown in Table 4. All three schemes (Scheme 1-Scheme 3) could detect *Klebsiella pneumoniae*, *Klebsiella acidogenae*, and *Proteus mirabilis* normally, and there was no significant difference in CT values.

[0078] Table 3 Preparation of PCR reaction solution

[0079] Table 4. Detection results of Klebsiella pneumoniae, Klebsiella acidogenic bacteria, and Proteus mirabilis.

[0080] Example 4: Sensitivity and Precision Verification To verify the sensitivity and precision of the detection method in this invention, Klebsiella pneumoniae, Klebsiella acidogenic bacteria, and Proteus mirabilis strains that had been cultured and counted were selected and diluted to 1×10⁻⁶. 4 CFU / mL, 1×10 3 CFU / mL, 500 CFU / mL, and 250 CFU / mL concentrations were used to detect the sensitivity of the strains using the detection method described in Example 2. Figure 2 As shown, the selected strains were detected at a sample concentration of 250 CFU / mL. A 1×10⁻⁶ CFU / mL sample was selected. 4 For each strain, the CFU / mL concentration was repeatedly tested 10 times using the detection method described in Example 2. The CV (%) was statistically analyzed, and the results are shown in Table 5. Figure 3 As shown, the detection precision CV of each strain is <1.4%, indicating good precision.

[0081] Table 5 Precision Validation Results

[0082] Example 5 Specificity Verification The specificity of this reagent was verified using 15 clinical isolates. These isolates included *Escherichia coli*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Staphylococcus aureus*, methicillin-resistant *Staphylococcus aureus*, *Moraxella catarrhalis*, *Legionella pneumophila*, *Pseudomonas aeruginosa*, *Acinetobacter baumannii*, *Burkholderia cepacia*, *Stenotrophomonas maltophilia*, *Haemophilus influenzae*, *Enterobacter cloacae*, *Serratia marcescens*, and *Citrobacter freundii*. The detection method described in Example 2 was used for testing. The results showed that the reagent exhibited high specificity and no cross-reactivity with any of the 15 isolates. The results are shown in Table 6.

[0083] Table 6 Specificity Validation Results

[0084] Example 6 Stability Verification PCR reaction solutions were prepared according to Table 2. Their real-time stability was then assessed using a 37°C accelerated thermal stability test. The reagents were accelerated at 37°C for 0, 7, 14, and 21 days. Three types of samples (high, medium, and low concentrations) were tested according to the method in Example 2 (high value: 8 × 10⁻⁶). 4 CFU / mL; Median: 2×10 4 CFU / mL; Low value: 5×10 3 The Ct value difference (CFU / mL) compared to day 0 was no more than 1.31 Ct, indicating a small difference and thus reagent stability. The results are shown in Table 7. Table 7 Stability test results

[0085] Example 7: Validation of the inclusion of primers and probes for the Klebsiella acidogenic complex The inclusion of the Klebsiella acidogenic complex primer probe was verified using the reagents prepared in Example 1. Klebsiella acidogenic and Klebsiella micranthae were detected in the Klebsiella acidogenic complex, respectively. 、 Klebsiella pneumoniae 、 Klebsiella pastoris was tested in 3 wells at a concentration of 250 CFU / mL. The results are shown in Table 8. All strains were detected and the CT values ​​differed by less than 1 Ct, indicating that the primer probe for the acid-producing Klebsiella complex has strong inclusiveness.

[0086] Table 8. Results of the inclusion verification of the Klebsiella acidogenic complex primer-probe combination. .

[0087] Example 8: Sensitivity Comparison of the Invention Kit with Existing Kits The detection method in Example 2 was used to detect 1×10 4 CFU / mL, 1×10 3 Four concentrations of Klebsiella pneumoniae and Proteus mirabilis were detected at CFU / mL, 500 CFU / mL, and 250 CFU / mL, and the results are as follows: Figure 2 As shown.

[0088] The primers, probes, and methods in patents CN 108866215 A (Comparison 1) and CN 110951895 A (Comparison 2) were used to target 1×10 4 CFU / mL, 1×10 3 Four concentrations of Klebsiella pneumoniae and Proteus mirabilis were tested at CFU / mL, 500 CFU / mL, and 250 CFU / mL, respectively. The results are as follows: Figure 4 As shown.

[0089] from Figure 4 As can be seen, compared with method 1, none of the four concentrations of Klebsiella pneumoniae could be detected. Compared with method 2, the four concentrations of Proteus mirabilis could not be detected, including a concentration of 250 CFU / mL. The above results show that the sensitivity of the primer probe of the present invention is significantly better than that of the prior art.

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer probe for detecting Klebsiella acidogenic complexes, characterized in that, The primers used to detect the Klebsiella acidogenic complex have nucleotide sequences as shown in SEQ ID NO.4 and SEQ ID NO.5, and the probes used to detect the Klebsiella acidogenic complex have nucleotide sequences as shown in SEQ ID NO.

6.

2. The primer probe according to claim 1, characterized in that, The Klebsiella acidogenic complex includes at least one of Klebsiella acidogenic, Klebsiella micrantha, Klebsiella gravidii, and Klebsiella pastoris.

3. The use of the primer probe according to claim 1 or 2 in the preparation of products for detecting Klebsiella acidogenic complex.

4. A primer-probe combination, characterized in that, This includes primers and probes for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis; The primers used to detect Klebsiella pneumoniae have nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe used to detect Klebsiella pneumoniae has nucleotide sequences as shown in SEQ ID NO.3; The primers used to detect the Klebsiella acidogenic complex have nucleotide sequences as shown in SEQ ID NO.4 and SEQ ID NO.5, and the probes used to detect the Klebsiella acidogenic complex have nucleotide sequences as shown in SEQ ID NO.6; The primers used to detect Proteus mirabilis have nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, and the probes used to detect Proteus mirabilis have nucleotide sequences as shown in SEQ ID NO.

9.

5. The primer-probe combination according to claim 4, characterized in that, It also includes primers and probes for detecting internal standard genes; The primers used to detect the internal standard gene have nucleotide sequences as shown in SEQ ID NO.10 and SEQ ID NO.11, and the probes used to detect the internal standard gene have nucleotide sequences as shown in SEQ ID NO.

12.

6. The primer-probe combination according to claim 4 or 5, characterized in that, The probe has a fluorescent reporter group and a fluorescent quencher group attached to its two ends, respectively. The fluorescent reporter group includes FAM, ROX, CY5, or HEX; The fluorescence quenching group includes TAMRA, BHQ1, or BHQ2; Preferably, the fluorescent reporter groups of each probe are different.

7. The use of the primer-probe combination according to any one of claims 4-6 in the preparation of products for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis.

8. A kit for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis, characterized in that, Includes the primer-probe combination as described in any one of claims 4-6.

9. The reagent kit according to claim 8, characterized in that, The kit also includes a PCR premix; The PCR premix includes 40-120 mM Tricine, 50-150 mM potassium acetate, 1-3 U rTth enzyme, 0.16-0.48 mM dNTPs, and 2-6 mM MgCl2, with water as the solvent. Preferably, the kit further includes negative control and positive control; The negative control was physiological saline. The positive control is a plasmid containing the target sequence of Klebsiella pneumoniae, Klebsiella acidogenetic complex, or Proteus mirabilis.

10. A method for detecting Klebsiella pneumoniae, Klebsiella acidogenic complex, and Proteus mirabilis for non-disease diagnosis and treatment purposes, characterized in that, Includes the following steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the primer and probe combination described in any one of claims 4-6 or the kit described in claim 8 or 9. The Ct value of the amplification is used to determine whether the sample to be tested contains Klebsiella pneumoniae, Klebsiella acidogenic complex and Proteus mirabilis.

Images