Antimicrobial peptides and their applications, products and preparation methods
By screening natural antimicrobial peptides derived from common beans and designing a controllable release protective segment, the shortcomings of existing antimicrobial peptides in terms of targeting and stability have been overcome. This has enabled the efficient killing of multidrug-resistant Escherichia coli O157:H7 and the protection of intestinal probiotics, thus improving the safety and efficiency of oral application.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-04-03
AI Technical Summary
Existing antimicrobial peptides have shortcomings in terms of targeting, stability, and delivery systems, making it difficult to meet the requirements for high efficiency, specificity, and safety in oral applications, especially in achieving the dual goals of killing multidrug-resistant Escherichia coli O157:H7 and protecting the gut microbiota.
By screening natural antimicrobial peptides derived from common beans and designing a controllable release protection segment, a highly selective complex antimicrobial peptide was formed. Taking advantage of the rich structure of common bean protein, candidate peptides that can specifically kill E. coli O157:H7 were screened, and randomly coiled protection segments were added before and after the effective segment. Staged release was achieved through spatial shielding and controllable enzymatic cleavage.
It achieves high affinity and high penetration bactericidal ability against multidrug-resistant E. coli O157:H7, while maintaining low inhibition of intestinal symbiotic bacteria, prolonging gastric stability and improving bioavailability, reducing the effective dose requirement, and significantly improving targeting efficiency and safety.
Smart Images

Figure CN121270663B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to an antimicrobial peptide, its applications, products, and preparation methods. Background Technology
[0002] Existing technology 1: CN1702083A (Antibacterial peptide DC and its preparation method and application)
[0003] This patent discloses a genetically engineered antimicrobial peptide DC, the sequence of which is shown in SEQ ID NO:2. It is synthesized using yeast-preferred codons and expressed in *Candida guinea*. The antimicrobial peptide DC possesses broad-spectrum bactericidal activity, capable of killing Gram-positive / negative bacteria, fungi (such as *Candida albicans*), and protozoa (such as *Trichomonas vaginalis*). Its preparation method includes:
[0004] 1. Design and synthesize the antimicrobial peptide DC gene (SEQ ID NO:1), and recombinant it with plasmids pHIL-S1 and pPICZα-A to construct an expression vector;
[0005] 2. Transformed into Candida albicans, and optimized fermentation conditions (such as corn steep liquor medium, 30-32℃, pH 6.5-7.0) to achieve high-density expression;
[0006] 3. The fermentation broth has a bactericidal potency of 10,000 units / mL. After purification by ion exchange chromatography, it can be used as a disinfectant (such as nasopharyngeal spray and vaginal suppository).
[0007] This technology produces broad-spectrum antimicrobial peptides through microbial fermentation, but it has the following problems:
[0008] 1. Insufficient targeting: Antimicrobial peptide DC is a non-specific bactericide that may disrupt the gut microbiota;
[0009] 2. Poor digestive stability: No mention is made of resistance to gastric acid or proteases; it is easily degraded after oral administration.
[0010] 3. Lack of delivery system: Relies on directly extracted peptides, without protective vectors or controlled release design.
[0011] Existing technology 2: CN104761617A / CN105622715A (Preparation and antibacterial application of chickpea peptides)
[0012] A polypeptide powder was prepared from chickpea bean kernels or bean residue using defatting, ethanol extraction, C18 reversed-phase column chromatography, and ultrafiltration membrane technology. The polypeptide exhibits antibacterial (e.g., Escherichia coli, Staphylococcus aureus) and fungal activities, with a molecular weight range of 4.1-20 kDa. It was obtained as a powder via spray drying and is intended for use as a food or pharmaceutical additive.
[0013] However, the following problems exist:
[0014] 1. Limitations in source: It relies on natural plant peptides without structural modification to enhance targeting;
[0015] 2. Mechanism of action is crude: it achieves broad-spectrum antibacterial activity through membrane disruption, potentially killing probiotics indiscriminately;
[0016] 3. No oral protection design: Does not address the issue of activity loss due to gastric acid or enzymatic hydrolysis.
[0017] Existing technology 3: CN107151671A (spCEMA::ErBD transgenic tobacco disease resistance)
[0018] A transgenic tobacco expression vector (pLGN-35S-spCEMA::ErBD) was constructed by fusing the ergosterol-binding domain (ErBD) to the C-terminus of the antimicrobial peptide spCEMA. The fusion peptide can specifically bind to ergosterol in the fungal cell membrane, significantly enhancing resistance to plant pathogens such as Verticillium dahliae and Acer rubrum.
[0019] However, the following problems exist:
[0020] 1. Limited application scenarios: It is only used for the prevention and control of plant diseases and does not involve animal or human intestinal pathogens;
[0021] 2. Lack of digestive protection: No oral delivery system was designed, and the peptides are easily degraded in the gastrointestinal tract;
[0022] 3. Single target: It targets fungi (ergosterol) and is ineffective against bacteria (such as Escherichia coli O157:H7).
[0023] Existing technology 4: CN114277087A (In vitro application of antimicrobial peptides to inhibit Escherichia coli)
[0024] A method for in vitro sterilization of antimicrobial peptides by intercalating into the DNA double helix of *E. coli* and inhibiting DNA replication (such as by downregulating the rnhA gene) is disclosed. Combined with eosin methylene blue test strips, the antimicrobial peptides are formulated into anal suppositories for the treatment of intestinal *E. coli* infections.
[0025] However, the following problems exist:
[0026] 1. Insufficient targeting: It only targets E. coli and does not distinguish between pathogenic strains (such as O157:H7) and probiotics;
[0027] 2. Limitations in delivery method: Relies on rectal administration, and the stability issue of oral delivery remains unresolved;
[0028] 3. No structural modification: The natural peptides have not been optimized for hydrophobic / charge ratios, which may result in non-specific killing.
[0029] Existing technology 5: CN118976004A (nanomaterial-coated antimicrobial peptides)
[0030] Antimicrobial peptides (such as ε-polylysine) are coated with sodium alginate nanocoatings, enabling targeted delivery by utilizing pH responsiveness (stable in gastric acid, released in an alkaline intestinal environment). The coated antimicrobial peptides resist gastric acid and proteases, significantly reducing the number of Escherichia coli in the intestines of livestock and poultry.
[0031] However, the following problems exist:
[0032] 1. Deficiency of broad-spectrum antibacterial activity: Not designed for specific pathogens (such as O157:H7);
[0033] 2. No genetic engineering optimization: Relies on natural peptides, without using genetic modification to increase yield or activity;
[0034] 3. Coarse release control: Relies solely on pH response, without precise design of cleavage sites or protective peptides.
[0035] In summary, existing antimicrobial peptides still have the following shortcomings:
[0036] 1. Peptide source
[0037] Existing antimicrobial peptides mainly come from natural plant or animal extracts, peptide enzymatic hydrolysis products, and sequences obtained through microbial expression. While natural peptides possess some broad-spectrum antimicrobial activity, their limited sources and uncontrollable structures make targeted design against specific pathogens difficult. Microbial expression can achieve a certain level of mass production, but the resulting peptides are mostly broad-spectrum active sequences, lacking selectivity for protecting probiotics. Current technologies also attempt to use transgenic plants to express peptides with specific functional domains to enhance antimicrobial effects, but these are mainly used for plant disease control, with limited targeting effects against animal or human intestinal pathogens. Overall, traditional peptide sources have significant shortcomings in targeting, yield, and stability, making it difficult to meet the demand for highly effective, specific, and safe antimicrobial peptides for oral applications.
[0038] 2. Molecular structure design
[0039] Existing antimicrobial peptides largely rely on natural sequences or simple chemical modifications, such as PEGylation and fatty acid grafting, in their molecular design, lacking systematic structural optimization strategies. Current peptides are typically not designed to protect against gastric acid and protease degradation, and lack mechanisms for bi-terminal protection or controlled enzymatic cleavage release, leading to easy loss of activity during oral administration. Furthermore, targeted design is often limited to single pathogen targets, such as specific fungal membrane components or bacterial DNA structures, lacking specificity for intestinal pathogens and failing to achieve selective bactericidal activity. The hydrophobicity and charge-to-particle ratio of traditional peptides have not been optimized, limiting their effectiveness in targeted bactericidal action and sustained-release in vivo.
[0040] 3. Oral delivery system
[0041] Current technologies generally lack comprehensive designs for oral delivery systems. Some antimicrobial peptides rely on physical encapsulation or nanomaterial coating to achieve gastric acid stability, but the timing and amount of release are difficult to control precisely, and early intestinal degradation still results in waste. Other approaches rely on rectal or local administration, which are only suitable for local or herbal applications and cannot solve the stability problem of oral administration. Naturally extracted peptides or microbial expressed peptides are mostly administered orally, but lack protective carriers, resulting in low oral bioavailability. Overall, existing delivery systems cannot achieve the dual goals of protecting the core active peptide in the stomach and achieving sustained release in the intestine, nor can they guarantee full activity.
[0042] 4. Production Mode
[0043] Traditional antimicrobial peptide production methods mainly include chemical synthesis, microbial fermentation, or extraction from natural plant peptides. Chemical synthesis is costly and complex, making large-scale application difficult; while microbial fermentation can achieve mass production, it requires complex fermentation, ion exchange, and chromatographic purification, limiting production costs and scalability; natural plant peptide extraction is limited by raw materials, resulting in low yields and difficulty in ensuring structural consistency. Nanocoating or other physical protection methods increase process complexity but do not solve the problem of balancing yield and activity. Overall, existing production methods present a contradiction between scalability, high activity, and low cost.
[0044] 5. Clinical Application Scenarios
[0045] Existing antimicrobial peptides have limitations in clinical and food applications. Some antimicrobial peptides can be used as disinfectants or food additives, but after oral administration, they have low targeting specificity to intestinal pathogens and easily disrupt probiotic flora. Some transgenic plant-expressed peptides are mainly used for plant disease control, lacking applications against animal and human pathogens. Rectal or local administration is only suitable for specific scenarios and is not conducive to oral use. Although nano-coated peptides can improve gastric acid stability, their ability to target specific pathogens is limited, and release control is crude. Current technologies generally lack an application scheme that can be administered orally, efficiently target pathogens, and simultaneously protect the intestinal flora.
[0046] In view of this, the present invention is hereby proposed. Summary of the Invention
[0047] The first objective of this invention is to provide an antimicrobial peptide to solve at least one of the above-mentioned technical problems.
[0048] A second objective of this invention is to provide the application of the above-mentioned antimicrobial peptides in the preparation of antimicrobial drugs.
[0049] A third objective of this invention is to provide a nucleic acid.
[0050] The fourth objective of this invention is to provide a carrier.
[0051] The fifth objective of this invention is to provide a cell.
[0052] The sixth objective of this invention is to provide a method for preparing the above-mentioned antimicrobial peptide.
[0053] The seventh objective of this invention is to provide an antibacterial drug.
[0054] To achieve the above objectives, the following technical solution is adopted:
[0055] In a first aspect, the present invention provides an antimicrobial peptide, wherein the amino acid sequence of the active peptide segment of the antimicrobial peptide is shown in SEQ ID NO.1.
[0056] As a further technical solution, the antimicrobial peptide also includes an upper protective peptide segment and a lower protective peptide segment;
[0057] The amino acid sequence of the upper segment of the protective peptide is shown in SEQ ID NO.2;
[0058] The amino acid sequence of the lower segment of the protective peptide is shown in SEQ ID NO.3;
[0059] From the N-terminus to the C-terminus, the upper segment of the protective peptide, the effective peptide segment, and the lower segment of the protective peptide are connected sequentially.
[0060] Secondly, the present invention provides the application of the above-mentioned antimicrobial peptide in the preparation of antimicrobial drugs.
[0061] As a further technical solution, the antibacterial drug includes a drug against Escherichia coli.
[0062] Thirdly, the present invention provides a nucleic acid that encodes the antimicrobial peptide.
[0063] As a further technical solution, the nucleic acid sequence of the nucleic acid is shown in SEQ ID NO.4.
[0064] Fourthly, the present invention provides a carrier carrying the nucleic acid.
[0065] Fifthly, the present invention provides a cell that carries the nucleic acid, or the vector, or expresses the antimicrobial peptide.
[0066] Sixthly, the present invention provides a method for preparing the above-mentioned antimicrobial peptide, comprising the following steps:
[0067] The vector was transfected into plant leaves, and then callus differentiation was induced in a culture medium to obtain plants expressing antimicrobial peptides. The antimicrobial peptides were then extracted from the plants.
[0068] In a seventh aspect, the present invention provides an antibacterial drug comprising the aforementioned antibacterial peptide.
[0069] Compared with the prior art, the present invention has the following beneficial effects:
[0070] This invention forms a highly selective complex antimicrobial peptide by screening natural antimicrobial peptides from common beans and combining them with a controlled release protection segment design, which has significant technical advantages over existing technologies.
[0071] First, existing oral antimicrobial peptides are mostly derived from animals or microorganisms, with simple peptide structures and easy degradation by proteases in the gastrointestinal tract, leading to loss of activity and some inhibitory effect on beneficial intestinal bacteria. This invention utilizes the rich structural characteristics of common bean protein, identifying it as the optimal source through systematic bioinformatics analysis and screening. Furthermore, it screens from the common bean genome for peptides that can specifically kill... E. coli The candidate peptide of O157:H7, after sequence optimization, retains the amphiphilic α-helical structure and adjusts the positive charge and hydrophobic distribution to achieve high affinity and high penetration bactericidal ability against target bacteria, while maintaining low inhibition against intestinal commensal bacteria. This is superior to existing technologies in terms of selectivity.
[0072] It is particularly noteworthy that the screening and verification targets of this invention are multidrug-resistant strains. E. coli The O157:H7 clinical isolate (resistant to ampicillin, tetracycline, and streptomycin) exhibits strong survival and virulence expression in food and the host gut. The complex antimicrobial peptide selectively recognizes and disrupts the negatively charged outer membrane lipopolysaccharide layer, while having no significant effect on the cell membranes of commensal bacteria such as *Lactobacillus rhamnosus* and *Bifidobacterium*, thus achieving specific killing of drug-resistant pathogens while preserving the balance of normal intestinal flora. This specific bactericidal characteristic not only reduces the further spread of drug resistance risk but also provides a new technical approach for the development of orally targeted antimicrobial peptides.
[0073] Secondly, the antimicrobial peptide designed in this invention incorporates randomly coiled protective segments before and after the active peptide. Through spatial shielding and controlled enzymatic cleavage, it achieves phased release, effectively solving the problem of rapid inactivation of traditional antimicrobial peptides in the stomach after oral administration. Specifically, the protective segment is mainly composed of residues such as Gly / Ser / Pro / Asn / Gln / Glu / Asp. This protective segment can form a flexible barrier in acidic gastric juice to reduce the recognition and cleavage of the core active peptide by pepsin, and can also be gradually cleaved by trypsin in the small intestine, achieving sustained release and maintenance of the core peptide's biological activity.
[0074] In vivo simulated digestion and mouse in vivo experiments showed that after oral administration of the antimicrobial peptide, a high proportion of intact core active peptides were detected in the samples recovered from the stomach. The residual rate of the core peptides remained high after entering the small intestine, and LC-MS / MS analysis confirmed that the core active peptide fragments were still partially present and maintained antimicrobial activity. The minimum inhibitory concentration (MIC) only slightly increased, indicating that some enzymatically hydrolyzed fragments still possess significant bactericidal function. This suggests that the biterminal protective peptide structure effectively prevents the core peptide from being degraded in the stomach and enables controlled release in the intestine, thereby prolonging the duration of action and maintaining high activity.
[0075] Furthermore, the activity test results of the antimicrobial peptide after being mixed with a variety of common food ingredients (such as dairy products, soy milk, starch solutions and plant protein beverages) showed that its antimicrobial efficacy was basically unaffected, indicating that the antimicrobial peptide of the present invention still has good stability and applicability in actual dietary environments.
[0076] Compared to traditional encapsulated peptides, under the same dosage conditions, the effective recovery amount of the antimicrobial peptides of this invention in the stomach is approximately twice that of the encapsulated peptides, and the amount of bioavailable active peptides in the small intestine is also significantly better than that of traditional encapsulation systems. Furthermore, the antimicrobial peptides achieve comparable antibacterial effects at only half the dosage of the encapsulated peptides, and gradient dosage experiments show that even at a dosage of one-quarter of the traditional dosage, they can effectively kill bacteria. E. coli The O157:H7 formulation significantly improves peptide utilization and targeting efficiency. Results show that the protective fragment not only delays degradation and improves bioavailability but also significantly reduces the effective dose requirement. Because the protective fragment design avoids the formation of regular secondary structures and the cleavage sites are controllable, the antimicrobial peptide of this invention achieves highly efficient antibacterial activity while minimizing interference with the intestinal flora, realizing simultaneous optimization of selective bactericidal action and digestive stability. These potent targeting, dose-saving, and intestinal-friendly characteristics are difficult to achieve with existing antimicrobial peptide technologies.
[0077] Furthermore, this invention employs a tobacco transgenic expression strategy, combined with plant codon optimization and signal peptide sequence design, to achieve efficient expression and secretion of antimicrobial peptides in plants. Compared with existing chemical synthesis or microbial expression methods, plant expression not only significantly reduces production costs and environmental risks, but also enhances peptide stability and activity through natural folding mechanisms. In constructing the expression system, this invention optimized the plant codons for the core active peptide and its bi-terminal protected segments, and achieved rapid expression through transient transformation. After optimizing leaf sampling and extraction conditions, the optimal extraction system was determined. Cost assessment shows that if the traditional Fmoc solid-phase synthesis route is used, the cost of producing 1 g of antimicrobial peptide in a single batch is approximately RMB 3500-4500, and although the purity can reach ≥95%, the operation is complex and the environmental burden is significant. However, using the plant expression system of this invention, through a purification process of affinity chromatography and reversed-phase HPLC / ion exchange chromatography, the production cost of each gram of complex peptide is approximately RMB 150-250, a cost reduction of over 90%, while maintaining an activity retention rate of over 65%-75%. Therefore, the antimicrobial peptides obtained by this invention have stable activity and can be directly used in oral formulations, taking into account both the feasibility of large-scale production and the safety of application.
[0078] In summary, this invention achieves [the following] through a combination of source innovation, sequence optimization, controlled release of the protected fragment, and plant expression. E. coli The invention offers the technological advantages of O157:H7, including highly selective bactericidal activity, intestinal activity release, intestinal flora protection, and high-purity oral production. Compared with existing technologies, this invention not only improves the efficacy and safety of oral antimicrobial peptides but also broadens the sources and application pathways of antimicrobial peptides, demonstrating significant technological advancement and application potential. Attached Figure Description
[0079] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0080] Figure 1 The structure of the antimicrobial peptide;
[0081] Figure 2 This is a schematic diagram of the cleavage sites of antimicrobial peptides under the action of proteases.
[0082] Figure 3 This is a schematic diagram of the release of antimicrobial peptides in the gastrointestinal tract. Detailed Implementation
[0083] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0084] The term "vector" refers to a nucleic acid delivery vehicle into which nucleotides can be inserted. When a vector enables the expression of the protein encoded by the inserted nucleotides, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be expressed in the host cells.
[0085] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids; phage particles; Cos plasmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses. In some embodiments, the vectors of this invention contain regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).
[0086] The terms “cell,” “cell line,” and “cell culture” used herein are used interchangeably, and all such names include progeny. Progeny may not be identical to primary cells due to natural, accidental, or intentional mutations, for example, in morphological and / or genomic DNA differences. “Transformation” and “transformed cell” include primary test cells and cultures derived therefrom.
[0087] In a first aspect, the present invention provides an antimicrobial peptide, wherein the amino acid sequence of the active peptide segment of the antimicrobial peptide is shown in SEQ ID NO.1.
[0088] The active peptide is the core bactericidal sequence, exhibiting typical amphiphilic α-helix characteristics. One side is rich in positively charged amino acids (Lys, Arg), while the other side is rich in hydrophobic residues (Trp, Ala), enabling it to specifically bind to and disrupt [the target organism]. E. coliO157:H7 cell membrane. The effective peptide of this invention was tested and found to have a MIC value of 8 μg / mL and an MBC value of 16 μg / mL, and it maintained high antibacterial activity even in the event of partial digestion loss.
[0089] This invention is the first to systematically screen for substances derived from kidney beans ( Phaseolus vulgaris Natural antimicrobial peptides from [a specific organism] were identified through genomic and proteomic information mining, revealing highly selective killing [a specific organism]. E. coli Candidate peptides for O157:H7. Compared to antimicrobial peptides from traditional sources, legumes have a richer protein structure, providing more peptides for screening. Preliminary screening showed that the probability of obtaining peptides targeting *E. coli* O157:H7 from the common bean genome is higher. After obtaining the candidate peptides, [further details are needed]. in silico The sequence was optimized to retain the amphiphilic α-helix characteristics, while the hydrophobic / hydrophilic ratio and positive charge distribution were adjusted to further obtain the effective peptide shown in SEQ ID NO.1, thereby enhancing its efficacy. E. coli O157:H7 exhibits targeted binding and membrane penetration capabilities while minimizing impact on gut symbionts. This strategy achieves a dual innovation of source novelty and functional selectivity compared to existing technologies that rely on single-source antimicrobial peptides or non-targeted screening.
[0090] In a preferred embodiment, the antimicrobial peptide further includes an upper protective peptide segment and a lower protective peptide segment;
[0091] The amino acid sequence of the upper segment of the protective peptide is shown in SEQ ID NO.2;
[0092] The amino acid sequence of the lower segment of the protective peptide is shown in SEQ ID NO.3;
[0093] From the N-terminus to the C-terminus, the upper segment of the protective peptide, the effective peptide segment, and the lower segment of the protective peptide are connected sequentially.
[0094] The protective peptide upper segment is used to mask the structure of the N-terminus of the active peptide, preventing premature recognition by pepsin. Simultaneously, it introduces non-conformational induced residues such as Gly, Ser, and Pro into the sequence to form a flexible coiled structure. Verification has shown that the protective peptide upper segment provided by this invention can significantly delay the pepsin cleavage rate without affecting the activity of the active peptide after release.
[0095] The lower protective peptide primarily acts as a C-terminal shield, forming a weak interaction with residues at positions 14-16 of the active peptide through coiling and folding, thus preventing rapid degradation by trypsin in the small intestine. Verification has shown that the lower protective peptide provided by this invention exhibits the best delayed release effect in simulated gastrointestinal digestion experiments, and can gradually release the complete or near-complete active fragment within 120 minutes.
[0096] When the antimicrobial peptide of this invention is used, it is orally administered into the gastrointestinal tract. In the acidic environment of the stomach, the upper segment of the protective peptide is first gradually broken down by pepsin, subsequently releasing the active peptide segment. This core peptide segment retains its bactericidal activity even after partial degradation. Simultaneously, the lower segment of the protective peptide is further broken down by trypsin in the small intestine, completing the release of the active peptide segment. The active peptide segment and its active fragment can rapidly bind to substances present in the gastric mucosa and mucus layer. E. coli O157:H7 disrupts the cell membrane and causes bacterial death, thereby achieving [the desired effect]. E. coli Specific killing of O157:H7.
[0097] This invention, based on the core active peptide derived from common bean, achieves structural masking and controlled release of the core active fragment by introducing a biterminal protective peptide. Unlike existing technologies that rely solely on a single antimicrobial peptide or simple chemical modifications, the protective segment of this invention is composed of Gly, Ser, Pro, and polar residues (Asn, Gln, Glu, Asp), exhibiting a random coiled conformation. This effectively reduces the direct recognition and excessive degradation of the core segment by digestive enzymes such as pepsin and trypsin. Simultaneously, short motifs that can be recognized by specific digestive enzymes are precisely placed within the protective segment, ensuring sufficient protection of the core segment in the gastric environment while achieving gradual release in the intestinal environment, achieving a dual effect of sustained release and targeted bactericidal action. This design provides "flexible masking" at the spatial level, preventing rapid inactivation of the active peptide in the stomach; and achieves "controlled release" at the functional level, ensuring stable activity of the core fragment in the intestine. Compared to traditional antimicrobial peptides or encapsulation methods, the antimicrobial peptide of this invention not only prolongs gastric stability and residence time but also exhibits more precise release kinetics, significantly improving the effectiveness of antimicrobial peptides in gastric digestion. E. coli The O157:H7 antibacterial efficiency is enhanced while reducing non-targeted impacts on the gut microbiota. By optimizing the length of the pre- and post-protective segments and the hydrophilic / hydrophobic ratio, the overall structure of the antimicrobial peptide balances the retention of the amphiphilic α-helix with high selectivity, thus exhibiting superior stability and bioavailability in oral applications.
[0098] Secondly, the present invention provides the application of the above-mentioned antimicrobial peptide in the preparation of antimicrobial drugs.
[0099] The antibacterial drugs include those that target Escherichia coli.
[0100] The antimicrobial peptides provided by this invention are used for the specific inactivation of *Escherichia coli* O157:H7 in the intestinal flora. Compared with traditional broad-spectrum antibiotic treatment, they have the advantages of strong targeting, less damage to intestinal probiotics, and better digestive stability. Firstly, common beans were chosen because their genome and proteome contain abundant potential natural antimicrobial peptide sequences. Screening results show that peptides derived from common beans are effective against... E. coliO157:H7 showed a higher inhibition probability. Secondly, structural modification of the bean-derived antimicrobial peptide could optimize the hydrophobic / hydrophilic ratio and positive charge distribution while retaining its amphiphilic α-helical characteristics, thereby significantly enhancing its inhibitory effect on... E. coli The O157:H7 cell membrane binding force and penetration efficiency are enhanced, and non-specific killing of probiotics is reduced. Furthermore, adding protective peptide segments to both ends of the modified antimicrobial peptide can delay the degradation of the active peptide through spatial shielding and controlled enzymatic cleavage, avoiding excessive decomposition in the stomach and loss of activity, thus achieving intestinal release and targeted bactericidal action. Finally, by transgenically inducing the secretion of this antimicrobial peptide from tobacco, and then extracting and orally administering it, the bioactivity of the antimicrobial peptide can be maintained in the gastrointestinal environment, specifically eliminating... E. coli O157:H7 exhibits higher stability and lower toxicity compared to traditional chemically synthesized peptides or oral antibiotic formulations.
[0101] Thirdly, the present invention provides a nucleic acid that encodes the antimicrobial peptide.
[0102] In some alternative embodiments, the nucleic acid sequence is as shown in SEQ ID NO.4:
[0103] ATGGGTTCTGGTGGTTCTTCTAGAGGTTCTCTAAAGGTTCTTCTGGTGGTTCTGGTAAAGGTGGTAGATGGAAAACCGCTACCGCTTCTGCTGGTACAGCTAGATGGAGAAAAGGTTCTAGAACCAGAGGTTCTTCTGGTTCTTCTAAAGGTTCTGGTGGTTCTGGTGGTAGAGGTAGCTTCTAAAGGTTAA (SEQ ID NO. 4).
[0104] This nucleic acid sequence is codon-optimized for tobacco, resulting in higher expression efficiency in tobacco.
[0105] Fourthly, the present invention provides a carrier carrying the nucleic acid.
[0106] Fifthly, the present invention provides a cell that carries the nucleic acid, or the vector, or expresses the antimicrobial peptide.
[0107] The cells include animal cells or microbial cells, and antimicrobial peptides are obtained through cell culture.
[0108] Sixthly, the present invention provides a method for preparing the above-mentioned antimicrobial peptide, comprising the following steps:
[0109] The vector was transfected into plant leaves, and then callus differentiation was induced in a culture medium to obtain plants expressing antimicrobial peptides. The antimicrobial peptides were then extracted from the plants.
[0110] This invention employs a plant transgenic expression system to achieve efficient and stable plant-derived production of antimicrobial peptides. Combined with optimized protein extraction and purification processes (such as salt-assisted Ni-NTA enrichment), it ensures both activity and stability while balancing yield and cost, providing a feasible solution for industrial oral applications.
[0111] In some alternative implementations, the plant is tobacco.
[0112] In some optional embodiments, the extraction includes: homogenizing the plant sample under 0.1-1.0 M NaCl conditions, removing large molecular weight proteins from the supernatant by fractional precipitation with ammonium sulfate, dissolving and loading a Ni-NTA column to enrich His-labeled complex peptides, and dialysis the eluent to remove salts to obtain antimicrobial peptides.
[0113] In a seventh aspect, the present invention provides an antibacterial drug comprising the aforementioned antibacterial peptide.
[0114] This antibacterial drug can specifically inactivate Escherichia coli in the intestinal flora.
[0115] In some alternative embodiments, the antimicrobial agent may further include pharmaceutically acceptable excipients, such as fillers, binders, disintegrants, etc.
[0116] In some alternative embodiments, the dosage form of the drug includes an oral dosage form.
[0117] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.
[0118] Example 1. Screening and sequence optimization of antimicrobial peptides derived from common soybean.
[0119] This invention aims to... Phaseolus vulgaris Natural antimicrobial peptides were screened from (beans) and the sequences of candidate peptides were optimized to obtain peptides with highly effective antimicrobial activity. E. coliO157:H7 activity and minimal interference with gut probiotics are key active peptides. Firstly, this invention utilizes genomic and proteomic data from multiple edible plants (including kidney beans, soybeans, peas, chickpeas, and mung beans) and antimicrobial peptide prediction software (CAMP and AntiBP2 databases) to predict and compare potential antimicrobial peptides. Multi-dimensional scoring of candidate peptides based on amino acid composition, hydrophobic moment, net charge, isoelectric point, and α-helix conformational tendency reveals that kidney bean proteome has the highest number and structural diversity of potential antimicrobial peptides, with a significantly higher average score than other legumes. Further cluster analysis shows that kidney bean candidate peptides have the highest structural similarity to known plant antimicrobial peptides effective against Gram-negative bacteria, especially in the distribution of positively charged residues and amphiphilic helical characteristics. E. coli The peptides showed high consistency. These results indicate that common bean is an ideal material for developing orally administered plant-derived antimicrobial peptides. Subsequently, bioinformatics methods were used to screen potential antimicrobial peptide fragments. Predictive tools employed included CAMP and AntiBP2, which assessed the amphiphilicity, positive charge density, hydrophobicity distribution, and potential α-helical structure of the peptides. Preliminary screening yielded several candidate peptides with lengths between 12 and 30 amino acids, exhibiting a potentially amphiphilic α-helical conformation, rich in positively charged (K / R) and hydrophobic residues (W / A), which facilitates binding to and penetration of bacterial membranes while reducing non-selective effects on probiotics.
[0120] Subsequently, the candidate peptides were subjected to... in silico Optimization was performed to adjust the hydrophobic / hydrophilic ratio, positive charge distribution, and amphiphilic arrangement to enhance membrane binding selectivity and bactericidal efficiency while maintaining low interference with probiotics. Three candidate core peptides were obtained, designated ID12-1 (RWKTATASAGTARWRKGSRT (SEQ ID NO.1)), ID12-2 (RYKTATASALRWRKKGSR (SEQ ID NO.5)), and ID12-3 (RFKTATGSSATARRKKGSR (SEQ ID NO.6)). Their physicochemical properties were analyzed and evaluated, focusing on bactericidal ability and probiotic selectivity. Physicochemical properties included normalized hydrophobic moment, hydrophobicity, net charge, isoelectric point, membrane penetration depth, tilt angle, tendency for irregular structure, and amphiphilic index. A comprehensive judgment was made based on membrane binding potential, expected bactericidal ability, and probiotic selectivity. The screening results and comprehensive evaluation are shown in Table 1. Because ID12-1 has low hydrophobicity and moderate amphiphilicity, it can ensure that the core peptide binds to the bacterial membrane but does not easily penetrate the intestinal symbiotic membrane excessively, thus ensuring selectivity. ID12-1 was ultimately selected as the core active peptide (SEQ ID NO.1).
[0121] Table 1. Physicochemical properties and comprehensive evaluation of core peptide candidates
[0122]
[0123] Example 2. Design and Protection Component Optimization of Complex Peptides
[0124] During the optimization process, the composite peptide designed in this invention consists of a protective peptide upper segment (SEQ ID NO.2), a core active peptide segment (SEQ ID NO.1), and a protective peptide lower segment (SEQ ID NO.3). Figure 1 ).
[0125] Initially, protective sequences were designed before and after the active peptide, mainly composed of Gly, Ser, Pro, Asn, Gln, Glu, and Asp, to form a random coil structure and inhibit the formation of regular secondary structures. Simultaneously, specific restriction enzyme sites were reserved in the sequence for controlled release via pepsin and trypsin recognition. Three candidate sequences were designed for each fragment (upper protective sequence 11-1 to 11-3 and lower protective sequence 13-1 to 13-3). These were screened through in vitro digestion stability tests and antibacterial activity experiments, and the best-performing sequence was ultimately selected for implementation. See Table 2 and... Figure 2 As shown, the upper segment 11-2 and the lower segment 13-3 of the protective peptide can delay the degradation of the core active peptide 12-1 under the conditions of pepsin and trypsin. Their folded structure binds to the N-terminal 2-5 and C-terminal 14-16 residues of the core peptide through weak interactions, respectively, to achieve phased release, thereby significantly prolonging the stability of the core active peptide in the gastrointestinal tract.
[0126] Table 2. Screening of protective peptide candidate sequences and in vitro activity
[0127]
[0128] The complex peptide (protected fragment-active peptide-protected fragment) was prepared by Fmoc solid-phase synthesis and purified to ≥95% purity by C18 reversed-phase HPLC. The complex peptide was digested in simulated gastric fluid (SGF, 0.1 M HCl, pH 2.0, containing 3200 U / mL pepsin) at 37°C, with samples taken every 15 minutes, neutralized with an equal volume of NaOH, and immediately frozen. Subsequently, the samples were added to simulated intestinal fluid (SIF, pH 7.4, containing 100 U / mL trypsin and 10 mM bile salts) and digested further at 37°C, with samples taken every 30 minutes, neutralized, and frozen in the same manner. All samples were filtered through a 0.22 μm filter membrane, and the peptide peak area and fragment sequence changes were analyzed by reversed-phase HPLC and LC-MS / MS.
[0129] As shown in Table 3, approximately 80% of the complex peptide remained after 15-120 minutes of pepsin treatment, with the main deletion fragment located at positions 2-5 of the N-terminus of the core peptide; after 30-120 minutes of trypsin treatment, approximately 60% remained, with the deletion fragment mainly located at positions 14-16 of the C-terminus of the core peptide. After combined digestion, approximately 55% of the intact complex peptide remained. LC-MS / MS analysis confirmed that the core active peptide segment still partially existed and maintained antibacterial activity, with the MIC slightly increasing to 16 μg / mL. These results indicate that the biterminal protective peptide structure can effectively protect the activity of the core active segment in the digestive tract, preventing significant ineffective degradation, thereby reducing the oral dosage while maintaining high bactericidal efficacy.
[0130] Table 3. Stability of complex peptides under simulated gastrointestinal digestion conditions
[0131]
[0132] Furthermore, compared with traditional encapsulated antimicrobial peptide microcapsules prepared by chitosan / alginate ionogel method, the composite peptide of this invention exhibits a core peptide retention rate of approximately 55% under gastrointestinal conditions, significantly higher than the 20% of traditionally encapsulated antimicrobial peptides. This indicates better protection in the stomach and sustained release in the intestine. Functional evaluation results also show that the minimum inhibitory concentration (MIC) of the composite peptide only slightly increases to 16 μg / mL after digestion, maintaining strong antimicrobial activity; while the MIC of the traditionally encapsulated sample significantly increases to ≥64 μg / mL after digestion, almost losing its effective antimicrobial effect. These results demonstrate that the bi-terminal protective structure of the composite peptide can effectively improve the stability and bioavailability of orally administered peptide antimicrobial agents in the gastrointestinal tract (Table 4).
[0133] Table 4. Comparison of stability and antimicrobial activity between complex peptides and traditional encapsulated antimicrobial peptides under simulated gastrointestinal digestion conditions.
[0134]
[0135] In summary, this embodiment, through systematic screening of antimicrobial peptides derived from common soybeans, optimization of the core active sequence, design of biterminal protective peptide structures, and combined with in vitro digestion and antimicrobial activity evaluation, has established a complex peptide system with controllable release, strong targeting, and minimal interference with intestinal probiotics. This provides a basis for oral targeted killing of [the bacteria / microbes]. E. coli O157:H7 provides a reliable technical solution.
[0136] Example 3. Evaluation of in vitro antibacterial activity
[0137] Will E. coliO157:H7 was cultured in Brucella medium containing 10% horse serum under microaerobic conditions until the logarithmic growth phase. The complex peptide, the core active peptide (SEQ ID NO.1), and the degradation fragment (partially truncated peptide fragments produced after simulated digestion) were dissolved separately in sterile water to prepare gradient concentrations of 0.5-256 μg / mL. In a 96-well plate, 100 μL of the peptide solution and 100 μL of bacterial suspension (1×10⁻⁶) were added to each well. 6 (CFU / mL), cultured under microaerobic conditions for 48 hours. After culture, OD was measured using a microplate reader. 600 The MIC (Minimum Inhibition Capacity) was determined to assess bacterial growth inhibition. Subsequently, concentrations at or above the MIC were inoculated onto solid culture medium and incubated at 37°C for 72 hours, with MBC (Mean Clinical Cycle) recorded. The effect of the peptide on bacterial survival at different time points was analyzed by plotting time-kill curves.
[0138] In the in vitro antibacterial activity evaluation (as shown in Table 5), the complex peptides... E. coli The MIC of O157:H7 was 16 μg / mL, and the MBC was 32 μg / mL, exhibiting antibacterial effects similar to the core active peptide (MIC 8 μg / mL, MBC 16 μg / mL). Furthermore, the time-bactericidal curve showed that it could effectively reduce bacterial viability in a relatively short time. While the core active peptide itself has stronger activity, it lacks a protective structure and therefore suffers from insufficient stability. In contrast, although degradation fragments generated during digestion resulted in slightly weaker activity (MIC 32 μg / mL, MBC 64 μg / mL), they still inhibited bacterial growth, indicating that even with partial degradation, the retained core sequence can still exert antibacterial effects in the intestinal environment, thus ensuring the overall therapeutic effect. In summary, the dual-end protection design not only improves stability and sustained-release effect in the gastrointestinal tract but also enhances the feasibility of oral administration by ensuring residual activity at the fragment level.
[0139] Table 5. Evaluation of in vitro antibacterial activity
[0140]
[0141] In addition, complex peptides are effective against representative probiotics. Lactobacillus rhamnosus and Bifidobacterium longum The MICs of L. were all greater than 256 μg / mL, and the selectivity index (SI) was ≥ 16 (Table 2). These results indicate that the complex peptides significantly inhibited the target bacteria in vitro while causing minimal interference with intestinal commensal bacteria, demonstrating excellent targeting selectivity (Table 6).
[0142] Table 6. Selective bactericidal effects of complex peptides on target bacteria and probiotics
[0143]
[0144] Note: Selectivity Index (SI) = MIC (probiotics) / MIC ( E. coli O157:H7)
[0145] Example 4. Evaluation of the stability and antibacterial activity of the complex peptide in different food media
[0146] To verify the applicability of the compound antimicrobial peptide of the present invention in actual dietary environments and its structural stability and bioactivity retention in complex food matrices, stability and antimicrobial activity tests were conducted on typical food systems such as dairy products, plant protein beverages, soy milk and starch solutions.
[0147] The specific procedure is as follows: Dissolve the lyophilized and purified complex peptides in PBS buffer to a final concentration of 16 µg / mL (corresponding to the complex peptide pair). E. coli The MIC level of O157:H7 was determined and mixed with the following media: whole milk, soy milk, corn starch solution (5%, w / v), and plant protein beverage. The mixtures were incubated at 37°C with shaking for 2 hours, then samples were taken. Insoluble components were removed by centrifugation, and the supernatant was collected for the following assays:
[0148] HPLC analysis of the residual rate of complex peptides: The residual ratio of complex peptides is calculated by comparing the main peak areas of each sample;
[0149] LC-MS / MS structure verification: to detect whether the peptide has undergone significant degradation or conformational changes;
[0150] Antibacterial activity test: using E. coli O157:H7 strain, the change in MIC value of the mixed sample was measured.
[0151] The results (Table 7) showed that the complex peptide exhibited high structural stability and activity retention in different food systems. HPLC quantitative analysis revealed that the complex peptide retained over 90% of its original content after 2 hours of incubation, indicating that its structure was not significantly affected by protein, lipid, or polysaccharide components. LC-MS / MS analysis showed no degradation peaks in the main core active component, confirming that the protected segment effectively prevents non-specific hydrolysis. Antimicrobial experiments showed that the MIC values of the complex peptide in different media differed from the PBS control by no more than ±10%, indicating that it maintained stable antimicrobial activity in various common food environments.
[0152] Furthermore, no significant precipitation or flocculation occurred after the complex peptide was blended with food, and the sample clarity was good, indicating that the complex peptide has good dispersibility and compatibility with food systems. Compared with traditional encapsulated antimicrobial peptides, the complex peptide of this invention can maintain high bioactivity in protein and lipid environments and is not affected by adsorption by food matrices, demonstrating strong potential for practical applications.
[0153] Table 7. Stability and Antibacterial Activity Retention of Complex Peptides in Different Food Media
[0154]
[0155] Example 5. Evaluation of in vivo antibacterial efficacy and safety
[0156] To further verify the targeted bactericidal effect and gastrointestinal stability of the complex peptide in vivo, this experiment designed a combined oral administration-peptide tracking-gut microbiota analysis protocol. SPF mice were randomly divided into groups, receiving either a gradient dose of the complex peptide, the same dose of a conventionally embedded antimicrobial peptide, or a saline control, with each group receiving oral administration for 7 consecutive days. During the oral administration experiment, mouse weight, food and water intake, and activity levels were recorded daily, and fur condition, behavioral abnormalities, abdominal distension, or other clinical manifestations were observed. After the experiment, the mice were euthanized, and major organs such as the liver, kidneys, spleen, heart, and gastrointestinal tract were immediately dissected and collected. These organs were fixed in 10% neutral formalin for 24 hours, and paraffin sections were prepared. After routine HE staining, the sections were observed under an optical microscope to examine organ structure, cell morphology, and inflammation or necrosis. Blood samples were collected during and after the experiment, and serum was obtained by centrifugation. Serum ALT, AST, BUN, CRE, and other indicators were measured using an automated biochemical analyzer to assess liver and kidney function and potential toxicity. Following the oral administration experiment, gastric, small intestinal, and colonic contents were collected. Total peptides and DNA were extracted using the DNeasy PowerSoil Kit. Peptide composition was analyzed using LC-MS / MS and HPLC to identify the core active peptide and its partially enzymatically degraded fragments. The residual amounts of the complex peptide and traditionally encapsulated antimicrobial peptides in the intestine and stomach were quantitatively compared. Simultaneously, high-throughput sequencing of the 16S rRNA V3-V4 region was performed on the intestinal contents to analyze changes in α-diversity, β-diversity, and abundance of major bacterial communities, in order to assess the antimicrobial effect and its impact on intestinal commensal bacteria.
[0157] The results (Table 8) showed that after oral administration of a 1× dose of the complex peptide, approximately 80% of the core active peptide remained in the stomach, and about 55% of the core peptide fragment was still detectable in the intestine. This indicates that the complex peptide was effectively protected in the stomach and achieved sustained release in the intestine, with a high extraction rate and guaranteed activity. In contrast, with the same oral administration of a 1× dose of traditionally encapsulated antimicrobial peptide, approximately 60% remained in the stomach, and only about 25% of the core peptide fragment was detected in the intestine. This indicates that the core peptide was not adequately protected in the stomach, and the intestinal release was only half that of the complex peptide, resulting in significant waste. Increasing the traditionally encapsulated antimicrobial peptide to a 2× dose achieved an intestinal residue level comparable to that of the complex peptide (approximately 50%), but the utilization efficiency decreased significantly with the increased oral dose. Overall, the complex peptide, through its dual-end protection design, protects the core active segment in the stomach and achieves sustained release in the intestine, significantly improving oral utilization efficiency and demonstrating a clear advantage over traditional encapsulation methods.
[0158] Table 8. Residual amounts of complex peptides and traditional encapsulated antimicrobial peptides in mouse intestines
[0159]
[0160] Functional analysis showed (Table 9) that the intestinal tract of the oral compound peptide group... E. coli The relative abundance of O157:H7 decreased from approximately 10 in the control group. 6 CFU / g decreased to 10 3 The CFU / g concentration remained stable, while the abundance of major probiotics remained constant. In contrast, the encapsulated antimicrobial peptides showed significantly weaker bactericidal effects than the complex peptides at the same dosage, achieving a similar antibacterial effect only when the oral dose was twice that of the complex peptides. Gradient-dose experiments further demonstrated that the complex peptides achieved significant bactericidal effects at only one-quarter the dosage of traditional encapsulated peptides, showcasing the advantages of high-efficiency targeting and sustained release.
[0161] Table 9. Evaluation of in vivo antibacterial effect
[0162]
[0163] As shown in Table 10, the experimental group mice showed stable weight gain over time, with no significant decrease in appetite or behavioral abnormalities. Their fur remained shiny, and their activity was normal. Pathological observation revealed that the liver, kidneys, spleen, heart, and gastrointestinal tract tissues were structurally intact, without significant inflammation, necrosis, or cellular abnormalities. Serum biochemical indicators showed no significant differences compared to the control group; ALT, AST, BUN, and CRE were all within the normal range, indicating that the oral dose of the complex peptide was safe and had no significant toxicity.
[0164] Table 10. Safety and serum biochemical indicators in mice
[0165]
[0166] In summary, the complex peptides designed in this project effectively regulate their phased release in vivo through a dual-protection strategy. For example... Figure 3 As shown, after oral administration to mice, the complex peptide first passes through the gastric environment, where the protective peptide structure significantly resists the enzymatic cleavage of pepsin, keeping the core peptide largely intact. Subsequently, in the intestinal stage, trypsin gradually recognizes and cleaves the protective peptide linker sites, causing the core peptide to be released slowly, thereby significantly enhancing the stability and bioavailability of the peptide in vivo.
[0167] Example 6. Tobacco transgenic expression and high-purity preparation
[0168] First, plant codon optimization was performed based on the preferred sequence of the complex peptide, validated in vitro and in vivo (coding sequence SEQ ID NO.4). A signal peptide sequence suitable for tobacco secretion was added, and a 6×His tag was added to the end of the sequence for purification. The optimized gene was synthesized and cloned into a 35S promoter-driven pCAMBIA plasmid, and purified using Agrobacterium (…). Agrobacterium tumefaciens Tobacco leaves were transformed using the leaf disc method. After 48 hours of co-culture, the transformed leaves were induced to differentiate into callus tissue on a regeneration medium containing antibiotics (such as kanamycin or gentamicin), and regenerated plants were obtained after several weeks. The integration of the antimicrobial peptide gene into the tobacco genome was verified by PCR and qPCR, and the transcription level was detected by RT-qPCR. Finally, the expression of the peptide in the leaves was detected by Western blot and LC-MS / MS to confirm that the expressed complex peptide had the expected molecular weight and active fragment characteristics.
[0169] The results, shown in Table 11, confirmed the successful expression and integrity of the target complex peptide in transgenic tobacco plants at both molecular and protein levels. PCR amplification revealed a specific band in the genome of the transgenic plants, indicating successful integration of the target gene. qPCR further confirmed a stable copy number in the plants. RT-qPCR analysis showed a significantly increased transcription level, approximately 10-fold higher than the initial screening threshold, indicating high transcription efficiency. At the protein level, Western blot detected a band with a molecular weight consistent with the design, and LC-MS / MS identification showed that the major active fragment of the target peptide was intact and its molecular weight was consistent with the theoretical value. In summary, these results demonstrate that the tobacco transgenic system can stably express a complex peptide with the expected molecular structure and function.
[0170] To determine an extraction and purification process suitable for industrial-scale preparation of antimicrobial peptides, this invention investigated three commonly used leaf protein extraction routes (methods A, B, and C), and compared different process conditions in each method to clarify the optimal extraction and purification method for the target peptides.
[0171] Method A is a high-purity process that involves homogenization and extraction with Tris-HCl buffer at low temperature, followed by sonication and centrifugation, and then direct loading onto a Ni-NTA affinity column. The product is eluted with high-concentration imidazole and finally purified by reversed-phase HPLC to obtain a product with a purity ≥95%. This method yields the highest purity, but it is complex to operate and has high consumable costs, making it suitable only for preparing analytical-grade samples.
[0172] Method B is a salt-assisted process, using three ionic strength conditions (0.1 M, 0.5 M, and 1.0 M NaCl) for homogenization and extraction. The supernatant is then subjected to fractional precipitation with ammonium sulfate to remove large-molecule proteins. The supernatant is then dissolved and loaded onto a Ni-NTA column to enrich His-labeled complex peptides. The eluent is dialyzed to remove salt, yielding the crude and purified product. This method balances yield, purity, and cost, making it suitable for large-scale preparation.
[0173] Method C is an acidic / multiphase precipitation process, using acetic acid (0.1%, 1.0%, 5.0%) for extraction. Small peptides are retained through acid precipitation, followed by impurity removal using precipitants such as polyvinylpyrrolidone. Finally, the peptides are enriched with Ni-NTA and dialyzed. This method is effective for removing pigments and large molecules, but the recovery rate and stability of the target peptides are dependent on the acid concentration, resulting in poor reproducibility.
[0174] As shown in Table 12, Method A can obtain high-purity products with a purity ≥95% and good protein stability, but the overall operation is complex and costly, making it suitable only for analytical-grade preparation. Method B can obtain products with medium to high purity under all three salt concentrations, especially performing best under NaCl 0.5 M conditions, with a purity of 65-75% and a yield of 0.7-1.2 mg per gram of leaf. This method also has good cost control and scalability, making it suitable for early-stage industrial-scale process development. Method C can effectively remove pigments and macromolecular impurities under acidic conditions, but the overall recovery rate is low (0.3-0.6 mg / g), the purity is only 40-60%, and the reproducibility is poor. The target peptide is also prone to degradation, making it unsuitable for large-scale applications. Therefore, Method B has significant advantages in terms of overall cost, recovery rate, and activity retention.
[0175] As shown in Table 13, Method B further investigated the effect of different NaCl ionic strengths on the recovery and purification of the target peptide. The results showed that under NaCl = 0.1 M conditions, although the target peptide could be extracted, both the recovery rate and purity were low (purity approximately 60%, recovery rate 40-50%). SDS-PAGE results showed a weak main band and numerous impurities. Under NaCl = 1.0 M conditions, the excessively high salinity led to partial loss of the target peptide, with a purity of approximately 55% and a recovery rate of only 30-40%, and the target band was significantly weakened. The best performance was achieved under NaCl = 0.5 M conditions, with a product purity of approximately 65-75% (typically 70%) and a recovery rate of 50-70%. SDS-PAGE showed a clear main band and fewer impurities. Further in vitro antibacterial experiments showed that the products obtained under all three conditions had a MIC value of 8 μg / mL against Escherichia coli O157:H7. However, the product obtained under NaCl = 0.5 M conditions achieved the best balance between yield and purity and was therefore identified as the recommended process condition.
[0176] Table 11. Screening results of transgenic tobacco plants
[0177]
[0178] Table 12. Comparison of Processes for Different Extraction and Purification Methods
[0179]
[0180] Table 13. Comparison of results under different salt concentrations in Method B
[0181]
[0182] Example 7. Safety and Oral Compatibility Assessment
[0183] The freeze-dried plant-derived complex peptide powder was first subjected to endotoxin detection (LAL method), heavy metal content analysis (atomic absorption spectrometry), and routine pesticide residue detection (GC-MS or LC-MS / MS) to ensure compliance with oral safety standards. Subsequently, mice were divided into groups for oral administration experiments (dose gradient: low, medium, and high doses, calculated based on body weight), and observed for 7 days, with daily recording of body weight, appetite, and activity. After the experiment, blood samples were collected to measure serum biochemical indicators (ALT, AST, BUN, CRE, etc.), and liver, kidney, spleen, heart, and gastrointestinal tissues were collected for HE staining and pathological observation. Simultaneously, the stability and antibacterial activity of the complex peptides were tested in vitro in simulated gastric and intestinal fluids to simulate the oral digestion process.
[0184] The endotoxin content of the complex peptide was less than 0.1 EU / mg; no heavy metals or pesticide residues were detected, meeting the oral safety standards; animal oral experiments showed that mice had stable weight gain, no abnormal behavior, normal serum biochemical indicators, intact organ and tissue structure, and no obvious pathological damage; in vitro digestive stability experiments showed that the complex peptide retained about 70% of its activity under gastric and intestinal digestion conditions, with the MIC maintained at 8-16 μg / mL, verifying the feasibility and safety of oral administration of the complex peptide.
[0185] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. An antimicrobial peptide, characterized in that, The amino acid sequence of the effective peptide segment of the antimicrobial peptide is shown in SEQ ID NO.1; The amino acid sequence of the upper segment of the protective peptide of the antimicrobial peptide is shown in SEQ ID NO.2; The amino acid sequence of the lower protective peptide of the antimicrobial peptide is shown in SEQ ID NO.3; From the N-terminus to the C-terminus, the upper segment of the protective peptide, the effective peptide segment, and the lower segment of the protective peptide are connected sequentially.
2. The use of the antimicrobial peptide according to claim 1 in the preparation of antimicrobial drugs; The antibacterial drug is an antibacterial drug against Escherichia coli.
3. A nucleic acid, characterized in that, The nucleic acid encodes the antimicrobial peptide of claim 1.
4. The nucleic acid according to claim 3, characterized in that, The nucleic acid sequence of the nucleic acid is shown in SEQ ID NO.
4.
5. A carrier, characterized in that, The vector carries the nucleic acid as described in claim 3 or 4.
6. A cell, characterized in that, The cell carries the nucleic acid as described in claim 3 or 4, or contains the vector as described in claim 5, or expresses the antimicrobial peptide as described in claim 1.
7. The method for preparing the antimicrobial peptide according to claim 1, characterized in that, Includes the following steps: Plant leaves were transfected with the vector described in claim 5, and then callus differentiation was induced in a culture medium to obtain plants expressing antimicrobial peptides. The antimicrobial peptides were then extracted from the plants.
8. An antibacterial drug, characterized in that, Includes the antimicrobial peptide as described in claim 1.
Citation Information
Patent Citations
Preparation method and application of chickpea polypeptide part
CN104761617A
Quick preparation method and application of chickpea polypeptide powder
CN105622715A
Method for improving phytopathogen resistance of spCEMA and transgenic tobacco material
CN107151671A
Application method of antibacterial peptide in in-vitro inhibition of escherichia coli
CN114277087A
Preparation method of nano-material coated antibacterial peptide
CN118976004A