Rice os slrl2 gene and application thereof in improving phosphorus utilization efficiency, plant type optimization and yield of rice

Abstract

The application discloses a rice OsSLRL2 gene and application thereof in improving phosphorus utilization efficiency, plant type optimization and yield, and relates to the technical field of plant genetic engineering. Research finds that knockout or functional loss of the OsSLRL2 gene can significantly enhance the adaptability of rice under low-phosphorus conditions, and is manifested as developed root system, increased tillering, improved grain number per panicle and increased biomass, thereby significantly improving phosphorus utilization efficiency, optimizing plant type structure, and realizing stable yield and high yield under low-phosphorus conditions. On the contrary, overexpression of the OsSLRL2 gene leads to limited root growth and reduced tillering. By regulating the expression of the OsSLRL2 gene, the synergistic optimization of high phosphorus utilization efficiency and ideal plant type can be realized without increasing phosphorus fertilizer input, and a new molecular target and breeding approach is provided for cultivating a new rice variety with high phosphorus utilization rate and excellent plant type.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to a rice OsSLRL2 gene and application thereof in improving phosphorus utilization efficiency, plant type optimization and yield of rice. BACKGROUND

[0002] Phosphorus is one of the essential macronutrients for rice growth and development, and plays an important role in energy metabolism, signal transduction and nucleic acid synthesis. However, the phosphorus fertilizer utilization efficiency is generally low in current agricultural production, and the phosphorus fertilizer utilization rate of rice production is only 10%-20% in the season, which is much lower than that of nitrogen and potassium fertilizers. The main reason is that phosphorus has poor mobility in soil and is easily fixed as a poorly soluble compound, resulting in very little effective phosphorus available for plants, thereby limiting the yield potential and causing resource waste and environmental pollution. Studies have shown that a large amount of unabsorbed phosphorus is retained in the soil or lost with runoff, causing water eutrophication. As a global phosphorus fertilizer consumer, China's phosphorus fertilizer utilization rate has been lower than the world average for a long time, which seriously restricts the efficient use of agricultural resources and sustainable development.

[0003] At present, a variety of functional genes related to phosphorus absorption and phosphorus deficiency response have been identified in rice. For example, OsPT1 belonging to the high-affinity phosphate transporter family is mainly expressed in the root system and is responsible for the absorption of inorganic phosphorus; OsPHR2 is a core transcription factor that regulates the phosphorus starvation signal pathway and can activate a variety of downstream phosphorus starvation response genes, but its overexpression can cause excessive accumulation of phosphorus in the body; in addition, the key gene OsPSTOL1 from traditional rice Kasalath can promote early root growth and significantly improve rice yield under low phosphorus environment. The above studies provide an important basis for improving the absorption and utilization efficiency of crop phosphorus nutrients.

[0004] In addition to nutrient utilization, the plant type of rice is also a key factor in determining yield potential and light energy utilization efficiency. An ideal plant type usually has fewer ineffective tillers, moderate plant height, strong stems and larger panicle type, which can significantly improve the group photosynthetic efficiency and lodging resistance. Studies have shown that IPA1 is an important gene for controlling ideal plant type, and its specific mutant can realize stable yield and high yield by regulating tiller number and grain number per panicle. However, such plant type optimization genes usually do not directly participate in the regulation of phosphorus absorption or utilization.

[0005] Although some progress has been made in improving phosphorus utilization efficiency and optimizing plant type of rice, it is still difficult to coordinate the two, and there is still a lack of effective molecular regulation approach. The existing technology for promoting phosphorus absorption often ignores the influence of plant type and growth balance, which is easy to cause excessive growth of plants or abnormal nutrient redistribution in the body; while the optimization strategy of plant type often relies on high fertilizer input, which is difficult to maintain stable yield under low phosphorus conditions. In other words, there is still a lack of a safe and controllable molecular regulation approach that can improve phosphorus utilization efficiency and improve plant type characteristics without increasing phosphorus fertilizer input. SUMMARY

[0006] In view of the above defects of the prior art, the present application provides a rice OsSLRL2 gene and its application in improving phosphorus utilization efficiency, plant type optimization and yield of rice. Through directional editing of the OsSLRL2 gene, the phosphorus balance in the plant body can be maintained under different phosphorus supply conditions, the phosphorus utilization efficiency of rice is significantly improved, and the coordinated optimization of root system and plant type is promoted, which provides a new molecular breeding idea and technical approach for breeding new rice varieties with high phosphorus utilization efficiency and excellent plant type, to solve the problems raised in the background art.

[0007] To achieve the above purpose, the present application provides the following technical scheme:

[0008] A method for improving phosphorus utilization efficiency, yield and plant type optimization of rice under low phosphorus conditions, characterized by knocking out the OsSLRL2 gene to improve the phosphorus utilization efficiency, yield and plant type optimization of rice; the nucleotide sequence of the OsSLRL2 gene is shown in SEQ ID NO. 1.

[0009] Preferably, the OsSLRL2 gene has a negative regulatory effect on the phosphorus utilization, yield and plant type development of rice. Knocking out or functionally deleting the OsSLRL2 gene or inhibiting its expression can significantly enhance the adaptability of rice under low phosphorus conditions, which is manifested as developed root system, increased tillering, improved grain number per ear and increased overall biomass, thereby improving the phosphorus utilization efficiency of the plant and promoting yield formation.

[0010] Preferably, the amino acid sequence encoded by the OsSLRL2 gene is shown in SEQ ID NO. 2.

[0011] Preferably, the high yield is manifested as increased biomass, increased yield per plant and increased number of filled grains.

[0012] Preferably, the plant type optimization is manifested as increased tiller number, thick and strong stem, developed root system, compact plant type and optimized ear type.

[0013] Preferably, the low phosphorus condition is divided according to the culture system as follows:

[0014] S1. Hydroponic system: The phosphorus source in the nutrient solution is KH2PO4, and the phosphorus concentration is 10µM.

[0015] S2, Field System: The phosphorus source applied to the soil is superphosphate, at a rate of 7.5 kg / mu.

[0016] Preferably, the rice includes indica rice and japonica rice.

[0017] Preferably, the protein encoded by the OsSLRL2 gene is located in the cell nucleus and cytoplasm.

[0018] Preferably, a method for preparing rice with high phosphorus use efficiency, high yield, and optimized plant type under low phosphorus conditions includes the following steps:

[0019] (1) The CRISPR / Cas9 target nucleotide sequence for the OsSLRL2 gene was used;

[0020] (2) Insert the target sequence into the CRISPR / Cas9 vector to construct the OsSLRL2 gene editing vector;

[0021] (3) The OsSLRL2 gene editing vector was transferred into competent cells to obtain Agrobacterium-mediated transformation containing the editing vector;

[0022] (4) Transformed Agrobacterium and recipient material are co-cultured and resistant callus tissue is obtained by screening;

[0023] (5) Differentiate and culture the resistant callus tissue, verify it by PCR sequencing, and screen to obtain positive lines with OsSLRL2 gene knockout, which are the target rice plants.

[0024] Preferably, the target nucleotide sequence is as follows:

[0025] gRNA 1: 5'-GTGTACGCGTCTCTAGTCCCTGG-3' (SEQ ID NO. 3);

[0026] gRNA 2: 5'-CCTGCGGTCGGTGAATCTCATGG-3' (SEQ ID NO. 4).

[0027] Preferably, the competent cells comprise Agrobacterium EHA105.

[0028] Preferably, the receptor material comprises rice callus.

[0029] Compared with the prior art, the beneficial effects of the present invention are:

[0030] (1) By directing the editing of the OsSLRL2 gene, this invention achieves the synergistic optimization of high phosphorus utilization, increased yield and ideal plant type in rice. Unlike previous genes that only act on a single trait, the OsSLRL2 gene can simultaneously regulate the phosphorus utilization efficiency, yield and plant type of rice, achieving the synergistic optimization of three key traits and providing a new molecular regulatory pathway for green, high-yield and low-phosphorus, high-efficiency breeding of rice.

[0031] (2) Knockout or loss of function of the OsSLRL2 gene can significantly enhance the adaptability of rice under low phosphorus conditions, manifested by well-developed root system, increased tillering, increased number of grains per panicle, and increased overall biomass, thereby improving the plant's phosphorus utilization efficiency and promoting yield formation. This invention provides new molecular targets and application strategies for efficient nutrient utilization and coordinated plant development, and has important theoretical significance and breeding application potential. Attached Figure Description

[0032] Figure 1 This is a schematic diagram of the structure of the OsSLRL2 gene editing vector;

[0033] Figure 2 A schematic diagram of the structure of the OsSLRL2 gene recombinant overexpression vector 35S:OsSLRL2-GFP;

[0034] Figure 3 The tissue expression pattern and subcellular localization of the OsSLRL2 gene are shown in Figure A. The relative expression level of OsSLRL2 in different tissues was detected by qRT-PCR. Figure B shows the subcellular localization of 35S:OsSLRL2-GFP in the epidermal cells of tobacco leaves and young rice roots. Figure C shows the GUS staining results of Pro:OsSLRL2-GUS transgenic plants in different tissues, where 1 is a longitudinal section of the main root, 2 is a transverse section of the main root root hair zone, 3 is a transverse section of the main root root tip, 4 is a transverse section of the leaf, and 5 is a leaf sheath. Figure D shows the comparison of GUS staining of the roots of Pro:OsSLRL2-GUS material under high phosphorus (HP) and low phosphorus (LP) hydroponic conditions.

[0035] Figure 4 The biomass and inorganic phosphorus content of the OsSLRL2 gene overexpression line (SLRL2-OE) and the knockout line (slrl2-cr) were compared. A shows the plant type comparison of wild-type (NIP), SLRL2-OE and slrl2-cr after 42 days of culture in high phosphorus (HP) and low phosphorus (LP) conditions. B shows the biomass statistics of each material after 42 days of culture. C shows the comparison of inorganic phosphorus (Pi) content in roots and different leaf positions after 21 days of treatment (data in the figure are expressed as mean ± SD, n≥3, *: P<0.05, **: P<0.01).

[0036] Figure 5The field phenotypes of NIP, SLRL2-OE, and slrl2-cr lines under different phosphorus supply levels are shown. Field treatments included MP (medium phosphorus), LP (low phosphorus), and NP (no phosphorus). A shows the whole-plant phenotype at maturity under MP, LP, and NP conditions; B shows the morphological characteristics of the panicle, stem, and root system; C shows the number of filled grains per plant under different phosphorus supply conditions (only MP and LP data are shown); D shows the number of effective tillers; E shows the plant height variation; F shows the number of grains per panicle; G shows the stem diameter; H shows the root diameter; I shows the yield variation per plant (only MP and LP data are shown). The data shown are from field trials in 2023 and 2024. (Data in the figure are expressed as mean ± SD, n≥3, *: P<0.05, **: P<0.01). Detailed Implementation

[0037] To enable those skilled in the art to better understand the technical content of this invention, the technical solution of this invention will be further described in detail below with reference to specific embodiments. The following examples are used to explain the technical solution of this invention and do not limit the scope of protection of this invention. Unless otherwise stated, the reagents and materials used in the experiments are conventional commercial products in the art or prepared by conventional methods.

[0038] Example 1: Hydroponic Conditions and Phosphorus Supply Treatment

[0039] (1) Cultivation conditions

[0040] The test materials were wild-type rice Nipponbare (NIP) and its derived lines. Hydroponic cultivation was conducted under artificial climate chamber conditions. The climate parameters were as follows: photoperiod: 12h light / 12h dark; photosynthetically active radiation: 150-300 µmol / m² / s; temperature: daytime 28-32℃, nighttime 20-25℃; relative humidity: 50%-70%. The hydroponic containers were plastic pots, with a nutrient solution volume of 50L, and 30 rice seedlings were planted in each pot.

[0041] (2) Nutrient solution and phosphorus supply treatment

[0042] The nutrient solution used was a modified Hoagland nutrient solution system, containing nitrogen (N), phosphorus (P), potassium (K), calcium (Ca), magnesium (Mg), iron (Fe), and trace elements (B, Mn, Zn, Cu, Mo). The chelated iron source was NaFe-EDTA, and the buffer was MES (2-(N-morpholino)ethanesulfonic acid) to maintain pH stability. The initial pH of the nutrient solution was adjusted to 5.5-5.8, and then fine-tuned with NaOH or HCl.

[0043] Two phosphorus supply levels were set: high phosphorus (HP): 200µM KH2PO4; low phosphorus (LP): 10µM KH2PO4; to maintain a consistent potassium ion concentration, equimolar amounts of KCl were used for compensation in the LP treatment.

[0044] The nutrient solution was changed every 7 days. The experimental period was 21 days.

[0045] The rice nutrient solution formula is shown in Table 1:

[0046] Table 1 Improved Hoagland Nutrient Solution

[0047]

[0048] Note: The formula described can be equivalently replaced by commonly used Hoagland, Yoshida, or other standard nutrient solution systems in the field; the concentrations of trace elements, iron chelates, and buffers are allowed to be adjusted within ±5% of the nominal value. Culture conditions such as pH and temperature can be appropriately optimized according to equipment conditions.

[0049] Example 2 Total RNA Extraction and qRT-PCR Analysis

[0050] To analyze the expression pattern of the OsSLRL2 gene under different tissues or treatment conditions, the following steps were performed for total RNA extraction and real-time quantitative PCR detection:

[0051] (1) Sample collection and pretreatment

[0052] Different tissues (roots, stems, leaves, leaf sheaths, leaf pulvinus, etc.) of rice grown normally for 21 days were collected, flash-frozen in liquid nitrogen, and then ground into fine powder. Three biological replicates were set up for each sample.

[0053] (2) RNA extraction and reverse transcription

[0054] Total RNA was extracted using the TRIzol method, following the manufacturer's instructions. RNA samples were treated with DNase I (approximately 1 U / μg RNA) to remove genomic DNA contamination before purity and integrity were assessed to ensure the quality of the RNA samples used in the experiment. 260 / A 280 =1.8-2.1; A 260 / A 230 ≥2.0; and 1% agarose gel electrophoresis shows clear 28S / 18S bands without degradation. Qualified samples were used to synthesize cDNA using the PrimeScript RT reagent kit.

[0055] (3) Primer design

[0056] qRT-PCR primers were designed to cover the CDS region-specific sequence of OsSLRL2, with a GC content of 40%-60% and an amplified fragment length of 200-300 bp. OsActin1 was selected as the internal control gene. The qRT-PCR primers are shown below:

[0057] OsSLRL2-qRT-PCR-F:TCTTCTACTACGCCTCCATGT (SEQ ID NO.5);

[0058] OsSLRL2-qRT-PCR-R:ATCATCGTCATCTTCTTCCCC (SEQ ID NO. 6).

[0059] (4) qRT-PCR reaction system and conditions

[0060] The 20 μL reaction system is shown in Table 2:

[0061] Table 2 qRT-PCR reaction system

[0062]

[0063] The amplification program was as follows: 95℃ for 3 min; followed by 40 cycles: 95℃ for 10 s, 60℃ for 30 s (fluorescence signal acquisition); melting curve: 65-95℃, with a temperature increase of 0.5℃ per step to confirm a single peak. Three technical replicates were set for each sample.

[0064] (5) Data Analysis

[0065] The relative expression level was calculated by standardizing the Ct value of the reference gene: ΔCt = Ct(target) – Ct(reference); ΔCt = ΔCt(sample) – ΔCt(control); relative expression level = 2 - ΔΔCt. Statistical analysis was performed using Student's t-test or one-way ANOVA, with a significance threshold of P < 0.05.

[0066] Example 3: Gene Editing and Overexpression Vector Construction of OsSLRL2

[0067] (1) CRISPR / Cas9 gene editing vector

[0068] Select 1-4 gRNA sites (PAMs such as NGG) in the OsSLRL2 coding region or conserved functional domains, avoiding highly homologous sequences; a dual-target knockout strategy is adopted here, with the two corresponding targets being:

[0069] Target gRNA 1: GTGTACGCGTCTCTAGTCCCTGG (SEQ ID NO.3);

[0070] Target gRNA 2: CCTGCGGTCGGTGAATCTCATGG (SEQ ID NO.4);

[0071] The gRNA expression cassette and Cas9 vector were assembled using conventional molecular cloning methods to obtain the OsSLRL2 gene editing vector, as shown below. Figure 1 As shown, after sequencing confirmation, it was used for Agrobacterium-mediated genetic transformation.

[0072] (2) Construction of overexpression vector

[0073] To obtain overexpression material of the OsSLRL2 gene, the full-length cDNA of OsSLRL2 was amplified by PCR and then directionally cloned into a plant expression vector derived from pCAMBIA1300. The vector contains the CaMV 35S promoter (a strong promoter) to drive the expression of the target gene and carries a GFP marker sequence for subcellular localization observation.

[0074] The primers used for PCR amplification are as follows:

[0075] Forward primer F: 5'-acgggggacgagctcggtaccATGGCTCAGTTCGGCGGC-3' (SEQ ID NO.7);

[0076] Reverse primer R: 5'-catgtcgactctagaggatccTCACTGCATGATTTGGTTGAGAG-3' (SEQ ID NO. 8);

[0077] The empty vector plasmid was digested with KpnI and BamHI, and then ligated with the amplified fragment to form the overexpression recombinant vector 35S:OsSLRL2-GFP. A schematic diagram of the recombinant vector is shown below. Figure 2 As shown. After transformation into E. coli DH5α, positive clones were screened, and the correctness of the inserted fragment was verified by sequencing. The correct 35S:OsSLRL2-GFP overexpression vector was verified to be suitable for Agrobacterium-mediated rice genetic transformation to obtain OsSLRL2 overexpression lines.

[0078] Example 4: Rice genetic transformation and screening of positive lines

[0079] (1) Carrier preparation

[0080] The CRISPR / Cas9 editing vector and OsSLRL2 overexpression vector constructed in Example 3 were transformed into Agrobacterium EHA105 competent cells using the freeze-thaw method for rice genetic transformation.

[0081] (2) Receptor material and callus induction

[0082] The infection receptor was the mature embryo of the japonica rice variety Nipponbare. Dehulling and sterilization: The seeds were soaked in 70% ethanol for 2 min, then treated with 2% NaClO solution for 30 min, and washed 5 times with sterile water. The sterilized seeds were placed on mature embryo induction medium (MS-based, containing 2,4-D 2 mg / L, sucrose 30 g / L, agar 8 g / L, pH 5.8) and incubated in the dark at 28℃ for 3-4 weeks to induce the formation of pale yellow, dense callus tissue.

[0083] (3) Agrobacterium infection and co-culture

[0084] Transformed Agrobacterium clones were picked and inoculated into YEP liquid medium containing antibiotics, and cultured at 28°C with shaking until OD reached. 600 ≈0.6-0.8; After collecting the bacterial cells, resuspend them in AAM solution (containing 200μM acetylsyl syringone), infect the callus tissue for 5-10 min, blot dry the surface bacterial solution, place them on filter paper and let stand for 30 min, then transfer them to co-culture medium and incubate in the dark at 25℃ for 2-3 days.

[0085] (4) Selection of culture and regeneration

[0086] After co-culture, the callus tissue was transferred to a selective medium containing antibiotics (hygromycin 50 mg / L and kanamycin 5 mg / L) and cultured for 10-14 days. Resistant callus was selected and subcultured once more. The resistant callus was then transferred to differentiation medium (MS + 6-BA 1 mg / L + NAA 0.2 mg / L) and cultured at 25°C under light conditions until regeneration and emergence.

[0087] (5) Identification of positive plants

[0088] Genomic DNA was extracted from the transgenic seedlings, and positive strains were identified by PCR using specific primers. The identified positive strains were named slrl2-cr and SLRL2-OE, respectively. slrl2-cr was a knockout strain, and SLRL2-OE was an overexpression strain.

[0089] (6) Technical Specifications

[0090] The above transformation system is also applicable to other rice varieties (such as indica rice). The Agrobacterium strain, selection markers (hygromycin, kanamycin, glufosinate, etc.), culture medium formula and culture cycle can all be adjusted within ±10% without affecting the transformation efficiency and the result of obtaining positive plants.

[0091] Example 5: Tissue expression, subcellular localization, and phosphorus deficiency induction of OsSLRL2

[0092] (1) Construction of OsSLRL2pro:GUS promoter report vector

[0093] To investigate the tissue-specific expression pattern of the OsSLRL2 gene, a fragment approximately 2000 bp upstream of its promoter (located upstream of ATG) was amplified from the Nipponbare genome and cloned into the plant reporter vector pCAMBIA1300-GUS between the KpnI and SalI sites.

[0094] The primers used are shown below:

[0095] OsSLRL2pro:GUS-KpnI-F:5'-CAGATCTACCATGGTACCGCGCGACGGCCGGCTA-3' (SEQ IDNO.9);

[0096] OsSLRL2pro:GUS-SalI-R:5'-TGCCTGCAGGTCGACGTGCATTAGAGAGTA-3' (SEQ IDNO.10);

[0097] After sequencing verification confirmed the insertion direction and sequence were correct, the construct OsSLRL2pro:GUS was obtained. This vector was then transformed into rice via Agrobacterium-mediated transformation (see Example 4 for the method), resulting in stably inherited OsSLRL2pro:GUS transgenic material.

[0098] (2) GUS staining and tissue sections

[0099] Tissues such as roots, stems, leaves, leaf sheaths, and leaf pulvinus from T1 generation OsSLRL2pro:GUS transgenic plants were placed in GUS staining solution for color development.

[0100] The GUS staining solution formula is shown in Table 3:

[0101] Table 3 GUS dye solution formulation

[0102]

[0103] Samples were subjected to vacuum degassing and incubated at 37°C in the dark for approximately 8–16 hours before the reaction was stopped. After staining, the tissues were destained with anhydrous ethanol until they became transparent. The destained tissues were embedded in 4% agarose and cut into approximately 40 μm sections using a vibratory microtome. The sections were then observed and photographed using an optical microscope. The results showed that OsSLRL2 was mainly expressed in the epidermis, exodermis, root tip, and root hairs of the primary root under normal phosphorus supply conditions, and signals were also found in the vascular bundles, ligule, and leaf sheath of the leaves.

[0104] (3) Subcellular localization analysis

[0105] To determine the intracellular localization of the OsSLRL2 protein, the full-length OsSLRL2 cDNA was cloned upstream of the pCAMBIA1300-35S-EGFP vector to obtain the fusion expression vector 35S:OsSLRL2-GFP. This vector was transformed with Agrobacterium and used in a transient expression system in tobacco leaves to observe the localization of exogenous expression. A stable transformation material in rice (SLRL2-OE) was used for localization verification in root tissues. Laser confocal microscopy revealed that the OsSLRL2-GFP signal was mainly distributed in the nucleus and cytoplasm, with no obvious organelle-specific aggregation, suggesting it is a nuclear-cytoplasmic distributed protein.

[0106] (4) Phosphorus deficiency-induced expression analysis

[0107] OsSLRL2pro:GUS transgenic material was hydroponically cultured for 14 days under high phosphorus (200 µM KH2PO4) and low phosphorus (10 µM KH2PO4) conditions, respectively, followed by GUS staining. The results showed that low phosphorus (LP) treatment significantly enhanced GUS signal intensity, especially with marked upregulation in the root tip region, indicating that OsSLRL2 is a phosphorus-responsive gene, induced under phosphorus deficiency conditions (see details). Figure 3 ).

[0108] Example 6: Material Identification and Phenotypic Evaluation

[0109] (1) Molecular identification:

[0110] The obtained OsSLRL2 edited line (slrl2-cr) and overexpression line (SLRL2-OE) were identified at the molecular level and used for subsequent analysis. First, fresh leaves from transgenic plants were collected, and genomic DNA was extracted using the CTAB method or a commercial plant DNA extraction kit. PCR amplification was performed using vector boundary primers to verify the integration of the exogenous fragment. Subsequently, the target region of the edited body was amplified by PCR and sequenced, or different allelic types were analyzed by cloning and sequencing to screen for homozygous mutant lines (slrl2-cr1, slrl2-cr2). Simultaneously, total RNA was extracted from the overexpression line, reverse transcribed, and then analyzed by qRT-PCR. The results showed that the transcription level of OsSLRL2 in the SLRL2-OE line was significantly higher than that in the wild type (NIP). OsActin1 was used as an internal reference gene for normalization analysis. After the above tests and verifications, the OsSLRL2 knockout line (slrl2-cr) and the overexpression line (SLRL2-OE) were finally obtained, and the homozygous positive seedlings were propagated to the T2 generation for subsequent functional verification and phenotypic analysis.

[0111] (1) Hydroponic phenotypic analysis

[0112] NIP, slrl2-cr, and OsSLRL2-OE lines were cultured for 42 days in high-phosphorus (HP, 200 µM KH2PO4) and low-phosphorus (LP, 10 µM KH2PO4) nutrient solutions. Plant height, tiller number, root length, root dry weight, and aboveground dry weight were recorded for each material, with 3-5 biological replicates per treatment. Dry weights were dried to constant weight (65℃, 72 h) and then weighed. The results showed that under low-phosphorus (LP) treatment, the slrl2-cr line had significantly higher tiller number and biomass than the wild type, while the OsSLRL2-OE line showed reduced tiller number and lower biomass. Under high-phosphorus (HP) conditions, the differences between materials were relatively smaller, indicating that the regulatory effect of the OsSLRL2 gene was more significant under low-phosphorus (LP) conditions (see details). Figure 4 A and Figure 4 (B in the middle).

[0113] (2) Determination of inorganic phosphorus (Pi) content

[0114] Root and leaf tissue samples were collected, and inorganic phosphorus content was determined using the molybdenum blue colorimetric method. The colorimetric wavelength was 820 nm, and the content was calculated using the KH₂PO₄ standard curve. The results showed that under LP conditions, the tissue Pi content of the slrl2-cr line was not significantly different from that of the wild type, while biomass and tillering were significantly increased. This indicates that the knockout of OsSLRL2 mainly improves phosphorus use efficiency rather than simply phosphorus uptake (see details). Figure 4 (C in the middle).

[0115] Example 7: Field validation and technical effect evaluation of the OsSLRL2 gene

[0116] To verify the adaptability of the OsSLRL2 gene to rice under low phosphorus conditions and its effects on plant architecture and yield traits, field cultivation trials were conducted for two consecutive years (2023-2024).

[0117] (1) Experimental materials and treatment

[0118] The experimental materials included: wild-type Nipponbare; OsSLRL2 knockout line (slrl2-cr); and OsSLRL2 overexpression line (SLRL2-OE). Field trials were conducted in 2023 and 2024 in the Changxing Nutrient Experimental Area of ​​Zhejiang Province, using a randomized block design with three replicates per treatment for each genotype. Three phosphorus application levels were set in the field: MP (medium phosphorus): 15 kg superphosphate / mu; LP (low phosphorus): 7.5 kg superphosphate / mu; NP (no phosphorus): no phosphorus application. Other nutrient (nitrogen, potassium) and field management practices remained consistent.

[0119] (2) Observation indicators and methods

[0120] At maturity, random samples were taken to measure the following indicators: plant height, number of effective tillers, number of grains per ear, stem diameter, yield per plant, and root diameter. Statistical analysis was performed on the number of filled grains per plant and biomass under different phosphorus supply conditions. In the statistical analysis, differences between two groups were assessed using Student's t-test, and differences among multiple groups were analyzed using one-way ANOVA with Tukey's post-hoc test. The significance level was set at P < 0.05. Experimental data were processed using conventional ANOVA methods, with P < 0.05 considered significant.

[0121] (3) Test results

[0122] The results showed that under field LP conditions, the SLRL2-cr line exhibited a more developed root system, higher tiller number, and larger panicle size, with significantly higher yield per plant and more filled grains than the NIP line. The SLRL2-OE line, on the other hand, showed reduced tillering, thinner stems, a more compact plant type, and decreased yield. Under field MP conditions, the SLRL2-cr line maintained yield-related traits comparable to or slightly higher than those of the NIP line, while the SLRL2-OE line showed significantly lower yields (see details). Figure 5 ).

[0123] (4) Technical effects

[0124] The combined results of two years of field trials show that knocking out or inhibiting the expression of the OsSLRL2 gene can significantly improve the biomass accumulation and yield performance of rice under low phosphorus conditions. Regulating the expression of this gene can simultaneously improve phosphorus use efficiency and plant architecture, achieving a coordinated balance between high phosphorus use efficiency and ideal plant architecture. The OsSLRL2 gene and its application described in this invention can achieve stable and increased yields without increasing phosphorus fertilizer input, and has broad prospects for promotion and application.

[0125] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for improving phosphorus use efficiency, yield, and optimizing plant architecture in rice under low phosphorus conditions, characterized in that, By knocking out the OsSLRL2 gene, the phosphorus use efficiency, yield, and plant architecture of rice were improved; the nucleotide sequence of the OsSLRL2 gene is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that, The amino acid sequence encoded by the OsSLRL2 gene is shown in SEQ ID NO.

2.

3. The method according to claim 1, characterized in that, Increased yield is manifested in increased biomass, increased yield per plant, and increased number of filled grains.

4. The method according to claim 1, characterized in that, The plant type optimization is manifested in increased tiller number, thicker stems, well-developed root system, compact plant type, and optimized panicle type.

5. The method according to claim 1, characterized in that, The low-phosphorus conditions are classified according to the culture system as follows: S1. Hydroponic system: The phosphorus source in the nutrient solution is KH2PO4, and the phosphorus concentration is 10µM. S2, Field System: The phosphorus source applied to the soil is superphosphate, at a rate of 7.5 kg / mu.

6. The method according to claim 1, characterized in that, The rice varieties include indica rice and japonica rice.

7. The method according to claim 1, characterized in that, Includes the following steps: (1) Using the CRISPR / Cas9 target nucleotide sequence of the OsSLRL2 gene as described in claim 1; (2) Insert the target nucleotide sequence into the CRISPR / Cas9 vector to construct the OsSLRL2 gene editing vector; (3) The OsSLRL2 gene editing vector was transferred into competent cells to obtain Agrobacterium-mediated transformation containing the editing vector; (4) Transformed Agrobacterium and recipient material are co-cultured and resistant callus tissue is obtained by screening; (5) Differentiate and culture the resistant callus tissue, verify it by PCR sequencing, and screen to obtain positive lines with OsSLRL2 gene knockout, which are the target rice plants.

8. The method according to claim 7, characterized in that, The target nucleotide sequence in step (1) is as follows: gRNA 1: 5'-GTGTACGCGTCTCTAGTCCCTGG-3'; gRNA 2: 5'-CCTGCGGTCGGTGAATCTCATGG-3'.

9. The method according to claim 7, characterized in that, The competent cells in step (3) include Agrobacterium EHA105.

10. The method according to claim 7, characterized in that, The recipient material in step (4) includes rice callus.

Images