SNP (Single Nucleotide Polymorphism) molecular marker related to beta-cryptoxanthin content character of sweet corn and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular markers, in particular to an SNP molecular marker related to the beta-cryptoxanthin content character of sweet corn and application of the SNP molecular marker. High performance liquid chromatography is used for detecting the beta-cryptoxanthin content character of the sweet corn kernels, QTL positioning is conducted through the beta-cryptoxanthin content character of the kernels, it is found that one major QTL related to the beta-cryptoxanthin content of the sweet corn kernels exists on the sixth chromosome of the corn, the major QTL is between SNP loci Chr677689205 and Chr682556175, and the major QTL can be used for detecting the beta-cryptoxanthin content of the sweet corn kernels. The SNP locus Chr677988878 has the advantages that the phenotype contribution rate of the SNP locus Chr677988878 to the content of the beta-cryptoxanthin in the corn kernels is 17.04%, the SNP locus Chr677988878 is closely linked with the content of the beta-cryptoxanthin in the corn kernels, the SNP locus can be used for predicting the content of the beta-cryptoxanthin in the sweet corn kernels, and technical support is provided for molecular marker-assisted breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to SNP molecular markers related to the β-cryptoxanthin content trait in sweet corn and their applications. Background Technology

[0002] Sweet corn is an important type of fresh corn, with its kernels possessing a unique flavor that is fresh, sweet, tender, and crisp during the milk-ripe stage. It is also known as "fruit corn" or "vegetable corn." Sweet corn is rich in various vitamins, minerals, and bioactive substances, possessing both high nutritional value and economic benefits. Carotenoids are an important component of the nutritional quality of sweet corn, among which β-cryptoxanthin (BCRY) has vitamin A precursor activity and physiological effects such as antioxidant and anti-stress properties. Increasing the β-cryptoxanthin content in sweet corn kernels is of great significance for enhancing the nutritional value and functionality of sweet corn.

[0003] β-cryptoxanthin content is a typical quantitative trait, regulated by multiple genes and easily influenced by environmental factors. Traditional breeding relies on phenotypic selection, which has limitations such as complex detection, long breeding cycles, and significant environmental interference, making it difficult to achieve precise improvement of the target trait. Molecular marker-assisted selection (MAS) can effectively track loci associated with the target trait at an early stage, improving the efficiency of selection for complex quantitative traits. By constructing genetic linkage populations and performing quantitative trait locus (QTL) mapping, key gene loci controlling traits can be revealed, providing a basis for molecular detection and early screening of superior allelic variations. Although some QTL loci controlling carotenoid content in maize kernels have been reported, specific studies on β-cryptoxanthin content in sweet maize kernels are still relatively limited. Systematically identifying the major QTLs for β-cryptoxanthin content in sweet maize kernels and developing SNP molecular markers closely linked to the major QTLs can achieve precise identification and selection of high β-cryptoxanthin traits at the molecular level, providing a theoretical basis and technical support for molecular breeding of high-nutritional-quality sweet maize. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides SNP molecular markers related to the β-cryptoxanthin content trait in sweet corn and their applications. The SNP molecular markers provided by this invention are tightly linked to the major QTLs for β-cryptoxanthin content in sweet corn kernels, and can be used to screen or assist in screening sweet corn with relatively high β-cryptoxanthin content, resulting in more accurate screening results and significant improvements in the nutritional quality of sweet corn.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides SNP molecular markers related to the β-cryptoxanthin content trait in sweet corn, wherein the SNP molecular markers are nucleic acid molecules containing SNP site information and their upstream and downstream nucleotide sequences; The SNP site is located at 77988878 bp on chromosome 6 of the maize B73 RefGen_v4 genome and exhibits C / T polymorphism.

[0006] Preferably, the nucleic acid molecule comprises a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.1.

[0007] This invention provides the application of the SNP molecular markers described in the above technical solutions, or the products that detect the SNP molecular markers described in the above technical solutions, in 1) and / or 2): 1) Screen sweet corn with relatively high β-cryptoxanthin content; 2) Develop sweet corn varieties with high β-cryptoxanthin content; When the genotype of the SNP site in the SNP molecular marker is TT, the β-cryptoxanthin content in sweet corn is relatively high.

[0008] Preferably, the β-cryptoxanthin content is the β-cryptoxanthin content in sweet corn kernels.

[0009] Preferably, the product includes primers or a kit.

[0010] This invention provides a primer pair for detecting the SNP molecular marker described in the above technical solution. The primer pair consists of an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0011] This invention provides a method for screening sweet corn with relatively high β-cryptoxanthin content, comprising the following steps: Determine the genotype of the SNP site in the SNP molecular marker described in the above technical solution for the sweet corn to be tested; Based on the genotype results, sweet corn with the genotype TT at the SNP locus was selected, which is sweet corn with a relatively high β-cryptoxanthin content.

[0012] This invention provides a method for breeding sweet corn varieties with high β-cryptoxanthin content, comprising the following steps: Determine the genotype of the SNP site in the SNP molecular marker described in the above technical solution for the sweet corn to be tested; Discard the sweet corn with the genotype CC at the SNP locus, and perform self-pollination and / or hybridization on the remaining sweet corn. Keep the sweet corn with the genotype TT at the SNP locus in the offspring, which is the sweet corn with a relatively high β-cryptoxanthin content.

[0013] Preferably, the determination includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product; the primer pair for PCR amplification includes the primer pair described in the above technical solution.

[0014] Preferably, the β-cryptoxanthin content is the β-cryptoxanthin content in sweet corn kernels.

[0015] Beneficial effects: This invention provides SNP molecular markers related to the β-cryptoxanthin content trait in sweet maize. The SNP molecular markers are nucleic acid molecules containing SNP site information and their upstream and downstream nucleotide sequences. The SNP site is located at 77988878 bp on chromosome 6 of the maize B73RefGen_v4 genome and exhibits C / T polymorphism. This invention utilizes sweet maize inbred lines SHL01 and SHL03 as parents to construct a RIL population. High-performance liquid chromatography (HPLC) was used to detect the β-cryptoxanthin content trait data in sweet maize kernels. QTL mapping for the kernel β-cryptoxanthin content trait revealed a major-effect QTL on maize chromosome 6 associated with sweet maize kernel β-cryptoxanthin content, located between SNP loci Chr6_77689205 and Chr6_82556175 (B73 RefGen_v4 genome). This QTL contributes 17.04% to the β-cryptoxanthin content phenotype in sweet maize kernels. SNP loci Chr6_77988878 are tightly linked to kernel β-cryptoxanthin content. This SNP locus can be used to predict sweet maize kernel β-cryptoxanthin content and, further, to predict the complex trait of carotenoid content in sweet maize kernels, providing technical support for marker-assisted breeding. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 Map showing the location of QTLs related to β-cryptoxanthin content in sweet corn kernels on maize chromosomes.

[0018] Figure 2 Violin plot showing the β-cryptoxanthin content in maize kernels of different alleles; In the violin plot, the three dashed horizontal lines represent quartiles; the asterisk indicates a significant difference according to the Student's t-test (ns indicates no significant difference; ** indicates...). P <0.01). Detailed Implementation

[0019] This invention provides SNP molecular markers related to the β-cryptoxanthin content trait in sweet corn, wherein the SNP molecular markers are nucleic acid molecules containing SNP site information and their upstream and downstream nucleotide sequences; The SNP site is located at 77988878 bp on chromosome 6 of the maize B73 RefGen_v4 genome and exhibits C / T polymorphism.

[0020] In one embodiment, the nucleic acid molecule includes a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.1, specifically as follows: SEQ ID NO.1: 5'-TTAAAGCCGACGCGAGAGAACCGAGGCGAGAGGGGATATGGGGAACCAGGTCGGGGGCCGGCGGYGGACGAGCGCTACACGCGCCCGCAGGGGCTGTACCCGCACCCGGACATCGACCTCAGGAAGCTCCGCCGCCTCATCCTCGAGGCCAAGCTCGCGCCCTGCCACCCTGGCGCCGACGACGCGCGCGCTGACCTCGACGAGTGCCCCATCTGCTTCCT-3'; wherein, the SNP site is located at 65 bp in SEQ ID NO.1 and is represented by the degenerate base Y, i.e., Y is C or T.

[0021] This invention utilizes a RIL population to perform QTL mapping on the β-cryptoxanthin content trait in sweet corn kernels, and screens out a major-effect QTL related to the β-cryptoxanthin content trait in sweet corn kernels, which is suitable for predicting the β-cryptoxanthin content trait in sweet corn kernels, and provides technical support for molecular marker-assisted breeding.

[0022] When screening for the β-cryptoxanthin content trait in sweet corn kernels using the SNP molecular markers provided by this invention, it is only necessary to detect the genotype of the SNP locus in the SNP molecular marker, or the genotype of position 65 of the nucleic acid molecule shown in SEQ ID NO.1, to predict the β-cryptoxanthin content trait in sweet corn kernels. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. SNP markers can also achieve high throughput. It can be used for marker-assisted breeding of the β-cryptoxanthin content trait in sweet corn kernels during the seedling stage, and it can also be used for molecular aggregation breeding of the trait.

[0023] Based on the above advantages, the present invention provides the application of the SNP molecular markers described in the above technical solutions or the products detecting the SNP molecular markers described in the above technical solutions in 1) and / or 2): 1) Screen sweet corn with relatively high β-cryptoxanthin content; 2) Develop sweet corn varieties with high β-cryptoxanthin content; When the genotype of the SNP site in the SNP molecular marker is TT, the β-cryptoxanthin content in sweet corn is relatively high.

[0024] In one embodiment, the β-cryptoxanthin content is the β-cryptoxanthin content in sweet corn kernels.

[0025] In one implementation, the product includes primers or a kit.

[0026] Based on the above advantages, this invention provides a primer pair for detecting the SNP molecular marker described in the above technical solution. The primer pair consists of an upstream primer (qBCRY6-FP) and a downstream primer (qBCRY6-RP). The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3, as detailed below: qBCRY6-FP: 5'-TTAAAGCCGACGCGAGAGAA-3', SEQ ID NO.2; qBCRY6-RP: 5'-AGGAAGCAGATGGGGCACTC-3', SEQ ID NO. 3. .

[0027] The primer pairs provided by this invention can specifically amplify nucleic acid molecules containing the SNP molecular marker. Based on the genotype of the 65th bp of the amplification product, sweet corn with relatively high β-cryptoxanthin content can be screened or sweet corn varieties with high β-cryptoxanthin content can be cultivated.

[0028] Based on the above advantages, the present invention provides a method for screening sweet corn with relatively high β-cryptoxanthin content, comprising the following steps: Determine the genotype of the SNP site in the SNP molecular marker described in the above technical solution for the sweet corn to be tested; Based on the genotype results, sweet corn with the genotype TT at the SNP locus was selected, which is sweet corn with a relatively high β-cryptoxanthin content.

[0029] Based on the above advantages, the present invention provides a method for breeding sweet corn varieties with high β-cryptoxanthin content, comprising the following steps: Determine the genotype of the SNP site in the SNP molecular marker described in the above technical solution for the sweet corn to be tested; Discard the sweet corn with the genotype CC at the SNP locus, and perform self-pollination and / or hybridization on the remaining sweet corn. Keep the sweet corn with the genotype TT at the SNP locus in the offspring, which is the sweet corn with a relatively high β-cryptoxanthin content.

[0030] This invention, by discarding sweet corn with the genotype CC at the SNP locus and performing self-pollination and / or hybridization on the remaining sweet corn, can increase the frequency of the TT genotype in the offspring population and cultivate sweet corn varieties with relatively high β-cryptoxanthin content.

[0031] In one embodiment, the determination includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product; the primer pair for the PCR amplification includes the primer pair described in the above technical solution.

[0032] As one implementation method, the β-cryptoxanthin content is the β-cryptoxanthin content in sweet corn kernels. To further illustrate the present invention, the following detailed description, in conjunction with embodiments and accompanying drawings, of the SNP molecular markers related to the β-cryptoxanthin content trait in sweet corn provided by the present invention and their applications, but these should not be construed as limiting the scope of protection of the present invention.

[0033] Example 1 1. Construction of a genetic map of sweet corn RIL population A Reproductive Inbred Line (RIL) population was constructed using sweet maize inbred lines SHL01 and SHL03 as parents and planted at the Zhuangxing Experimental Station of the Shanghai Academy of Agricultural Sciences. After emergence, leaf tissues were collected from the RIL population, and DNA was extracted using a high-efficiency plant genomic DNA extraction kit (catalog number DP350, TIANGEN, China). Using the SHL01 reference genome sequence (Accession number GWHFPVK00000000.1, National Center for Biotechnology Information), genotyping by target sequencing (GBTS) was used to genotype 236 individuals from the F7 generation, yielding 68,484 SNP loci. PLINK software was used for quality control filtering, selecting SNPs with a deletion rate of less than 20%, a minimum allele frequency greater than 0.05, and a heterozygosity of less than 20%. The constructed genetic map contained 5,081 high-quality SNP markers, divided into 10 linkage groups. The total distance of the genetic map was 3923.82 cM, and the average genetic distance between SNP markers was 0.77 cM.

[0034] 2. Detection of β-cryptoxanthin content in sweet corn kernels RIL (Recombinant Inbred Line) populations were constructed using sweet maize inbred lines SHL01 and SHL03 as parents. These RIL populations were then used in a randomized block design and planted at the Zhuangxing Experimental Station of the Shanghai Academy of Agricultural Sciences in both open fields and greenhouses. Each RIL family was planted in two-row plots with three replicates, and normal field management was implemented. After the sweet maize kernels were harvested, the β-cryptoxanthin content in the kernels was determined using high-performance liquid chromatography (HPLC). Three ears were taken from each replicate, and 15 intact kernels free from disease and pests were selected from each ear for β-cryptoxanthin extraction and determination. The average value of the three replicates was then used as the phenotypic data.

[0035] Table 1. Comparison of phenotypic variation and heritability of β-cryptoxanthin in RIL populations

[0036] 3. Obtain the main effect QTL for the β-cryptoxanthin content trait in sweet corn kernels. Using QTL IciMapping 4.2 software and the inclusive composite interval mapping (ICIM) method, QTL analysis was performed on the β-cryptoxanthin content of grains in the RIL population based on the best linear unbiased estimators (BLUEs) obtained from two experimental environments. P At a significance level of <0.05, 1000 randomization tests were performed to determine the logarithm of the odds (LOD) of the likelihood function ratio. The confidence interval (QTL interval) for the QTL was determined using the 2-LOD interval method. The format for naming QTLs is: prefix "q" + trait abbreviation + chromosome number of the QTL + serial number of the QTL on the same chromosome, with the number connected to the chromosome number by a "-". QTL analysis was performed on the β-cryptoxanthin content of grains, such as... Figure 1 As shown, a total of two QTLs were detected, located on chromosomes 6 and 8, with LOD values ​​of 8.97 and 4.23, respectively. The contribution rates of individual QTLs to phenotypic variation were 17.04% and 7.55%, respectively. A single QTL contributing ≥10% to phenotypic variation is considered a major QTL, therefore, the QTL located on chromosome 6... qBCRY6 It is the primary QTL.

[0037] Table 2. QTL results of β-cryptoxanthin content in sweet corn RIL population kernels

[0038] 4. Development and application of SNP markers closely linked to the β-cryptoxanthin content trait in sweet corn kernels QTL positioning results show that qBCRY6 This is a major-effect QTL located on chromosome 6 of maize that regulates kernel β-cryptoxanthin content, between SNPs S6_91927299 and S6_96134979. The physical location of the corresponding maize B73 RefGen_v4 genome (Accession number GCF_000005005.2, National Center for Biotechnology Information) is Chr6_77689205-82556175, among which the Chr6_77988878 locus is closely linked to the kernel β-cryptoxanthin content trait.

[0039] Example 2 Based on the SNP sites screened in Example 1, detection primers qBCRY6-FP (SEQ ID NO.2) and qBCRY6-RP (SEQ ID NO.3) were designed to amplify the region Chr6_77988814~Chr6_77989034 in maize to detect the SNP marker Chr6_77988878 genotype.

[0040] The filtering method is as follows: Using genomic DNA from maize leaves as a template, PCR amplification was performed using primers qBCRY6-FP and qBCRY6-RP to obtain PCR amplification products. These products were then sequenced to determine the genotype of the SNP site Chr6_77988878. When the genotype of SNP site Chr6_77988878 was homozygous (TT), the β-cryptoxanthin content in the sweet maize kernels was relatively high; when the genotype of SNP site Chr6_77988878 was homozygous (CC) or heterozygous (CT), the β-cryptoxanthin content in the sweet maize kernels was low.

[0041] Example 3 The method described in Example 2 was validated in a natural population of 133 sweet maize inbred lines at the Shanghai Academy of Agricultural Sciences. The phenotype of kernel β-cryptoxanthin content and the genotype at the Chr6_77988878 locus were determined. The results are shown in Table 3 and... Figure 2 As shown, when the genotype of SNP Chr6_77988878 is homozygous (TT), the β-cryptoxanthin content in sweet corn kernels is significantly higher than that of homozygous (CC) and heterozygous (CT), with highly significant differences (P values ​​of 0.0002 and 0.0019, respectively, obtained by Student's t-test). This indicates a strong association between the Chr6_77988878 genotype and the phenotype. This SNP locus can be used to predict the β-cryptoxanthin content in sweet corn kernels.

[0042] Table 3. Correspondence between SNP genotypes and kernel β-cryptoxanthin content phenotypes in natural sweet maize populations.

[0043] In summary, the major-effect QTL tightly linked SNP markers associated with β-cryptoxanthin content in sweet corn, obtained using this invention, can assist in the selection of corn with high β-cryptoxanthin content. Only the genotype of the SNP base at a specific locus, or the genotype at position 65 of the sequence shown in SEQ ID NO.1, needs to be detected to predict the β-cryptoxanthin content trait in sweet corn kernels. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. SNP markers can also achieve high throughput. They can be used in marker-assisted breeding for the β-cryptoxanthin content trait in sweet corn kernels during the seedling stage, and can also be used for molecular aggregation breeding of the trait.

[0044] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with the sweet corn beta-cryptoxanthin content trait, characterized in that, The SNP molecular marker is a nucleic acid molecule containing SNP site information and its upstream and downstream nucleotide sequences. The SNP site is located at 77988878 bp on chromosome 6 of the B73 RefGen_v4 genome of Zea mays, and a C / T polymorphism exists.

2. The SNP molecular marker of claim 1, wherein, The nucleic acid molecule includes a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.

1.

3. The SNP molecular marker of claim 1 or 2 or a product for detecting the SNP molecular marker of claim 1 or 2 for use in 1) and / or 2): 1) screening sweet corn with relatively high β-cryptoxanthin content; 2) breeding sweet corn varieties with high β-cryptoxanthin content. When the genotype of the SNP site in the SNP molecular marker is TT, the sweet corn has relatively high β-cryptoxanthin content.

4. Use according to claim 3, characterized in that, The β-cryptoxanthin content is the β-cryptoxanthin content in the sweet corn kernels.

5. Use according to claim 3, characterized in that, The product includes primers or a kit.

6. A primer pair for detecting the SNP molecular marker of claim 1 or 2, characterized in that, The primer pair consists of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.

3.

7. A method of screening sweet corn having relatively high content of β-cryptoxanthin, characterized by, The method comprises the following steps: determining the genotype of the SNP site in the SNP molecular marker of claim 1 or 2 in the sweet corn to be tested; According to the determined genotype result, sweet corn with a genotype of TT at the SNP site is selected, i.e. sweet corn with relatively high β-cryptoxanthin content.

8. A method for breeding a sweet corn variety having a high content of β-cryptoxanthin, characterized by, The method comprises the following steps: determining the genotype of the SNP site in the SNP molecular marker of claim 1 or 2 in the sweet corn to be tested; Discarding sweet corn with a genotype of CC at the SNP site, and selfing and / or crossing the remaining sweet corn, and retaining sweet corn with a genotype of TT at the SNP site in the offspring, i.e. sweet corn with relatively high β-cryptoxanthin content.

9. The method according to claim 7 or 8, characterized in that, The determination comprises performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product; the primer pair for the PCR amplification comprises the primer pair of claim 6.

10. The method according to claim 7 or 8, characterized in that, The β-cryptoxanthin content is the β-cryptoxanthin content in the sweet corn kernels.

Images