Endogenous reference gene, probe primer and kit for quantitatively detecting HCMV nucleic acid

Abstract

The invention relates to the technical field of nucleic acid detection, in particular to an endogenous reference gene, a probe primer and a kit for quantitatively detecting HCMV nucleic acid, the endogenous reference gene comprises a core sequence and flanking sequences located at the two ends of the core sequence, and the nucleotide sequence of the core sequence is shown as SEQ ID NO.1. According to the endogenous reference gene sequence, the detection primer and the detection probe of the endogenous reference gene and the detection primer and the detection probe for specifically recognizing the HCMV nucleic acid, rapid and accurate quantitative detection of the HCMV nucleic acid can be realized, and the accuracy and the reliability of a detection result are improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of nucleic acid detection, in particular to an internal standard gene for quantitatively detecting HCMV nucleic acid, a probe primer and a kit. BACKGROUND

[0002] In recent years, nucleic acid quantification methods have gradually attracted attention in HCMV detection. The conventional nucleic acid quantification method usually uses qPCR technology, such as patent CN119614756A, which needs to draw a standard curve in each test to ensure the accuracy and stability of the quantitative results. This method is not only cumbersome to operate, but also consumes a large amount of standardization product in each test, resulting in high detection cost.

[0003] In addition, the conventional quantitative reference of the quantitative reagent is usually in the form of three forms of pseudo-virus, artificially constructed plasmid or artificially synthesized DNA fragment, such as the pseudo-virus used in patent CN116732236A to prepare the quantitative reference, which is an enveloped virus with relatively poor stability, the most complex preparation, the highest cost, and more stringent storage and transportation conditions. For example, the human cytomegalovirus recombinant plasmid used in patent CN119614756A as a quantitative reference, since the artificially constructed plasmid usually exists in three forms of supercoiled structure, open loop structure and linear after the preparation is completed, and with the extension of storage time, the proportion of the three forms changes, which eventually leads to differences in the detection results. And the artificially synthesized fragment alone is unstable in the sample and is easily degraded. These internal standards have the problems of poor stability, complex preparation, high cost, and stringent storage and transportation conditions. The current cytomegalovirus nucleic acid detection method lacks a quantitative reagent that can overcome the defects of the prior art, and it is difficult to realize accurate, rapid and absolute quantitative detection of human cytomegalovirus. SUMMARY

[0004] In view of the above-mentioned defects of the prior art, the purpose of the present application is to provide an internal standard gene for quantitatively detecting HCMV nucleic acid, a probe primer and a kit, which are used to solve the problems in the prior art.

[0005] To achieve the above-mentioned purposes and other related purposes, the present application first provides an internal standard gene for quantitatively detecting HCMV nucleic acid, which comprises a core sequence and a flanking sequence located at both ends of the core sequence, the oligonucleotide backbone of the flanking sequence is modified by phosphorothioate, and the nucleotide sequence of the core sequence is shown in SEQ ID NO. 1.

[0006] The application further provides a detection primer and a detection probe for detecting the internal standard gene, wherein the detection primer comprises an internal standard upstream primer shown as SEQ ID NO. 3 and an internal standard downstream primer shown as SEQ ID NO. 4; and the detection probe further comprises an internal standard probe shown as SEQ ID NO. 5.

[0007] The application further provides a detection substance for HCMV, which comprises the internal standard gene, the detection primer and the detection probe for detecting the internal standard gene, and a detection primer and a detection probe for specifically recognizing HCMV nucleic acid, wherein the detection primer for specifically recognizing HCMV nucleic acid comprises an HCMV upstream primer shown as SEQ ID NO. 6 and an HCMV downstream primer shown as SEQ ID NO. 7; and the detection probe for specifically recognizing HCMV nucleic acid further comprises an HCMV probe shown as SEQ ID NO. 8.

[0008] The application further provides a use of the detection substance for preparing an HCMV detection product.

[0009] The application further provides an HCMV detection kit, which comprises the detection substance.

[0010] The application further provides a method for quantitatively detecting HCMV nucleic acid for non-diagnostic purposes, which comprises the following steps: extracting DNA of a sample to be detected and an internal standard gene, and performing nucleic acid detection by using the kit.

[0011] As described above, the internal standard gene, the probe primer and the kit for quantitatively detecting HCMV nucleic acid of the application have the following beneficial effects: 1) The internal standard absolute quantification method is used to replace the traditional standard curve absolute quantification method, and the problems of poor stability, complex preparation and high cost of the traditional internal standard quantitative reagent are overcome. By using an artificially synthesized DNA fragment modified by thiophosphoric acid ester as the internal standard, the problem of poor stability and easy degradation of the pseudo virus is effectively solved, and the accuracy and reliability of the detection result are improved. 2) The internal standard of the application is a DNA fragment modified by thiophosphoric acid ester, which can effectively resist the degradation of nucleases, improve the stability of the internal standard in the sample, avoid the problem that the artificially synthesized fragment is easy to be degraded, and ensure the reliability of the detection result. 3) The internal standard quantitative reagent of the application is easy to prepare and store, has good stability and durability, significantly reduces the production and transportation cost, and improves the usability and market competitiveness of the product. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 An amplification graph of HCMV plasmid is shown.

[0013] Figure 2 Amplification plot showing the internal control gene.

[0014] Figure 3 Accelerated stability trend plot showing the HCMV pseudovirus.

[0015] Figure 4 Accelerated stability trend plot showing the HCMV plasmid.

[0016] Figure 5 Accelerated stability trend plot showing the internal control gene.

[0017] Figure 6 Amplification plot showing the HCMV international standard and internal control primary reference (IS) after extraction.

[0018] Figure 7 Standard curve plot showing the HCMV plasmid.

[0019] Figure 8 Difference plot showing the standard curve quantification and internal control method quantification for different sample matrices.

[0020] Figure 9 Bland-Altman plot.

[0021] Figure 10 Regression analysis plot. DETAILED DESCRIPTION

[0022] The present application provides an internal control gene for quantitatively detecting HCMV nucleic acid, which comprises a core sequence and flanking sequences at both ends of the core sequence, wherein the oligonucleotide backbone of the flanking sequences is modified by phosphorothioate, and the nucleotide sequence of the core sequence is shown in SEQ ID NO. 1.

[0023] SEQ ID NO. 1: 5'-CCTCATTCCCATGCCATCTCTGCACCTCTCAACTGCCGCTGTTCAGTTGACAGTCCTGGTGCGCTGGTTTGACTACATTCAACCAACGC-3'.

[0024] In some embodiments of the present application, the length of the flanking sequence is n nucleotides, wherein n≥3. Further, the length of the flanking sequence is 3≤n≤8. For example, it can be 3, 4, 5, 6, 7 or 8.

[0025] In a specific embodiment of the present application, the length of the flanking sequence is 6 nucleotides.

[0026] In some embodiments of the present application, the nucleotide sequence of the flanking sequence is any arrangement of A, T, C, G.

[0027] In a specific embodiment of the present application, the nucleotide sequence of the flanking sequence is as shown in SEQ ID NO: 2.

[0028] SEQ ID NO: 2: ATCTGA.

[0029] In a specific embodiment of the present application, the nucleotide sequence of the internal standard gene is as shown in SEQ ID NO: 9.

[0030] SEQ ID NO: 9: 5'-A*T*C*T*G*ACCTCATTCCCATGCCATCTCTGCACCTCTCAACTGCCGCTGTTCAGTTGACAGTCCTGGTGCGCTGGTTTGACTACATTCAACCAACGCA*T*C*T*G*A-3'.

[0031] The nucleotide sequence of the complementary strand is as shown in SEQ ID NO: 10.

[0032] SEQ ID NO: 10: 5'-T*C*A*G*A*TGCGTTGGTTGAATGTAGTCAAACCAGCGCACCAGGACTGTCAACTGAACAGCGGCAGTTGAGAGGTGCAGAGATGGCATGGGAATGAGGT*C*A*G*A*T-3' The bolded part represents the flanking sequence, and the * represents a phosphorothioate modification between two bases.

[0033] In some embodiments of the present application, the flanking sequences at the two ends are independent of each other in terms of length and nucleotide arrangement.

[0034] The present application also provides a detection primer and a detection probe for detecting the internal standard gene described above. The detection primer comprises an internal standard upstream primer as shown in SEQ ID NO. 3 and an internal standard downstream primer as shown in SEQ ID NO. 4; and the detection probe further comprises an internal standard probe as shown in SEQ ID NO. 5.

[0035] In some embodiments of the present application, one end of the internal standard probe is labeled with a fluorescent reporter group and the other end is labeled with a fluorescent quencher group. The fluorescent reporter group is selected from one or more of FAM, HEX, TET, ROX, JOE; and the fluorescent quencher group is selected from one or more of ECLIPSE, DABCYL, BHQ-1, BHQ-2, BHQ-3.

[0036] In a specific embodiment of the present application, the fluorescent reporter group of the internal standard probe is HEX and the fluorescent quencher group is BHQ-1.

[0037] The present application also provides a detection substance for HCMV, which comprises the above-mentioned internal standard gene, the above-mentioned detection primer and detection probe for detecting the internal standard gene, and a detection primer and a detection probe for specifically recognizing HCMV nucleic acid, wherein the detection primer for specifically recognizing HCMV nucleic acid comprises an HCMV upstream primer as shown in SEQ ID NO. 6 and an HCMV downstream primer as shown in SEQ ID NO. 7; and the detection probe for specifically recognizing HCMV nucleic acid further comprises an HCMV probe as shown in SEQ ID NO. 8.

[0038] In some embodiments of the present application, one end of the HCMV probe is labeled with a fluorescent reporter group and the other end is labeled with a fluorescent quencher group. The fluorescent reporter group is selected from one or more of FAM, HEX, TET, ROX, JOE; and the fluorescent quencher group is selected from one or more of ECLIPSE, DABCYL, BHQ-1, BHQ-2, BHQ-3.

[0039] In a specific embodiment of the present application, the fluorescent reporter group of the HCMV probe is FAM and the fluorescent quencher group is BHQ-1.

[0040] Specifically, the fluorescent reporter groups labeled at the 5' end of the internal standard probe and the HCMV probe are different and have different fluorescent wavelengths. Preferably, the fluorescent wavelengths of the two fluorescent reporter groups are greatly different and the signal intensities are similar, which ensures the accuracy of the detection results and avoids mutual interference between the signals.

[0041] The kit uses polymerase chain reaction (PCR) combined with Taqman technology, and specific primers are designed according to the nucleic acid sequence of HCMV for amplifying the corresponding nucleic acid fragment. Meanwhile, a highly specific Taqman probe can be combined with the corresponding nucleic acid fragment and hydrolyzed under the action of Taq enzyme exonuclease activity to generate a fluorescent signal. According to the relationship between the fluorescent signal and the number of amplification cycles, a real-time amplification curve can be obtained.

[0042] The present application also provides the use of the above-mentioned detection substance in the preparation of an HCMV detection product.

[0043] In some embodiments of the present application, the detection sample suitable for the detection product is selected from the group consisting of blood sample, body fluid sample. Specifically, the blood sample is selected from the group consisting of whole blood, plasma or serum; the body fluid sample is selected from the group consisting of urine or milk.

[0044] In some embodiments of the present application, the detection product is used for the judgment of HCMV, the selection of treatment plan, and / or the prognosis evaluation.

[0045] The present application also provides a detection kit for HCMV, which comprises the detection substance as described above.

[0046] In some embodiments of the present application, the working concentration of the HCMV upstream primer and / or the HCMV downstream primer is 0.2-0.6 μM, based on the volume of the PCR reaction system. The working concentration of the HCMV upstream primer and / or the HCMV downstream primer is selected from any one of the following ranges: 0.2-0.25 μM, 0.25-0.3 μM, 0.3-0.35 μM, 0.35-0.4 μM, 0.4-0.45 μM, 0.45-0.5 μM, 0.5-0.55 μM, 0.55-0.6 μM. In a specific embodiment of the present application, the working concentration of the HCMV upstream primer and / or the HCMV downstream primer is 0.4 μM.

[0047] In some embodiments of the present application, the working concentration of the HCMV probe is 0.03-0.07 μM, based on the volume of the PCR reaction system. The working concentration of the HCMV probe is selected from any one of the following ranges: 0.03-0.04 μM, 0.04-0.05 μM, 0.05-0.06 μM, 0.06-0.07 μM. In a specific embodiment of the present application, the working concentration of the HCMV probe is 0.05 μM.

[0048] In some embodiments of the present application, the working concentration of the internal standard upstream primer and / or the internal standard downstream primer is 0.1-0.5 μM, based on the volume of the PCR reaction system. The working concentration of the internal standard upstream primer and / or the internal standard downstream primer is selected from any one of the following ranges: 0.1-0.15 μM, 0.15-0.2 μM, 0.2-0.25 μM, 0.25-0.3 μM, 0.3-0.35 μM, 0.35-0.4 μM, 0.4-0.45 μM, 0.45-0.5 μM. In a specific embodiment of the present application, the working concentration of the internal standard upstream primer and / or the internal standard downstream primer is 0.25 μM.

[0049] In some embodiments of the present application, the working concentration of the internal standard probe is 0.03-0.07 μM, based on the volume of the PCR reaction system. The working concentration of the internal standard probe is selected from any one of the following ranges: 0.03-0.04 μM, 0.04-0.05 μM, 0.05-0.06 μM, 0.06-0.07 μM. In a particular embodiment of the present application, the working concentration of the internal standard probe is 0.05 μM.

[0050] In the present application, the working concentration refers to the final concentration in the PCR reaction system.

[0051] In some embodiments of the present application, the detection kit further comprises a nucleic acid extraction reagent.

[0052] The nucleic acid extraction reagent is selected from nucleic acid extraction reagents based on silica gel membrane adsorption or magnetic bead method. In a particular embodiment of the present application, the nucleic acid extraction reagent is a nucleic acid extraction reagent based on silica gel membrane adsorption. For example, commercially available kit QIAamp DNA Mini Kit can be used. The nucleic acid extraction reagent includes lysis solution, washing solution and elution solution, etc.

[0053] In some embodiments of the present application, the detection kit further comprises a detection solution mixture A, which comprises PCR buffer, Mg 2+ , dNTP, Taq enzyme and other necessary components for PCR amplification.

[0054] The working concentration of Mg 2+ is 3 mM-6 mM, for example, the working concentration of Mg 2+ is selected from any one of the following ranges: 3 mM-4 mM, 4 mM-5 mM, 5 mM-6 mM. In a particular embodiment of the present application, the working concentration of Mg 2+ is 4.5 mM.

[0055] The working concentration of dNTP is 0.05 mM-0.25 mM, based on the volume of the PCR reaction system; for example, the working concentration of dNTP is selected from any one of the following ranges: 0.05 mM-0.1 mM, 0.1 mM-0.15 mM, 0.15 mM-0.2 mM, 0.2 mM-0.25 mM. In a particular embodiment of the present application, the working concentration of dNTP is 0.15 mM.

[0056] The working concentration of the Taq enzyme is 0.02-0.05 U / μL, based on the volume of the PCR reaction system; the working concentration of the Taq enzyme is selected from any one of the following ranges: 0.02-0.03 U / μL, 0.03-0.04 U / μL, 0.04-0.05 U / μL. In a specific embodiment of the application, the working concentration of the Taq enzyme is 0.0375 U / μL.

[0057] The application also provides a method for quantitatively detecting HCMV nucleic acid for non-diagnostic purposes, comprising the following steps: extracting DNA of the sample to be tested and the internal standard gene, and using the above-mentioned kit to detect nucleic acid.

[0058] The embodiments of the application are described below by way of specific examples, and those skilled in the art can easily understand other advantages and effects of the application from the disclosure of the specification. The application can also be implemented or applied by means of other different specific embodiments, and various modifications or changes can be made to the details in the specification based on different viewpoints and applications without departing from the spirit of the application.

[0059] Before further describing the specific embodiments of the application, it should be understood that the scope of protection of the application is not limited to the following specific embodiments; it should also be understood that the terms used in the embodiments of the application are for the purpose of describing the specific embodiments, rather than limiting the scope of protection of the application; in the specification and claims of the application, the singular forms "one", "an" and "this" include the plural forms, unless the context clearly indicates otherwise.

[0060] When the embodiments give numerical ranges, it should be understood that, unless otherwise stated by the application, each numerical range has two endpoints and any number between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the application have the same meaning as understood by those skilled in the art. In addition to the specific methods, devices, materials used in the embodiments, any method, device and material of the prior art similar or equivalent to those described in the embodiments of the application can also be used to implement the application according to the mastery of the prior art by those skilled in the art and the description of the application. Embodiment 1

[0061] This embodiment provides primer probe sequences for detecting HCMV and internal standards, and describes the detection method.

[0062] The target gene of HCMV is searched and downloaded through NCBI, the sequences are compared, the conserved segment is selected as the candidate target region, and the HCMV-specific amplification primer and probe are designed by using Beacon Designer software. The primer probe is synthesized by Yingwei Jie (Shanghai) Trade Co., Ltd., and the specific sequence is as follows: HCMV upstream primer: 5'-CACTGTCATCAGAATATATGATGTA-3' (SEQ ID NO: 6); HCMV downstream primer: 5'-GCGGTTGCTACTACTTTC-3' (SEQ ID NO: 7); HCMV probe: 5'-FAM-TCCTCACCATAGCCACC-BHQ-l-3' (SEQ ID NO: 8).

[0063] The primer and probe sequences of the internal standard are as follows: Internal standard upstream primer: 5'-CCTCATTCCCATGCCATC-3' (SEQ ID NO: 3); Internal standard downstream primer: 5'-GCGTTGGTTGAATGTAGTC-3' (SEQ ID NO: 4); Internal standard probe: 5'-HEX-CGCACCAGGACTGTCAA-BHQ-l-3' (SEQ ID NO: 5).

[0064] After the primer and probe dry powder arrives, according to the nucleic acid amount (or mole number) provided by the manufacturer, dissolve it with sterile nuclease-free water, prepare 20 μM, and then store it for use.

[0065] HCMV plasmid, synthesized by General Biosystems (Anhui) Co., Ltd., sequence as follows: CACTGTCATCAGAATATATGATGTATATTATTTCCTCCAAACTCCTCACCATAGCCACCAATTCGCATCACTTAAGAAAGTAGTAGCAACCGC (SEQ ID NO: 11).

[0066] After the HCMV plasmid dry powder arrives, dissolve it with 40 μL TE buffer to obtain the plasmid stock solution, then take an appropriate amount of stock solution, and dilute it 10 4 times with TE buffer. This solution is defined as the standard of the initial concentration; use the standard of the initial concentration as the first concentration, use TE buffer as the diluent, and perform serial 10-fold gradient dilution for 6 times, a total of 7 concentration gradient standard solution, which is used for subsequent real-time fluorescence quantitative PCR reaction, to draw the standard curve. Used for subsequent detection.

[0067] HCMV pseudovirus, synthesized by San Yoo Biomedicals (Shanghai) Co., Ltd., target sequence same as that of HCMV plasmid.

[0068] The internal standard is a phosphorothioate-modified fragment, synthesized by Shanghai Biotech Bioengineering Co., Ltd. The "*" in the sequence represents phosphorothioate modification between two bases. The two complementary sequences are as follows: Positive strand: 5'-A*T*C*T*G*ACCTCATTCCCATGCCATCTCTGCACCTCTCAACTGCCGCTGTTCAGTTGACAGTCCTGGTGCGCTGGTTTGACTACATTCAACCAACGCA*T*C*T*G*A-3' (SEQ ID NO: 9); Negative strand: 5'-T*C*A*G*A*TGCGTTGGTTGAATGTAGTCAAACCAGCGCACCAGGACTGTCAACTGAACAGCGGCAGTTGAGAGGTGCAGAGATGGCATGGGAATGAGGT*C*A*G*A*T-3' (SEQ ID NO: 10).

[0069] After the internal standard dry powder arrives, it is dissolved in sterile nuclease-free water to prepare a 20 μM stock solution, and then 10 9 times dilution is performed with TE buffer to obtain an initial working solution. Continue to dilute by 10 times to prepare a series of standard samples with different concentrations for subsequent detection.

[0070] The composition of the detection mixture is shown in Table 1:

[0071] Detection: 20 μL of the detection mixture was aliquoted into PCR tubes, and 20 μL of the sample to be tested, including HCMV plasmid gradient solution and internal standard gradient solution, was added to each well. After centrifugation and mixing, a total reaction system of 40 μL of PCR reaction solution was obtained. The reaction tube was placed on a real-time fluorescence quantitative PCR instrument, and PCR amplification was performed according to the following program (Table 2), and the fluorescence signal was collected at 60°C. The reaction system was 40 μL.

[0072]

[0073] The detection peak shapes of HCMV and internal standard are shown in Figure 1 and Figure 2 The corresponding detection Ct values are shown in Tables 3 and 4. It can be seen that the amplification efficiencies of the two are 95.53% and 95.72%, respectively, and the difference in efficiency is only 0.19%. The results show that the amplification efficiencies of HCMV and internal standard in this detection system are close to the ideal value (100%), and the amplification kinetics behavior is highly consistent, meeting the requirements for using internal standard quantification.

[0074]

[0075] Example 2

[0076] This example evaluates the stability of HCMV pseudovirus, HCMV plasmid and phosphorothioate modified internal control gene fragment at different temperatures.

[0077] Experimental method: HCMV pseudovirus, HCMV plasmid and phosphorothioate modified internal control gene were aliquoted into centrifuge tubes and stored in constant temperature incubators at -20°C, 4°C, 25°C, 37°C and 45°C, respectively. At different time points, one tube was taken out and the three replicate wells were extracted using QIAamp DNA Mini Kit (Cat. No. 51306, QIAGEN, the specific operation steps were carried out according to the use method in the instruction manual). The detection mixture was prepared (same as Example 1) and PCR detection was carried out according to the steps in Example 1. The mean value of the three replicate wells was calculated, and the Ct mean value detected at each temperature was plotted. The Ct mean value detected at the first time (0 day) was taken as the reference, and ±0.5 Ct was the normal fluctuation range.

[0078] As shown in Table 5, the results of HCMV pseudovirus stability showed that when stored at 5 temperatures, the Ct value detected gradually increased with the increase of storage temperature and storage time. This is because the pseudovirus is unstable at high temperature and is prone to degradation, resulting in a decrease in its concentration. The stability trend chart is shown in Figure 3 .

[0079]

[0080] As shown in Table 6, unlike HCMV pseudovirus, the results of HCMV plasmid stability showed that when stored at 5 temperatures, the higher the storage temperature, the longer the storage time, and the Ct value gradually decreased, while the lower the storage temperature, the Ct value gradually increased. The stability trend chart is shown in Figure 4 , which is because the commercially available plasmid DNA is usually a mixture of 3 conformations (supercoiled, linear and open circle). The amplification efficiency of different conformations in PCR is different. With the change of storage temperature, different conformations are transformed into each other, which may lead to the change of amplification efficiency, and finally lead to the difference of detected Ct value.

[0081]

[0082] As shown in Table 7 and Figure 5As shown, the stability results of the phosphorothioate-modified internal standard gene fragment showed that the detected Ct values were still within the quality control range after 90 days at 5 temperatures, indicating that it was not sensitive to temperature stress and had better chemical stability than the HCMV pseudovirus and plasmid, and was more suitable as a long-term quantitative reference material.

[0083] Example 3

[0084] This example provides the preparation of the internal standard reference material for quantification and its value traceability.

[0085] 3.1 Determination of the working concentration of the internal standard primary reference (IS) 1) Mix the two phosphorothioate-modified strands, i.e. the positive strand and the negative strand, at the same concentration, and anneal to form a double-stranded internal standard; 2) Take 5 μL of the double-stranded internal standard solution and add it to 200 μL of negative plasma, and use the QIAamp DNA Mini Kit to extract the nucleic acid; 3) Use the extracted nucleic acid as a template, and perform real-time fluorescent PCR detection according to the method of Example 1; 4) According to the detected Ct value, select an appropriate dilution factor to dilute the initial internal standard solution, to ensure that the final working concentration has a Ct value within the range of 26±0.5.

[0086] 3.2 Quantitative traceability operation 3.2.1 Preparation of co-extraction samples 1) Trace the concentration to the 1st WHO International Standard for Human Cytomegalovirus (HCMV) (NIBSC code 09 / 162), and dissolve the HCMV international standard in water to obtain a solution with a concentration of 5×10 6 IU / mL; 2) Take 100 μL of the solution and dilute it 10-fold with negative plasma, and mix well for use; 3) Take another 200 μL of the diluted standard, add 5 μL of the internal standard primary reference (IS), and mix well to prepare a co-extraction sample.

[0087] 3.2.2 Nucleic acid extraction and detection 1) Use the QIAamp DNA Mini Kit to extract nucleic acid from the co-extraction sample described above, with 3 replicate wells for each sample; 2) Extract another 4 solutions of 10-fold gradient-diluted HCMV plasmid nucleic acid with known copy number concentration as a standard curve; 3) Take 20 μL of nucleic acid from the co-extracted sample and plasmid standard, add them to 20 μL of detection mixture, and perform real-time fluorescence PCR detection.

[0088]

[0089]

[0090] 3.3 Quantitative Traceability Methods 1) Using the concentration Log of HCMV plasmid standard 10 The values ​​are on the x-axis, assuming the concentration of the four standards is 1 × 10⁻⁶. 8 IU / mL, 1×10 7 IU / mL, 1×10 6 IU / mL, 1×10 5 IU / mL, corresponding concentration Log 10 The values ​​are 8, 7, 6, and 5. The measured Ct value is the ordinate. A linear regression equation (standard curve) is established, yielding y = -3.329x + 45.721. 2) Calculate the intercept of the standard curve: Keeping the slope constant, substitute the Log value (5.69897) of the known concentration of the international standard and the measured average Ct value into the regression equation to calculate the intercept of the linear regression equation as 44.832. 3) Correcting the standard curve: Correcting the intercept in the original regression equation to obtain the source-corrected standard curve y = -3.329x + 44.832; 4) Substitute the measured average Ct value of the internal standard primary reference (IS) into the calibrated standard curve to infer its concentration, and the final value is determined to be 4.51 × 10⁻⁶. 5 IU / mL.

[0091] The specific Ct values ​​for HCMV international standard and internal standard primary reference (IS) are shown in Table 8, and the peak shapes are shown in [the table below]. Figure 6 The HCMV standard curve is shown below. Figure 7 The specific Ct values ​​are shown in Table 9. The final calculated concentration of the internal standard primary reference (IS) is 4.51 × 10⁻⁶. 5 IU / mL. Example 4

[0092] This embodiment provides a comparison between the internal standard method and the standard curve method to verify the accuracy of the internal standard method in the quantitative detection of HCMV in complex biological matrices.

[0093] A known concentration of HCMV sample (1.06E+07 IU / mL) was diluted by 10 times gradient with negative human plasma and negative human serum respectively, and 5 concentration gradients (HCMV-1~ HCMV-5) were prepared. 200 μL of each concentration was taken, 5 μL of internal standard working solution with known concentration and completed value traceability was added, and the sample was extracted by QIAamp DNA Mini Kit. Three duplicate wells were extracted for each concentration, and the standard curve method and internal standard quantitative method were used for value analysis of all samples, and the difference between the values of the two methods was compared.

[0094] The calculation formula of internal standard quantitative method is as follows:

[0095] Y = -0.3 * (Ct - Ct 样 Y refers to the concentration value of HCMV, Y 内 refers to the concentration value of internal standard, Ct 样 refers to the detection Ct value of HCMV, Ct 内 refers to the detection Ct value of internal standard.

[0096]

[0097]

[0098] The Ct values of standard curve quantitative and internal standard quantitative are shown in Table 10, and the corresponding peak shape diagram is shown in Figure 8 The difference between the two quantitative methods in human plasma and human serum matrix is shown in Table 10. It can be seen that the average difference of human plasma matrix is -0.04 log 10 , and the average difference of human serum is -0.12 log 10 . The absolute value of the difference between the two is obviously less than the acceptable range of ±0.5 log 10 in clinical virology quantification. Therefore, it can be considered that the HCMV internal standard quantitative method established in the application has equivalent quantitative accuracy with the recognized standard curve quantitative method, and can realize accurate quantification of HCMV virus in different biological matrices. Example 5

[0099] This example provides the quantitative effect of the constructed internal standard quantitative method in clinical samples.

[0100] 25 HCMV positive samples were collected from the hospital, 200 μL of each sample was taken, 5 μL of internal standard working solution with known concentration was added, and nucleic acid extraction was performed by QIAamp DNA Mini Kit. Four HCMV calibrators were extracted to establish a standard curve, and real-time fluorescence quantitative PCR analysis was performed using the detection system of Example 1.

[0101] The standard curve method and the internal standard quantification method were used to determine the values of all samples, and the differences between the two methods were compared. The formula for internal standard quantification is:

[0102] where Y 样 represents the concentration value of HCMV, Y 内 represents the concentration value of the internal standard, Ct 样 represents the detection Ct value of HCMV, Ct 内 represents the detection Ct value of the internal standard.

[0103] Standard curve method: The concentration was calculated according to the regression equation (y = -3.312x + 45.418) established by the standard.

[0104] The results of the detection are shown in Table 12. The differences between the results of internal standard quantification and standard curve quantification are within ±0.5 log 10 .

[0105] To comprehensively evaluate the consistency of the two methods, Bland-Altman analysis and regression analysis were performed. Figures 9-10 The Bland-Altman analysis results show that the mean difference between the two methods is -0.01, and the 95% confidence interval (CI) contains 0, indicating that there is no significant systematic bias, and the upper and lower limits of LoA are less than ±0.5 log 10 . The regression analysis results show that the 95% confidence interval of the intercept is (-0.3287, 0.0448), which contains 0, indicating that there is no constant bias; the 95% confidence interval of the slope is (0.9908, 1.0588), which contains 1, indicating that there is no proportional bias. Therefore, based on the results of Bland-Altman and regression analysis, when quantitatively detecting HCMV clinical samples, the internal standard quantification method and the standard curve quantification method are highly consistent, and there is no significant statistical bias. Therefore, in clinical detection practice, the two methods can be used interchangeably. Moreover, the internal standard quantification method does not need to rely on the standard curve of each experiment, and the operation is more convenient, especially suitable for rapid and accurate quantification of single sample or small amount of sample.

[0106]

[0107] The above examples are intended to be illustrative and not exclusive, and are not intended to limit the scope of the application. Furthermore, various modifications to the above-described embodiments will be apparent to one skilled in the art in view of the above teachings, and such modifications are intended to be within the scope of the present application. It should be understood that changes can be made in the order of steps and / or the arrangement of steps without departing from the scope and spirit of the application. Although the application has been described in conjunction with specific preferred embodiments thereof, it will be understood that no limitation of the scope of the application is actually intended. It is anticipated that alterations and modifications will occur to others upon reading and understanding the detailed description thereof. It is intended to define the scope of the application only by the appended claims.

Claims

1. An internal standard gene for the quantitative detection of HCMV nucleic acid, characterized in that, The internal standard gene includes a core sequence and flanking sequences at both ends of the core sequence. The oligonucleotide backbone of the flanking sequences is modified with phosphate thioester. The nucleotide sequence of the core sequence is shown in SEQ ID NO.

1.

2. The internal standard gene according to claim 1, characterized in that, Includes one or more of the following characteristics: 1) The length of the flanking sequence is n nucleotides, where n ≥ 3; 2) The nucleotide sequence of the flanking sequence is any arrangement of A, T, C, and G; preferably, the nucleotide sequence of the flanking sequence is as shown in SEQ ID NO:2; 3) The flanking sequences at both ends are independent of each other in length or nucleotide sequence.

3. A detection primer and detection probe for detecting the internal standard gene as described in claim 1 or 2, characterized in that, The detection primers include an internal standard upstream primer as shown in SEQ ID NO.3 and an internal standard downstream primer as shown in SEQ ID NO.4; the detection probe also includes an internal standard probe as shown in SEQ ID NO.

5.

4. The detection primers and detection probes according to claim 3, characterized in that, One end of the internal standard probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group; preferably, the fluorescent reporter group is selected from one or more of FAM, HEX, TET, ROX, and JOE; preferably, the fluorescent quencher group is selected from one or more of ECLIPSE, DABCYL, BHQ-1, BHQ-2, and BHQ-3.

5. A detection substance for HCMV, characterized in that, The detection substance includes the internal standard gene as described in claim 1 or 2, the detection primers and detection probes as described in claim 3 or 4, and the detection primers and detection probes that specifically recognize HCMV nucleic acid. The detection primers that specifically recognize HCMV nucleic acid include the HCMV upstream primer as shown in SEQ ID NO. 6 and the HCMV downstream primer as shown in SEQ ID NO.

7. The detection probes that specifically recognize HCMV nucleic acid also include the HCMV probe as shown in SEQ ID NO.

8.

6. The detection substance according to claim 5, characterized in that, One end of the HCMV probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group; preferably, the fluorescent reporter group of the HCMV probe is FAM, and the fluorescent quencher group is BHQ-1.

7. Use of the HCMV detection substance as described in claim 5 or 6 in the preparation of HCMV detection products.

8. A kit for detecting HCMV, characterized in that, The kit includes the detection substance for HCMV as described in claim 5 or 6.

9. The reagent kit according to claim 8, characterized in that, Includes one or more of the following characteristics: A) Based on the volume of the PCR reaction system, the working concentration of the HCMV upstream primer and / or HCMV downstream primer is 0.2~0.6 μM; B) Based on the volume of the PCR reaction system, the working concentration of the HCMV probe is 0.03~0.07 μM; C) Based on the volume of the PCR reaction system, the working concentration of the internal standard upstream primer and / or the internal standard downstream primer is 0.1~0.5 μM; D) Based on the volume of the PCR reaction system, the working concentration of the internal standard probe is 0.03~0.07 μM; E) It also includes nucleic acid extraction reagents; preferably, the nucleic acid extraction reagents are selected from nucleic acid extraction reagents based on silica membrane adsorption or magnetic bead methods; F) also includes detection solution mixture A; preferably, the detection solution mixture A includes PCR buffer, Mg 2+ One or more of dNTPs or Taq enzymes.

10. A method for quantitative detection of HCMV nucleic acid for non-diagnostic purposes, characterized in that, Includes the following steps: DNA is extracted from the sample to be tested and the internal standard gene, and nucleic acid detection is performed using the kit described in claim 8 or 9.

Images