A method for rapidly producing gene-edited goldfish and its application

Abstract

This invention provides a method for rapidly preparing gene-edited goldfish, comprising: S1, obtaining rare gudgeon with primordial germ cells removed as recipient fish; S2, processing the goldfish... raw Genetic design targets were used to introduce the Cas9 / gRNA complex into goldfish fertilized eggs. Sequencing verification yielded mutant individuals, which were then raised as donor fish. S3: The gonads of the donor fish were harvested, minced, enzymatically digested, filtered, and then enriched with donor reproductive stem cells via density gradient centrifugation. S4: The donor fish reproductive stem cells were transplanted into recipient fish, which were then raised to obtain gene-edited goldfish sperm and eggs. S5: Goldfish spawned by rare gudgeon... raw Mutant sperm and eggs are hybridized and raised to obtain gene-edited goldfish individuals. This invention utilizes gudgeon as the recipient and gene-edited goldfish from across subfamilies as donors, employing surrogate reproduction technology to provide an efficient, stable, and easily scalable method for preparing gene-edited goldfish.

Description

Technical Field

[0001] This invention belongs to the field of aquatic animal genetic breeding technology, specifically relating to a method for rapidly preparing gene-edited goldfish and its application. Background Technology

[0002] Superior breeds are the foundation of sustainable development in aquaculture, while efficient breeding is a prerequisite for breed selection and creation. Gene editing technology can not only uncover functional genes that determine important economic traits in fish, such as high yield, quality, disease resistance, and stress resistance, but also allow for the targeted design and "de novo domestication" of new farmed fish varieties. However, many farmed fish have long reproductive cycles and are difficult to breed, resulting in lengthy genetic breeding cycles and low breeding efficiency. Surrogate reproduction has been recognized by the academic community both domestically and internationally as one of the essential cutting-edge technologies for precision fish breeding. Using this technology, gametes from fish with shorter reproductive cycles and smaller body sizes can be generated from fish with longer reproductive cycles and larger body sizes. Combined with gene editing technology, this can significantly accelerate the process of fish genetic breeding.

[0003] Goldfish, with their unique shapes, vibrant colors, and graceful forms, are beloved by many and possess high ornamental value. Goldfish farms and ornamental fish markets are located throughout my country's provinces, giving them significant economic value. Therefore, efficiently and rapidly obtaining gene-edited goldfish varieties is an urgent problem to solve. In traditional fish surrogacy techniques, zebrafish are the most common recipient fish. However, they lack a genetic sex-determining system, and their sex differentiation is drastically affected by the number of germ cells. This results in almost no donor eggs being available from zebrafish as surrogacy recipients. Furthermore, zebrafish themselves have extremely low sperm production, further limiting their practical application potential in surrogacy techniques.

[0004] Therefore, there is an urgent need to find a new recipient fish with a shorter sexual maturation cycle and higher yield than zebrafish, and to produce sperm and eggs derived from gene-edited functional goldfish, so as to provide an efficient, stable and easy-to-promote method for rapidly obtaining gene-edited goldfish. Summary of the Invention

[0005] In view of this, the present invention provides a method for rapidly preparing gene-edited goldfish and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A method for rapidly producing gene-edited goldfish includes the following steps:

[0008] S1, Targeting the rare gudgeon dead end The morpholino gene was designed and injected to obtain rare gudgeon with primordial germ cells removed, which were then used as recipient fish.

[0009] S2, for goldfish raw Gene design target: Cas9 / gRNA complex was introduced into goldfish 1-cell stage fertilized eggs, and the mutant individuals were obtained by embryonic mixed sequencing verification. They were then raised and used as donor fish.

[0010] S3. Remove the gonads of the donor fish from S2, cut them into pieces, digest them with enzymes, filter them, and then enrich the reproductive stem cells of the donor fish using the Percoll density gradient centrifugation method.

[0011] S4. Transplant the donor fish reproductive stem cells (GSCT) from S3 into the juvenile recipient fish from S1, and raise them to obtain gene-edited goldfish sperm and eggs.

[0012] S5, the rare gudgeon produced in S4 raw By hybridizing the sperm and eggs of genetically mutated goldfish, F1 embryos are produced. These embryos are then raised to obtain individual genetically edited goldfish.

[0013] In some specific embodiments, preferably, the morpholino sequence in step S1 is: 5'-CTTCATAAGCGGATAACGACATGGA-3'.

[0014] In some specific embodiments, preferably, the target sequence in step S2 is as follows: 5'-GGGATGGATCACCAGCAGTT CGG -3';

[0015] The primers for gRNA amplification in the Cas9 / gRNA complex are: 5'-TAATACGACTCACTATAGGGATGGATCACCAGCAGTTGTTTTAGAGCTAGAA-3'.

[0016] In some specific embodiments, preferably, the plasmid pT7-gRNA is used as a template when obtaining gRNA, and the amplification primers are as follows:

[0017] Forward primer amh-gRNA-F sequence: 5'-TAATACGACTCACTATAGGGATGGATCACCAGCAGTTGTTTTAGAGCTAGAA-3';

[0018] Reverse primer gRNA-RP sequence: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'.

[0019] In some specific embodiments, preferably, the Cas9 / gRNA complex is 5 μL in volume, with gRNA and Cas9 mRNA concentrations of 100 ng / μL, 5×phenol red 1 μL, and the remainder being RNase-free ddH2O.

[0020] In some specific embodiments, preferably, the enzymatic digestion in step S3 is carried out using pancreatic enzymes and collagenases at 35°C;

[0021] The filtration process uses a sieve with a pore size of 40 μm;

[0022] The concentration of the Percoll separation solution is 25%-40%.

[0023] The application of the above methods in goldfish genetic breeding.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] This invention utilizes rare gudgeon as the recipient and gene-edited goldfish spanning multiple subfamilies as donors to conduct research on surrogate reproduction. Due to... dead end Even after Morpholino knockdown treatment, rare gudgeon still exhibits sexual dimorphism, producing both donor sperm and donor eggs. Furthermore, the high sperm yield of rare gudgeon makes them more suitable for large-scale production, thereby improving breeding efficiency and production quality. Therefore, this invention utilizes goldfish-derived reproductive cells to colonize and differentiate within the gonadal microenvironment of rare gudgeon, ultimately producing reproductively functional, gene-edited goldfish-derived sperm and eggs. These gene-edited gametes are then hybridized with wild-type gametes, resulting in the rapid and efficient production of gene-edited goldfish. Attached Figure Description

[0026] Figure 1 This is a flowchart of the scheme in Example 1.

[0027] Figure 2 The goldfish in Example 1 raw Gene target sequence.

[0028] Figure 3 This is a fluorescence image of germline stem cells that can be tracked 5 days after transplantation in Example 1.

[0029] Figure 4 The image shows the detection results of GSCT-positive sperm in Example 1. raw Image of a successfully gene-edited F1 generation goldfish embryo.

[0030] Figure 5 This is a diagram of the embryo and seedling resulting from self-fertilization of a GSCT-positive oocyte and a GSCT-positive sperm in Example 1. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.

[0032] Example 1

[0033] This embodiment provides a method for preparing gene-edited goldfish, as detailed below (see flowchart). Figure 1 ):

[0034] 1. CRISPR / Cas9 target site design

[0035] According to goldfish raw The CDS sequence of the gene (NCBI: GCF_003368295.1) was used as the primer for designing primers in the conserved region. Then, goldfish ovarian cDNA was used as a template for amplification. Sequencing of the PCR product yielded the goldfish cDNA. raw The true CDS sequence of the gene was obtained. The genome was then amplified using the same primers, further confirming the identity of the goldfish. raw A partial genomic sequence of the gene was used, and a target was designed for this gene on the website http: / / zifit.partners.org / ZiFiT / . Figure 2 ).

[0036] The specific amplification primers are as follows:

[0037] Ca- raw -yz-gRNA2-F1: 5'-GTGACATGTTCTGCCCTTGA-3';

[0038] Ca- raw -yz-gRNA2-R1: 5'-CTCGGCATCCCAAATATCTAC-3'.

[0039] The amplification system is as follows:

[0040]

[0041] The amplification procedure is as follows:

[0042]

[0043] Ultimately, an effective target was found: Ca- raw -target:5'-GGGATGGATCACCAGCAGTT CGG -3'. The underlined sequence indicates the PAM region.

[0044] 2. Synthesis of gRNA and mRNA

[0045] All consumables and solutions used in RNA preparation should be RNase-free. gRNA synthesis uses plasmid pT7-gRNA as a template and target-specific primers. raw The gRNA template for the target site was obtained by amplification using gRNA-F and the universal reverse primer gRNA-RP.

[0046] Among them, the forward primer raw gRNA-F sequence: 5'-TAATACGACTCACTATAGGGATGGATCACCAGCAGTTGTTTTAGAGCTAGAA-3'; reverse primer gRNA-RP sequence: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3';

[0047] The amplification system is as follows:

[0048]

[0049] The amplification procedure is as follows:

[0050]

[0051] The amplification product obtained in the previous step was purified and transcribed using the MAXIscript T7 Kit (Ambion, USA) to obtain the corresponding gRNA. The system is as follows:

[0052]

[0053] The reaction conditions are as follows: After bathing in a 37°C water bath for 2-5 hours, add 2 μL DNaseI + 2.5 μL 10× Buffer, bathe in a 37°C water bath for 15 minutes to remove the DNA template, precipitate with 8M LiCl at -20°C for more than half an hour, and finally purify and recover with 75% ethanol.

[0054] mRNA synthesis: The plasmid used to prepare mRNA was linearized with restriction endonucleases and then transcribed into mRNA using the mMessage mMachine MLtraKit (Ambion, USA) in vitro transcription kit. The system is as follows:

[0055]

[0056] After incubating in a 37°C water bath for 2 hours, add 1 μL of Turbo DNase and incubate in a 37°C water bath for 15 minutes to remove the DNA template. Then purify and recover the DNA. The steps are as follows:

[0057] (1) Add 20 μL of 5M ammonium acetate, mix thoroughly, and let stand at -20°C for 30 min to terminate the reaction and precipitate RNA.

[0058] (2) Centrifuge at 4°C and maximum speed for 15 min in a refrigerated centrifuge to precipitate and aggregate RNA.

[0059] (3) Carefully remove the supernatant, add 1 mL of 70% anhydrous ethanol (RNAase-free) to wash the precipitate, and centrifuge at 4°C for 5 min at the maximum speed to remove unbound nucleic acids.

[0060] (4) Carefully remove 70% anhydrous ethanol and allow the RNA sample to dry at room temperature.

[0061] (5) Add 10 μL of RNAase-free water to dissolve the RNA sample and place it on ice for 10-20 min to allow it to dissolve completely.

[0062] (6) Take 0.5 μL, dilute it 10 times, measure the concentration and run gel electrophoresis. If there are no quality problems, freeze it at -80℃.

[0063] 3. Goldfish breeding and embryo collection

[0064] The goldfish were injected with oxytocin the day before, using a standard dose of 50 μL containing 2 μg domperidone (DOM) + 3 ng gonadotropin-releasing hormone (LRH-A2). The following morning, the female was anesthetized with 1×MS-222. After drying her body, her abdomen was gently pressed to collect mature eggs in a spoon. The male was then anesthetized with 1×MS-222. After drying his body, a 10 μL pipette was used to extract milky white semen from the vent, which was then placed in 1 mL of Hank's Buffer. After mixing thoroughly, 200 μL of semen was added to the eggs. The spoon was gently rotated to ensure full contact between the semen and eggs. The spoon was then quickly placed into a glass culture dish containing an appropriate amount of culture water. The spoon and dish were rapidly shaken to evenly distribute the embryos at the bottom of the dish. After 5 minutes, once fertilization was complete, the dish was rinsed three times with culture water to remove any remaining sperm. Subsequent culture or micromanipulation experiments were then conducted.

[0065] 4. Microinjection of embryos

[0066] (1) Prepare the sample for microinjection according to the following system:

[0067]

[0068] Note that both the sample and phenol red must be centrifuged for 2 minutes using a high-speed centrifuge before use to prevent impurities from clogging the injection needle during microinjection.

[0069] (2) Preparation of injection needles: Select a capillary tube with a drainage core, and use a horizontal needle puller to adjust the parameters to pull out a sufficient number of micro-injection needles.

[0070] (3) Embryo collection: According to the experimental requirements (see step 3: goldfish feeding and embryo collection for operation details), complete the spawning of the required experimental fish one night in advance. After the photocycle begins on the second day, collect the fertilized eggs at the 1-cell stage required for injection.

[0071] (4) Preparation before injection: Open the main nitrogen valve, nitrogen buffer valve, microinjector and stereomicroscope in sequence. Use a pipette to transfer 1 μL of sample for injection to the top of the capillary. Under the action of the flow guide, the sample will fall to the tip of the injection needle after a few minutes. Use the fine-tipped tweezers for microscopic fine manipulation to slowly cut off the excess tip of the injection needle. Then step on the foot pedal of the injector and observe the size of the sample droplet flowing out of the needle tip, and adjust the sample volume accordingly.

[0072] (5) Microinjection: When injecting the recipient sample, wait until the animal pole of the 1-cell stage embryo bulges. Once the embryo has developed to the appropriate injection time, collect the embryo in a new 90mm petri dish, remove excess water, and inject using the dry method. Tilt the injection needle at approximately 45° to penetrate the oocyte membrane and insert it into the animal pole of the embryo, injecting 1 nL of sample into each embryo. After injection, close the stereo microscope, nitrogen buffer valve, nitrogen main valve, and release residual nitrogen in the tube in sequence before turning off the injection apparatus.

[0073] 5. Preparation of recipient fish for endoscopic reproduction

[0074] To completely eliminate its own primordial germ cells (PGCs) and prevent them from competing with exogenous PGCs, thus enabling better early colonization, this method is specifically designed for rare gudgeon. dead end The gene was engineered to produce morpholino (MO: 5'-CTTCATAAGCGGATAACGACATGGA-3') using early knockdown. dead end The method is to remove its PGC (Weidinger et al., 2003, Zhang et al., 2020).

[0075] 6. Isolation, identification, and transplantation of goldfish reproductive stem cells

[0076] First, 3-month-old male F0 generation gene-edited goldfish were anesthetized and their testes were dissected. Testicular tissue from one 3-month-old individual was collected, minced, and placed in 2mL centrifuge tubes. 50mg of the minced tissue was added to each tube, and trypsin and collagenase were added. The mixture was then enzymatically digested in a 35℃ water bath. After approximately one hour of digestion, a drop of cell suspension was collected and examined under a microscope. If a large number of dispersed cells were observed, the mixture was filtered through a 40μm sieve. Germ stem cells (GSCs) were then purified using Percoll density gradient centrifugation. To determine the enrichment location of GSCs in the Percoll gradient, immunofluorescence analysis of the cell suspension at the interfaces of each density layer from 20% to 60% was performed. The results showed that GSCs were present in all gradient layers from 25% to 40%, with the highest content in the 35% layer. The 50% and 60% layers were almost entirely composed of sperm cells and mature sperm. Cell counting statistics showed that an average of 1.75 × 10⁶ cells were obtained from the 35% and 40% gradient layers per donor fish. 4 and 5.4×10 3 GSCs were collected. Finally, cells from gradient layers of 35% and 40% were used as donors for GSCT experiments. The purified GSCs were transplanted into rare gudgeon juveniles whose endogenous germ cells had been effectively eliminated. Five days post-transplantation, fluorescence of germ cells could be detected at the genital ridge of the rare gudgeon. Figure 3 It is expected that gene-edited goldfish sperm can be obtained after 3-4 months of careful breeding.

[0077] 7. Obtaining Gene-Edited Goldfish

[0078] The rare male gudgeon recipient fish from GSCT developed to 3.5 months of age, and 4 out of 12 were able to rapidly produce offspring. raw The success rate of gene-edited goldfish sperm was 33.3%. raw Genetically edited GSCT-positive semen was testcrossed with wild-type goldfish eggs to produce F1 generation goldfish embryos. All gene-edited GSCT embryos developed normally, and gene-edited goldfish were obtained through culture.

[0079] Extract the genome from F1 generation embryos and use it as a template for amplification. raw Knocking out sequences near the target site and performing Sanger sequencing on the PCR products revealed that all four rare gudgeon recipient fish were able to produce [the desired PCR product]. raw Gene-edited goldfish sperm and raw Successfully edited F1 generation goldfish embryos ( Figure 4 ).

[0080] After five months of careful feeding and multiple induced spawning cycles, the female rare gudgeon recipient fish of the GSCT (Gudgeon Crossing) were found to have matured eggs that could be released from the cloaca of the recipient fish. rawGene-edited GSCT-positive eggs were self-fertilized with GSCT-positive goldfish sperm to produce F1 embryos. All gene-edited GSCT embryos developed normally and grew into goldfish. Figure 5 ).

[0081] In summary, this application uses rare gudgeon, a Chinese experimental fish with a clear genetic sex system, as the recipient and gene-edited goldfish from across subfamilies as the donor to conduct research on surrogate reproduction. The results show that goldfish-derived reproductive cells can colonize and differentiate in the gonadal microenvironment of rare gudgeon, ultimately producing gene-edited goldfish-derived sperm and eggs with normal developmental functions. Gene-edited goldfish can be further obtained through self-fertilization.

[0082] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0083] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for rapidly producing gene-edited goldfish, characterized in that, Includes the following steps: S1, Targeting the rare gudgeon dead end The gene morpholino was designed and injected to obtain rare gudgeon with primordial germ cells removed, which were then used as recipient fish. S2, for goldfish amh Gene design target: Cas9 / gRNA complex was introduced into goldfish 1-cell stage fertilized eggs, and the mutant individuals were obtained by embryonic mixed sequencing verification. They were then raised and used as donor fish. S3. Remove the gonads of the donor fish from S2, cut them into pieces, digest them with enzymes, filter them, and then enrich the reproductive stem cells of the donor fish using the Percoll density gradient centrifugation method. S4. Transplant the donor fish reproductive stem cells from S3 into the juvenile fish of the recipient fish in S1, and raise them to obtain gene-edited goldfish sperm and eggs. S5, the rare gudgeon produced in S4 amh By hybridizing the sperm and eggs of genetically mutated goldfish, F1 embryos are produced. These embryos are then raised to obtain individual genetically edited goldfish.

2. The method according to claim 1, characterized in that, The morpholino sequence mentioned in step S1 is: 5'-CTTCATAAGCGGATAACGACATGGA-3'.

3. The method according to claim 1, characterized in that, The gRNA target sequence in step S2 is as follows: GGGATGGATCACCAGCAGTTCGG; The primers for gRNA amplification in the Cas9 / gRNA complex are: 5'-TAATACGACTCACTATAGGGATGGATCACCAGCAGTTGTTTTAGAGCTAGAA-3'.

4. The method according to claim 3, characterized in that, When obtaining gRNA, plasmid pT7-gRNA was used as a template, and the amplification primers are as follows: forward primer amh -gRNA-F sequence: 5'-GGGATGGATCACCAGCAGTTCGG-3'; Reverse primer gRNA-RP sequence: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'.

5. The method according to claim 3, characterized in that, The Cas9 / gRNA complex was calculated in 5 μL volumes: gRNA and Cas9 mRNA were both 100 ng / μL, 5×phenol red was 1 μL, and the remainder was RNase-free ddH2O.

6. The method according to claim 1, characterized in that, In step S3, enzymatic digestion is carried out using trypsin and collagenase at 35°C. The filtration process uses a sieve with a pore size of 40 μm; The concentration of the Percoll separation solution is 25%-40%.

7. The application of the method according to any one of claims 1-6 in goldfish genetic breeding.

Images