Application of GJC1 gene as target spot in neuroblastoma resistance

Abstract

The invention discloses application of a GJC1 gene as a target spot in resisting neuroblastoma, and relates to the field of biological medicines. In-vitro and in-vivo experiments show that the GJC1 gene can be used as a therapeutic target of neuroblastoma, and growth of the tumor can be obviously inhibited by inhibiting, interfering or silencing gene expression. The invention provides a new treatment thought or means for the treatment of neuroblastoma.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically, to the application of the GJC1 gene as a target in the treatment of neuroblastoma. Background Technology

[0002] Neuroblastoma (NB) is the most common malignant solid tumor in the abdomen of children, often referred to as the "king of childhood cancers." NB exhibits strong heterogeneity, high malignancy, and a high rate of recurrence and metastasis. Previous studies have suggested that NB originates from undifferentiated neural crest cell lines; elucidating the developmental origin of NB tumor cells will contribute to a deeper understanding of NB. Summary of the Invention

[0003] The purpose of this invention is to provide the application of the GJC1 gene as a target in the treatment of neuroblastoma, thereby providing a new therapeutic approach or method for the treatment of neuroblastoma.

[0004] This invention is implemented as follows:

[0005] On the one hand, the present invention provides the application of the GJC1 gene as a target in the preparation or screening of antitumor drugs, wherein the tumor is neuroblastoma.

[0006] GJC1, also known as CX45, is a gene located on chromosome 17q21.31. The protein it encodes, Cx45, is a member of the gap junction protein family and is involved in the formation of gap junctions between cells.

[0007] This invention is the first to discover that GJC1 is upregulated in UCHC-like phenotype cells, suggesting that GJC1 may represent a poorly differentiated and highly proliferating subpopulation of NB tumor cells. Subsequent analysis of the public datasets GSE49710 and GSE45547 revealed that GJC1 expression is upregulated in stage 4, MYCN amplified, and high-risk patients, with patients in the high-GJC1 expression group showing significantly poorer prognosis.

[0008] This invention further reveals through in vitro and in vivo experiments that the GJC1 gene can serve as a therapeutic target for neuroblastoma. By inhibiting, interfering with, or silencing the expression of this gene, the growth of the tumor can be significantly suppressed. This invention provides a new therapeutic approach or method for the treatment of neuroblastoma.

[0009] Optionally, in some embodiments of the present invention, the antitumor drug targets the GJC1 gene to inhibit, interfere with, or silence its expression.

[0010] Secondly, the present invention provides the use of molecules or reagents that inhibit, interfere with, or silence the GJC1 gene in the preparation of antitumor drugs, wherein the tumor is neuroblastoma.

[0011] Optionally, in some embodiments of the present invention, the molecule or reagent is selected from 18α-glycyrrhetinic acid and glycyrrhetinic acid.

[0012] Optionally, in some embodiments of the present invention, the molecule or reagent is siRNA or shRNA.

[0013] Based on the content provided in this invention, those skilled in the art can use conventional techniques in the field to design siRNA or shRNA that can inhibit, interfere with, or silence the GJC1 gene.

[0014] Optionally, in some embodiments of the present invention, the molecule or reagent is shRNA.

[0015] Optionally, in some embodiments of the present invention, the target sequence of shRNA is any one of SEQ ID NO.1-3.

[0016] SEQ ID NO.1:GCTGTGAGAATGTCTGTTATG

[0017] SEQ ID NO.2:GCTGTCAAACCAGATCAATC

[0018] SEQ ID NO.3:GCAAATTCTACCCTGGCTTTA

[0019] It should be noted that any other molecules that target, inhibit, interfere with, or silence this gene are within the scope of protection of this invention.

[0020] Thirdly, the present invention provides a method for screening antitumor drugs in vitro, comprising: contacting the drug to be screened with tumor cells in vitro; if the proliferation of the tumor cells is inhibited, the drug to be screened is indicated as a candidate drug.

[0021] The drugs to be screened target the GJC1 gene to inhibit, interfere with, or silence its expression.

[0022] The tumor cells are neuroblastoma cells.

[0023] Fourthly, the present invention provides a drug for treating neuroblastoma, wherein the drug targets the GJC1 gene to inhibit, interfere with, or silence its expression.

[0024] Optionally, in some embodiments of the present invention, the medicament further includes pharmaceutically acceptable excipients.

[0025] Fifthly, the present invention provides a method for treating neuroblastoma by applying the drug as described above to the subject to be treated. Attached Figure Description

[0026] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 Screening of UCHC-like characteristic genes and GJC1 expression. A. Bubble chart of GO analysis results for UCHC-like characteristic genes, with blue markings for 6 non-cell cycle-related GO functions and red arrows indicating GO functions enriched in GJC1. B. t-SNE plot of distribution of UCHC-like and DCHC-like phenotype tumor cells. C. Expression of GJC1 and NTRK1, where NTRK1 is a marker of NB tumor cell differentiation. D. Box plot of GJC1 expression in UCHC-like and DCHC-like phenotype tumor cells, with p-values ​​calculated using the Wilcoxon rank-sum test. ****, p < 0.0001.

[0028] Figure 2 Correlation analysis was performed on GJC1 and MKI67. Scatter plots were generated showing the correlation between GJC1 and MKI67 expression in datasets GSE45547 and GSE49710. Pearson correlation analysis was used to calculate p-values.

[0029] Figure 3 Correlation analysis was performed between GJC1 expression and clinical characteristics of neonatal nephropathy (NB). The correlation between GJC1 expression and MYCN amplification status, INSS stage, and NB risk stratification in datasets GSE45547 and GSE49710 was analyzed. ANOVA was used to calculate p-values. All p-values ​​were <0.001.

[0030] Figure 4 Prognostic analysis was performed using public databases. Kaplan-Meier survival curves were obtained for prognostic analysis of GJC1 high and low expression groups in the GSE45547 and GSE49710 datasets. The log-rank test was used to calculate the p-value. OS: overall survival; EFS: event-free survival.

[0031] Figure 5Figure 1 shows the qPCR and WB results for GJC1 expression detection in stable transgenic cells. Left: Bar chart of relative GJC1 expression levels in different stable transgenic cells. Student's t-test was used to calculate the p-value. Right: GJC1 protein expression levels in different stable transgenic cells. over-NC: Overexpression control cell line; over-GJC1: GJC1 overexpression cell line; sh-NC: Expression knockdown control cell line; sh-GJC1: GJC1 expression knockdown cell line.

[0032] Figure 6 CCK8 cell proliferation curves. Curves showing the change in cell number over time for different stable cell lines. Student's t-test was used to calculate p-values. h: hours. over-NC: overexpression control cell line; over-GJC1: GJC1 overexpression cell line; sh-NC: expression knockdown control cell line; sh-GJC1: GJC1 expression knockdown cell line; ****, p<0.0001.

[0033] Figure 7 The effect of altered GJC1 expression on cell proliferation was detected using EdU assay. Left: Fluorescence results of EdU assay for each stable cell line. Right: Histogram of results for each stable cell line. Student's t-test was used to calculate p-values. over-NC: Overexpression control cell line; over-GJC1: GJC1 overexpression cell line; sh-NC: Knockdown control cell line; sh-GJC1: GJC1 knockdown cell line.

[0034] Figure 8 Figure 1 shows the Transwell assay results. The migration and invasion assays for each stable transfected cell line are presented, with histograms showing the number of cells that crossed the Transwell chamber in each group. Student's t-test was used to calculate the p-value. over-NC: overexpression control cell line; over-GJC1: GJC1 overexpression cell line; sh-NC: expression knockdown control cell line; sh-GJC1: GJC1 expression knockdown cell line. **, p < 0.01. ***, p < 0.001.

[0035] Figure 9 Results of subcutaneous xenograft models. A. Size of subcutaneous xenograft models in nude mice in the GJC1 overexpression group and overexpression control group on day 21. B. Size of subcutaneous xenograft models in nude mice in the GJC1 knockdown group and knockdown control group on day 21. Student's t-test was used to calculate p-values. **, p < 0.01. ***, p < 0.001. C. HE staining (10X) and Ki67 immunohistochemical staining results (20X) of subcutaneous tumor tissue from the four groups of nude mice.

[0036] Figure 10 In vivo experiments for the application of GJC1 inhibitors. A. Size of subcutaneous tumors on day 21 in the GJC1 inhibitor experiment. Student's t-test was used to calculate p-values. ***, p<0.001. B. HE staining (10X) and Ki67 immunohistochemical staining results (20X) of subcutaneous tumor tissue from nude mice. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0038] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0039] Example 1

[0040] Identification of UCHC-like phenotypic characteristic genes in NB tumor cells.

[0041] In NB tumor single-cell data, similarity analysis with developing cells allows NB tumor cells to be classified into two phenotypes: UCHC-like and DCHC-like. This embodiment identifies the characteristic genes of the UCHC-like phenotype from the NB tumor single-cell data. First, cell cycle-related genes were removed from the UCHC-like phenotype characteristic genes. Then, the percentage difference in cell expression of all characteristic genes was calculated, and the top 50 genes with the highest percentage differences were selected for GO enrichment analysis. Figure 1 A). The enriched functions were mainly concentrated in cell cycle regulatory pathways such as DNA replication / repair and chromosome replication, all consistent with the active proliferation capacity of the UCHC-like phenotype; six non-cell cycle-related GO functions were enriched, among which only the GJC1 gene was enriched twice. Further examination of GJC1 expression was conducted ( Figure 1 B, C, D) revealed that GJC1 was significantly overexpressed in tumor cells with a UCHC-like phenotype (p<0.0001).

[0042] Example 2

[0043] Clinical correlation analysis between GJC1 and NB.

[0044] This embodiment further verifies the possible role of GJC1 in NB. Using the GSE45547 and GSE49710 datasets, this embodiment verifies the correlation between GJC1 expression and the expression of the cell proliferation marker MKI67. The results show that GJC1 expression is positively correlated with MKI67 expression. Figure 2This indicates that GJC1 is closely related to the proliferative capacity of NB. Next, the correlation between GJC1 and the clinical characteristics of NB was analyzed in these two datasets. Figure 3 As can be seen, in the GSE45547 dataset, GJC1 was significantly highly expressed in stage 4 patients and patients with MYCN amplification. In the GSE49710 dataset, GJC1 was also significantly highly expressed in both patient groups, and also significantly highly expressed in the high-risk COG group. Prognostic analysis results from both datasets showed that patients in the GJC1 high-expression group had significantly worse event-free survival and overall survival. Figure 4 This indicates that GJC1 plays a role in promoting tumor development in NB.

[0045] Example 3

[0046] In vitro experiments revealed that GJC1 promotes the progression of NB tumors.

[0047] To verify the potential biological function of GJC1 in NB, this embodiment used lentiviral transfection technology to construct a stable GJC1 overexpression cell line and a stable GJC1 knockdown cell line in the NB tumor cell line SK-N-Be(2)-C. qPCR and WB results showed that both the stable GJC1 overexpression cell line and the stable GJC1 knockdown cell line were successfully constructed. Figure 5 ).

[0048] After establishing a stable cell line, this example first used the CCK8 assay to verify the effect of GJC1 expression on the in vitro proliferation of NB tumor cells. The results showed that increased GJC1 expression enhanced the proliferation of NB tumor cells; conversely, decreased GJC1 expression weakened the proliferation of NB tumor cells. Figure 6 The cell proliferation levels of GJC1-overexpressing cells, GJC1-knockdown cells, and two empty vector control cell lines were further detected using the EdU kit. Figure 7 Experiments showed that overexpression of GJC1 significantly enhanced cell proliferation, while knockdown of GJC1 inhibited cell proliferation. The results of the CCK8 and EdU assays both validated the conclusion in Example 3.3.1 that tumor cells with high GJC1 expression had stronger proliferative capacity.

[0049] Subsequently, to verify whether interfering with GJC1 expression has other effects on NB tumor cells, this embodiment used a Transwell assay to detect changes in the migration and invasion abilities of NB tumor cells. Figure 8 Experimental results showed that knocking down GJC1 significantly reduced the migration and invasion abilities of tumor cells. Conversely, overexpression of GJC1 enhanced the migration and invasion abilities of tumor cells. This further clarified the important role of GJC1 in the progression of NB tumors.

[0050] Example 4

[0051] In vivo experiments verified that GJC1 promotes NB tumor growth.

[0052] After demonstrating the crucial role of GJC1 gene expression in the proliferation, migration, and invasion of NB tumor cells in in vitro experiments, this embodiment further constructed a nude mouse subcutaneous xenograft model to verify the effect of altered GJC1 expression on the in vivo growth and proliferation of NB tumor cells.

[0053] The results showed that the subcutaneous tumor growth rate in the GJC1 overexpression group was significantly higher than that in the control group, and the average tumor volume after 21 days was significantly larger than that in the control group (p<0.01). Figure 9 A); however, the growth rate and mean tumor volume were significantly reduced in the GJC1 knockdown group (p<0.001). Figure 9 B). IHC staining of tumor tissues from the xenograft model revealed that, compared to the control group, Ki67, representing cell proliferation capacity, was significantly increased in the GJC1 overexpression group and significantly decreased in the GJC1 knockdown group. Figure 9 C). It is evident that enhancing GJC1 expression can significantly upregulate the proliferation of NB tumor cells in vivo, while interfering with GJC1 expression can significantly weaken the proliferation of NB tumor cells in vivo.

[0054] Example 5

[0055] In vivo experiments verified that GJC1 promotes NB tumor growth

[0056] After demonstrating the crucial role of GJC1 gene expression in the proliferation, migration, and invasion of NB tumor cells in in vitro experiments, this embodiment further constructed a nude mouse subcutaneous xenograft model to verify the effect of altered GJC1 expression on the in vivo growth and proliferation of NB tumor cells.

[0057] The results showed that the subcutaneous tumor growth rate in the GJC1 overexpression group was significantly higher than that in the control group, and the average tumor volume after 21 days was significantly larger than that in the control group (p<0.01). Figure 9 A); however, the growth rate and mean tumor volume were significantly reduced in the GJC1 knockdown group (p<0.001). Figure 9 B). IHC staining of tumor tissues from the xenograft model revealed that, compared to the control group, Ki67, representing cell proliferation capacity, was significantly increased in the GJC1 overexpression group and significantly decreased in the GJC1 knockdown group. Figure 9 C). It is evident that enhancing GJC1 expression can significantly upregulate the proliferation of NB tumor cells in vivo, while interfering with GJC1 expression can significantly weaken the proliferation of NB tumor cells in vivo.

[0058] Example 6

[0059] Application of GJC1 inhibitors in NB treatment

[0060] The above results suggest that GJC1 significantly promotes NB growth, proliferation, migration, and invasion, and may be a potential therapeutic target for NB. Therefore, this embodiment aims to verify the potential application value of GJC1 inhibitors in NB treatment through in vivo experiments.

[0061] This embodiment used two GJC1 inhibitors (18α-glycyrrhetinic acid and glycyrrhetinic acid) to treat a nude mouse subcutaneous xenograft model. Figure 10 The results showed that when the drug was administered via gavage starting on day 7 post-tumor transplantation, the tumor volume in both drug groups was significantly smaller than that in the control group by day 21. IHC staining also revealed a significant downregulation of Ki67 expression in both drug groups. Therefore, GJC1 inhibitors can significantly inhibit the growth and proliferation of neonatal nephropathy (NB) tumors in vivo, making them promising therapeutic agents for NB.

[0062] In summary, the embodiments of this invention first discovered that GJC1 expression is upregulated in UCHC-like phenotype cells, suggesting that GJC1 may represent a poorly differentiated and highly proliferating cell subpopulation in NB tumor cells. Subsequently, analysis of the public datasets GSE49710 and GSE45547 revealed that GJC1 expression is upregulated in stage 4, MYCN amplified, and high-risk patients, with patients in the high GJC1 expression group exhibiting significantly poorer prognosis.

[0063] Subsequently, to verify the molecular function of GJC1 in NB, this invention constructed GJC1 overexpression and knockdown stable transgenic cell models in NB tumor cells. It was found that interfering with or enhancing GJC1 expression significantly inhibited and enhanced cell proliferation, respectively. The results of the in vivo model further confirmed the effect of GJC1 expression on the growth and proliferation of NB tumor cell lines. Furthermore, Transwell assays also confirmed that high GJC1 expression promotes the migration and invasion of NB tumor cells. All these findings suggest that GJC1 plays a role in promoting tumor progression in NB.

[0064] Using a nude mouse subcutaneous xenograft model, the above examples showed that GJC1 inhibitors can inhibit the growth of NB tumor cells in the mouse model and exert a significant anti-tumor effect, providing preclinical evidence to support the application of GJC1 inhibitors in NB treatment.

[0065] In summary, the embodiments of the present invention have identified GJC1, a key differentially expressed gene associated with NB proliferation, in the UCHC-like phenotypic characteristic genes of NB. In vivo and in vitro experiments have verified that GJC1 can significantly promote NB tumor progression, and GJC1 inhibitors can significantly inhibit NB tumor growth in mice, suggesting that GJC1 is a promising potential therapeutic target in NB patients.

[0066] Materials and methods used in the above embodiments:

[0067] I. Materials and Methods

[0068] 1. Materials

[0069] (I) Cell lines

[0070] The cell lines used in this study were the 293T cell line and the NB tumor cell line SK-N-BE(2)-C, both purchased from the Cell Bank of the Chinese Academy of Sciences. The cell types were identified by short tandem repeat sequence analysis and the mycoplasma test was negative.

[0071] (II) Laboratory Animals

[0072] The experimental animals used in this embodiment were SPF-grade female Balb / c nude mice, 4-6 weeks old, purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd. All animal experiments complied with laboratory animal ethics and were approved by the Ethics Committee of the Children's Hospital Affiliated to Fudan University.

[0073] (III) Public datasets are shown in Table 1.

[0074] Public datasets used in Table 1

[0075]

[0076] 2 methods

[0077] (I) Extraction of UCHC-like phenotypic characteristic genes

[0078] Differential analysis of UCHC-like and DCHC-like tumor cells was performed using the one-sided Wilcoxon rank-sum test in Seurat, after removing cell cycle-related genes from the UCHC-like phenotypic characteristic genes. Subsequently, the percentage of differentially expressed cells was calculated and ranked.

[0079] The percentage of differentially expressed gene A in cell populations = (Percentage of gene A expression in UCHC-like phenotype tumor cells - Percentage of gene A expression in DCHC-like phenotype tumor cells) / Percentage of gene A expression in UCHC-like phenotype tumor cells.

[0080] (II) Gene Ontology (GO) Analysis

[0081] The R software clusterProfiler was used to perform enrichment analysis of the biological process (BP) pathway in the GO pathway on the top 50 genes in the UCHC-like phenotypic characteristic genes, and p<0.05 and q<0.05 were set as screening conditions in the results.

[0082] (III) Gene Expression Correlation Analysis

[0083] Gene expression correlation analysis and plotting were performed using the R package ggstatsplot. The input data consisted of the expression levels of GJC1 and MKI67 genes for each sample in the datasets GSE45547 and GSE49710. The correlation was calculated using the Pearson correlation coefficient.

[0084] (iv) Expression and prognostic analysis of GJC1 in public database

[0085] The R2 platform was used to analyze the correlation between gene expression in NB and overall patient survival, event-free survival and clinical characteristics (INSS stage, MYCN amplification status and risk stratification).

[0086] (V) Cell Culture

[0087] The cell culture conditions used in the previous examples are shown in Table 2. During culture, the medium was changed every 2 to 3 days; the cells were passaged when the cell density reached about 80%; and the frozen cells were stored in a liquid nitrogen tank.

[0088] Table 2 Cell Culture Conditions

[0089]

[0090] * Bispecific antibiotics: penicillin / streptomycin solution

[0091] (VI) Construction of stable cell lines

[0092] (1) Plasmid construction: The overexpression plasmid and interference plasmid for GJC1 were constructed and purified by Suzhou Fubai'ao Company. The overexpression plasmid vector for GJC1 was FV117 (CMV-MCS-Ubi-Luc2-IRES-Puro). The interference plasmid vector for GJC1 was FV097 (U6-MCS(AE)-Ubi-Luc2-MT-IRES-Puro); the interfering RNA used was shRNA, and its target sequence targeting the GJC1 gene is as follows:

[0093] SEQ ID NO.1:GCTGTGAGAATGTCTGTTATG

[0094] SEQ ID NO.2:GCTGTCAAACCAGATCAATC

[0095] SEQ ID NO. 3:GCAAATTCTACCCTGGCTTTA.

[0096] (2) Virus Packaging and Collection: 293T cells in logarithmic growth phase were seeded in 10cm cell culture dishes. When the cell density reached approximately 60%-70%, the medium was changed to prepare for the virus packaging experiment. First, the target gene plasmid, helper plasmid, and PEI infection aid were added to 500μl of serum-free Opti-MEM medium. After gentle and thorough mixing, the medium was incubated at room temperature for 30 minutes. After incubation, the suspension was gently added dropwise to the 293T cell culture medium and the cells were incubated for 12-24 hours. The medium was then changed with complete medium. 48 hours after the medium change, the fluorescence in the 293T cells was observed under a fluorescence microscope. The cell supernatant was collected into a centrifuge tube, centrifuged at 1000rpm for 5 minutes, and the precipitate was discarded. The supernatant was aspirated using a 20ml syringe, passed through a 0.45μm filter into an ultrafiltration tube, and centrifuged at 4000rpm for 45 minutes. The concentrated virus solution was collected into a 1.5ml EP tube and stored at -80℃.

[0097] (3) Lentiviral transfection and selection: SK-N-BE(2)C cells were seeded in 6-well plates. When the cells reached a density of 70%-80%, Polybrene and 50 μl of virus solution were added at a ratio of 1:1000 for viral transfection. The medium was changed after 24 hours. Cell fluorescence was observed under a fluorescence microscope 48-72 hours after viral infection. After the cell density reached 80%, the cells were passaged and the culture medium was changed to cell culture medium containing puromycin. Viral transfection was considered successful when the uninfected cells died completely. At this time, the cells were cultured normally to stabilize the transfected line, and RNA and protein were extracted to detect GJC1 expression. The cell line with the highest overexpression / knockdown level was selected for subsequent experiments.

[0098] (vii) Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

[0099] (1) Cell RNA extraction (using a 6cm cell culture dish as an example): Discard the cell culture medium, gently wash with PBS, add 1ml Trizol to lyse the cells and pipette thoroughly, place on ice for 5 minutes to lyse; collect the lysate into a 1.5ml EP tube, centrifuge at 12000g, 4℃ for 5 minutes, collect the supernatant; add 200μl chloroform and mix well, place on ice for 5 minutes; then centrifuge at 12000g, 4℃ for 5 minutes, transfer the upper aqueous phase to a new 1.5ml EP tube, add 0.5ml pre-cooled isopropanol and mix thoroughly, place on ice for 10 minutes; then centrifuge at 12000g, 4℃ for 10 minutes, discard the supernatant, add 1ml 75% ethanol, repeatedly pipette to precipitate; continue centrifuging at 12000g, 4℃ for 10 minutes, discard the supernatant, and after the precipitate dries at room temperature, add 50μl DEPC water to dissolve the RNA precipitate, and detect the RNA quality and concentration.

[0100] (2) Reverse transcription: Prepare a 20 μl reverse transcription reaction system according to Table 4; set the reverse transcription reaction conditions to 37℃ for 15 minutes, 85℃ for 5 seconds, and 4℃ to synthesize cDNA by reverse transcription, and then dilute it 5 times for later use.

[0101] Table 3 Reverse Transcription Reaction System

[0102]

[0103]

[0104] (3) qPCR: Prepare the PCR reaction system according to Table 5, and perform the qPCR reaction according to the 3-step method:

[0105] A. Cycle once: 95℃, 10 minutes;

[0106] B. Cycle 40 times: 95℃, 5 seconds; 60℃, 30 seconds; 72℃, 35 seconds;

[0107] C. Cycle once: 60℃, 10 minutes

[0108] Table 4 qPCR reaction system

[0109]

[0110] (4) Data Analysis: After the reaction, the amplification curve and dissolution curve were confirmed. β-actin was used as an internal reference, and a 2... -ΔΔCt The relative expression level of mRNA can be calculated using this method.

[0111] (5) Primer sequences are shown in Table 5.

[0112] Table 5 qPCR primer sequences

[0113]

[0114]

[0115] (viii) Western Blot (WB) assay

[0116] (1) Cell protein extraction (taking a 6cm cell culture dish as an example): When the cell density reaches about 80%, discard the culture medium, rinse three times with pre-cooled PBS and discard it; add 250μl of RIPA lysis buffer and 2.5μl of protease inhibitor and phosphatase inhibitor, scrape the cells off with a cell scraper, mix thoroughly by pipetting and collect the liquid into a 1.5ml EP tube, and lyse on ice for 30min.

[0117] (2) Protein concentration detection and sample preparation: Dilute the protein standard to the working concentration (0.5 mg / mL); mix BCA reagent A and B in a ratio of 50:1 to prepare BCA working solution; add the standard solution and the sample to be tested to a 96-well plate according to step 7, set the replicate, and incubate at 37℃ for 30 minutes; after incubation, place the plate in an automated microplate reader and measure the absorbance at a wavelength of 562 nm; plot the standard curve and calculate the protein concentration of the sample to be tested; according to the protein concentration of each sample, dilute all samples to the same concentration using lysis buffer, add 5X loading buffer, mix thoroughly, incubate at 99℃ for 15 minutes in a metal bath, and cool to room temperature for later use.

[0118] (3) Gel preparation, sample loading and electrophoresis: SDS-PAGE gel was prepared using a rapid gel preparation kit; the gel was fixed in the electrophoresis tank, electrophoresis buffer was added to the inner tank, and after confirming that there was no leakage, the pre-stained protein and the protein sample prepared in the previous step were slowly added, and an appropriate amount of electrophoresis buffer was added; electrophoresis was started at a constant voltage of 80V, and when the protein bands reached the lower gel, the voltage was adjusted to a constant voltage of 120V, and electrophoresis was stopped when the bromophenol blue reached the bottom.

[0119] (4) Transfer and blocking: Take out the gel after electrophoresis and trim it to the appropriate size; cut the PVDF to the corresponding size and soak it in formaldehyde for 2 minutes to activate it; stack the gel from anode to cathode in the order of sponge pad-filter paper-PVDF membrane-gel-filter paper-sponge pad and remove air bubbles; set the constant current of 300mA at 4℃ for 90 minutes; after the transfer, cut the PVDF membrane according to the molecular weight, add it to the blocking solution, and shake it gently on a shaker at room temperature for 10 minutes.

[0120] (5) Antibody incubation and exposure: Dilute the primary antibody according to the instructions, place the blocked membrane in the primary antibody solution, and incubate at 4°C for 16-18 hours; after incubation, place at room temperature for 10 minutes, wash three times with TBST for 10 minutes each time; dilute the secondary antibody according to the instructions, place the band in the secondary antibody, and incubate on a shaker at room temperature for 1 hour; wash three times with TBST for 10 minutes each time; add the chemiluminescent solution evenly to the band, and perform imaging and image acquisition in the imager.

[0121] (ix) Cell Counting Kit 8 (CCK8) Experiment

[0122] (1) Take stable cell lines in the logarithmic growth phase, digest and count them, and then seed them into 5 96-well plates with 6 accessory wells in each group and 2000 cells per well.

[0123] (2) After the cells adhered to the plate, take out one 96-well plate and add 10 μl of CCK8 reagent to each well; after incubating in an incubator for 2 hours, place it in an ELISA reader to detect the OD value at 450 nm, which is taken as the 0-hour time point.

[0124] (3) Similarly, the OD values ​​at 24, 48, 72 and 96 hours were measured, and the proliferation curves of each group were statistically analyzed.

[0125] (X) EdU Experiment

[0126] (1) Take stable cell lines in the logarithmic growth phase, digest and count them, and then seed them into 6-well plates. After the cells adhere overnight, add an equal volume of 2X EDU working solution and incubate for 2 hours.

[0127] (2) After incubation, remove the culture medium, add 2 ml of fixative to each well, and fix at room temperature for 15 minutes; after fixation, remove the fixative, wash the cells 3 times with washing buffer for 5 minutes each time; add 1 ml of permeabilizing buffer to each well, and react at room temperature for 15 minutes; wash again with washing buffer 2 times for 5 minutes each time.

[0128] (3) Prepare the Click reaction solution according to the order in Table 6. Add 0.5 ml of Click reaction solution to each well, cover all cells, and incubate at room temperature in the dark for 30 minutes. After removing the reaction solution, wash three times with washing solution for 5 minutes each time.

[0129] (4) Add 1 ml of 1X Hoechst 33342 solution to each well for nuclear staining and incubate at room temperature in the dark for 10 minutes; after removing the Hoechst 33342 solution, wash the cells 3 times with washing buffer for 5 minutes each time; and place the cells under a fluorescence microscope for image acquisition.

[0130] Table 6 Click Reaction Solution Preparation

[0131]

[0132] (xi) Cell migration and invasion experiments

[0133] (1) Preparation: Migration experiment: Add an appropriate amount of preheated serum-free cell culture medium to the Transwell chamber for hydration, and remove it after 15 minutes; Invasion experiment: Add 50 μl of matrix gel (diluted 5 times with serum-free cell culture medium) to the Transwell chamber and incubate at 37°C for 2 hours.

[0134] (2) Take stable cell lines in the logarithmic growth phase, digest and count them, resuspend them in serum-free medium, and add them to the upper layer of a Transwell chamber (migration assay: 1×10⁻⁶). 5 Cells; Invasion assay 2×10 5 Cells); add complete culture medium containing 20% ​​FBS to the lower layer and place in a cell culture incubator for culture.

[0135] (3) After culturing for 48 hours, wash twice with PBS, fix with 4% paraformaldehyde for 20 minutes and wash once more; add 0.25% crystal violet and stain at room temperature for 30 minutes, then wash with PBS.

[0136] (4) Gently wipe the upper layer of cells in the chamber with a cotton swab, take random photos under a microscope and count them.

[0137] (xii) Subcutaneous tumor formation experiment in nude mice

[0138] (1) Take stable cell lines in the logarithmic growth phase, digest and count them, resuspend the cells in serum-free medium containing 10% matrix gel, and adjust the temperature to 1×10⁶. 7 Cells / ml, and placed on ice.

[0139] (2) Nude mice were randomly divided into groups of 6; after disinfection of the skin under the right armpit, 0.2 ml of cell suspension was inoculated, i.e., each nude mouse was inoculated with 5 × 10⁻⁶ cells. 6 cell.

[0140] (3) After disinfecting the wound and marking the earrings, return the mice to their cages according to their groups. Observe the health status of the nude mice daily and record whether tumors have formed. After tumors form, record the longest diameter (L) and the shortest diameter perpendicular to it (W) of the tumor every 3 days, using the formula L×W. 2 / 2 Calculate tumor volume.

[0141] (4) After 21 days of observation or when the subcutaneous tumor volume in nude mice reaches 1000 mmHg. 3 Mice were euthanized, tumors were removed, photographed, fixed, and embedded in paraffin.

[0142] (xiii) Tumor tissue staining in animal models

[0143] (I) HE staining

[0144] (1) The tissue sections were dewaxed by soaking in xylene I and II for 10 minutes each; and hydrated by soaking in ethanol solutions of gradient concentrations (100%, 95%, 80%) for 5 minutes each.

[0145] (2) After rinsing the tissue sections with tap water for 2 minutes, stain them with hematoxylin for 5 minutes.

[0146] (3) After rinsing the tissue sections with tap water for 1 minute, quickly immerse them in 1% hydrochloric acid alcohol and then remove them.

[0147] (4) Rinse the tissue sections with tap water for 1 minute and then stain with eosin for 5 minutes.

[0148] (5) After quickly immersing the tissue sections in 80% ethanol solution, remove them and then immerse them in ethanol solutions of gradient concentrations (95%, 95%, 95%, 100%, 100%) for 5 minutes each to dehydrate them;

[0149] (6) Soak the tissue sections in xylene I and II for 10 minutes each.

[0150] (7) After applying neutral resin to the tissue surface, mount the slide and dry it in a 37°C incubator or fume hood. Then observe it under a microscope.

[0151] (II) Immunohistochemical staining

[0152] (1) Slicing and baking: Place the tissue slices for staining in a constant temperature oven at 62℃ for 60 minutes.

[0153] (2) Dewaxing and rehydration: The tissue sections were dewaxed by immersing them in three staining tanks of xylene I, xylene II and xylene III for 20 minutes respectively; then they were gradually rehydrated by immersing them in staining tanks of anhydrous ethanol I, anhydrous ethanol II, 90% ethanol, 80% ethanol and 70% ethanol for 1 minute in sequence; finally, they were washed by immersing them in pure water for 3 minutes 3 times.

[0154] (3) Inactivation of endogenous peroxidase: Add 100 μl of hydrogen peroxide blocking solution to each slice and incubate at room temperature for 10 minutes to inactivate endogenous peroxidase; then wash with PBS 3 times for 5 minutes each time.

[0155] (4) Antigen retrieval: Tissue sections were immersed in 10mM sodium citrate at 100℃ for 20 minutes for antigen retrieval. After retrieval, the sections were removed, cooled to room temperature, and then washed three times with PBS for 5 minutes each time.

[0156] (5) Blocking: Add 100 μl of 5% BSA blocking solution to each slice and incubate at room temperature for 60 minutes.

[0157] (6) Primary antibody incubation: Add 100 μl of diluted primary antibody solution to each slice and incubate overnight at 4°C.

[0158] (7) Secondary antibody incubation: The next day, warm to room temperature for 30 minutes, then wash with PBS 3 times for 5 minutes each time; incubate with horseradish peroxidase-labeled secondary antibody at room temperature for 10 minutes, then wash with PBS 3 times for 5 minutes each time.

[0159] (8) DAB staining: Add 50 μl of DAB solution to each tissue section. Stop the staining process immediately when the ideal staining degree is observed under a microscope, and rinse thoroughly with tap water.

[0160] (9) Hematoxylin counterstaining: After staining with hematoxylin for 1 minute, rinse with tap water for 10 minutes.

[0161] (10) Dehydration, clearing and mounting: Soak in 80% and 90% ethanol solutions for 5 minutes each, and in anhydrous ethanol I, anhydrous ethanol II, xylene I and xylene II for 10 minutes each for dehydration and clearing; finally, mount with neutral resin and place in a fume hood for drying.

[0162] (XIV) Small molecule drug inhibition experiment

[0163] The methods for establishing the animal model and detecting tumor volume were the same as described above. On day 7 after inoculation with NB tumor cells, an average tumor volume of 80-100 mm was collected. 3 Six mice were randomly assigned to three groups: a control group, a 18α-glycyrrhetinic acid (GAA) group, and a carbenoxolone (CARB) group. The GCA groups received the corresponding inhibitor via gavage daily at a dose of 30 mg / kg for 14 consecutive days. The control group received a 1:99 mixture of DMSO and saline. Tumors were classified as tumors when the average tumor volume reached 1000 mmHg. 3 The experiment was terminated at that time.

[0164] (XV) Statistical Analysis

[0165] The statistical analysis in the previous examples employed Student's t-test, Wilcoxon rank-sum test, Pearson correlation coefficient, ANOVA test, and log-rank test, the specific applications of which are indicated in the figure captions. Two-tailed tests were used in the analysis, with p < 0.05 as the statistical standard.

[0166] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Application of GJC1 gene as a target spot in preparation or screening of an anti-tumor drug, characterized in that, The tumor is neuroblastoma.

2. Use according to claim 1, characterized in that, The anti-tumor drug targets GJC1 gene and inhibits, interferes or silences its expression.

3. Use of a molecule or agent that inhibits, interferes with, or silences the GJC1 gene in the preparation of an antitumor drug, characterized in that, The tumor is neuroblastoma.

4. Use according to claim 3, characterized in that, The molecule or agent is selected from 18α-glycyrrhetinic acid and carbenoxolone.

5. Use according to claim 3, characterized in that, The molecule or agent is siRNA or shRNA.

6. Use according to claim 5, characterized in that, The molecule or agent is shRNA, and the target sequence of the shRNA is any one of SEQ ID NO. 1-3.

7. A method for screening an anti-tumor drug in vitro, characterized by, It comprises: The drug to be screened is contacted with tumor cells in vitro, and if the proliferation of the tumor cells is inhibited, it indicates that the drug to be screened is a candidate drug. The drug to be screened targets GJC1 gene and inhibits, interferes or silences its expression. The tumor cells are neuroblastoma cells.

8. A medicament for treating neuroblastoma, characterized by comprising the compound of claim 1. The drug targets GJC1 gene and inhibits, interferes or silences its expression.

9. The medicament according to claim 8, characterized in that, The drug contains 18α-glycyrrhetinic acid or carbenoxolone.

10. A method of treating neuroblastoma, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of claims 1-9. The drug of claim 8 is administered to the subject to be treated.

Images