Fermentation method of escherichia coli EcN for producing heparin precursor polysaccharide

Abstract

The invention relates to the technical field of heparin precursor polysaccharides, and discloses a fermentation method of escherichia coli EcN for producing heparin precursor polysaccharides. In order to improve the yield of the heparin precursor polysaccharide, when escherichia coli EcN is fermented until the concentration of residual sugar in fermentation liquor is 8-10g / L, the method is realized by supplementing materials in stages, specifically, a glucose solution is supplemented into the fermentation liquor at the rate of 12-16g / (L.h), and the total time is 10-14 hours; then supplementing the glucose solution at the rate of 7-10g / (L.h) until the fermentation is finished; and supplementing salt while supplementing the glucose solution, so that the final concentration of the salt in the glucose solution is as follows: 7-15g / L of KH2PO4 and 8-12g / L of MgSO4. The method provided by the invention effectively solves the problems of unreasonable material supplementation, high salt inhibition and the like, and obviously improves the yield of the heparin precursor polysaccharide.

Description

Technical Field

[0001] This invention relates to the field of heparin precursor polysaccharide technology, and more particularly to a fermentation method of Escherichia coli (EcN) for producing heparin precursor polysaccharides. Background Technology

[0002] N-acetylheparosan, a precursor polysaccharide, is a polydisperse glycosaminoglycan with a homogeneous structure composed of alternating repeating N-acetylglucosamine (GlcNAc) and glucuronic acid (GlcA). It serves as a precursor for heparin synthesis. Heparin is a widely used anticoagulant in clinical practice, traditionally extracted primarily from porcine intestinal mucosa or bovine lungs. However, this extraction method suffers from limitations in raw material sources, risks of pathogen contamination, and batch-to-batch quality instability. Microbial fermentation synthesis of heparosan, due to its high structural similarity to heparin, controllable production process, and absence of animal-derived contamination, has become an important alternative to traditional extraction methods.

[0003] In the existing technology, Escherichia coli K5 is the most widely studied heparosan producing strain, but its potential pathogenicity limits its application in pharmaceutical production.

[0004] In addition, existing technologies include constructing genetically engineered bacteria by modularly regulating the synthesis pathway of heparin precursor polysaccharides, thereby increasing the yield of heparin precursor polysaccharides in engineered bacteria. For example, Chinese patent application CN117460835A discloses a recombinant cell for producing heparin precursors. This patent application increases the yield of heparin precursors by introducing nucleic acids encoding a polypeptide with heparin precursor synthase (HSS) activity and nucleic acids encoding a polypeptide with UDP-glucose dehydrogenase (UDP-GlcDH or HASB) activity into yeast. However, the method of this patent still has limited effectiveness in increasing the yield of heparin precursors.

[0005] Escherichia coli Nissle 1917 (EcN), as a probiotic, boasts high safety; however, its fermentation process has not been systematically optimized, and its yield falls far short of industrial-scale requirements. Existing processes suffer from osmotic pressure inhibition due to high salt concentrations and inappropriate feeding strategies, severely hindering its industrialization. Therefore, it is urgent to propose an engineered strain for producing heparin precursors using Escherichia coli Nissle 1917 as the substrate bacterium and its fermentation method. Summary of the Invention

[0006] To address the technical problem of low yield of heparin precursor from Escherichia coli (EcN), this invention provides a fermentation method for producing heparin precursor polysaccharides from Escherichia coli.

[0007] The specific technical solution of this invention is as follows: This invention provides a fermentation method for producing heparin precursor polysaccharide from Escherichia coli (EcN), comprising the following steps: Inoculate Escherichia coli (EcN) into the fermentation medium and ferment until the residual sugar concentration in the fermentation broth reaches 8-10 g / L. Then, feed the bacteria using the following method: Add glucose solution to the fermentation broth at a rate of 12-16 g / (L·h) for a total of 10-14 hours, based on the glucose feeding rate; then add glucose solution at a rate of 7-10 g / (L·h) until fermentation is complete; the concentration of the glucose solution is 480-520 g / L. While adding glucose solution, salt is also added to make the final salt concentration in the glucose solution: KH2PO4 7~15 g / L, MgSO4 8~12 g / L.

[0008] To increase the yield of heparin precursor polysaccharides, this invention employs a staged feeding method during the fermentation of *E. coli* (EcN) until the residual sugar concentration in the fermentation broth reaches 8-10 g / L. Specifically, glucose solution is added to the fermentation broth at a rate of 12-16 g / (L·h) for a total of 10-14 hours; then, glucose solution is added at a rate of 7-10 g / (L·h) until fermentation is complete. Simultaneously with the addition of glucose solution, salt is added to achieve a final salt concentration of 7-15 g / L KH₂PO₄ and 8-12 g / L MgSO₄ in the glucose solution. This method effectively solves problems such as unreasonable feeding and high salt inhibition, significantly improving the yield of heparin precursor polysaccharides.

[0009] Preferably, the *Escherichia coli* EcN is constructed by overexpressing the glmS, kfiD, kfiA, kfiC, kpsS, kpsT, and kpsM genes in an *EcN* strain with the genotype EcN / ΔendA / ΔpfkA. This invention uses the production of heparin precursor polysaccharide as an example to verify the effectiveness of the fermentation method of this invention.

[0010] Preferably, the nucleotide sequence of the glmS gene is shown in SEQ ID NO.1; the nucleotide sequence of the kfiD gene is shown in SEQ ID NO.2; the nucleotide sequence of the kfiA gene is shown in SEQ ID NO.5; the nucleotide sequence of the kfiC gene is shown in SEQ ID NO.6; the nucleotide sequence of the kpsS gene is shown in SEQ ID NO.7; the nucleotide sequence of the kpsT gene is shown in SEQ ID NO.8; the nucleotide sequence of the kpsM gene is shown in SEQ ID NO.9; the nucleotide sequence of the endA gene is shown in SEQ ID NO.10; and the nucleotide sequence of the pfkA gene is shown in SEQ ID NO.11.

[0011] Preferably, the fermentation medium has the following composition: The following ingredients are listed: glucose monohydrate 25~30 g / L, KH2PO4 10~15 g / L, (NH4)2HPO4 10~15 g / L, MgSO4 3~5 g / L, citric acid 5~10 g / L, trace element solution 0.8~1.2 mL / L, and defoamer 1.5~3 g / L.

[0012] Preferably, the trace element solution has the following composition: Ferrous sulfate heptahydrate 20 g / L, manganese sulfate tetrahydrate 2.5 g / L, copper sulfate pentahydrate 2 g / L, ammonium molybdate tetrahydrate 1 g / L, sodium borate decahydrate 2 g / L.

[0013] Preferably, the fermentation temperature is 35~39℃.

[0014] Preferably, the pH is controlled at 6.5~7.5 during the fermentation process.

[0015] Preferably, the dissolved oxygen in the fermentation broth is controlled to be at least 30% during the fermentation process.

[0016] Based on the above fermentation method, the present invention provides a heparin precursor polysaccharide prepared by the above method.

[0017] Compared with the prior art, the present invention has the following technical effects: To increase the yield of heparin precursor polysaccharide, this invention employs a staged feeding method during the fermentation of *E. coli* (EcN) until the residual sugar concentration in the fermentation broth reaches 8-10 g / L. Specifically, glucose solution is added to the fermentation broth at a rate of 12-16 g / (L·h) for 10-14 hours; then, glucose solution is added at a rate of 7-10 g / (L·h) until fermentation is complete. Simultaneously with the addition of glucose solution, salt is added to achieve a final salt concentration of 7-15 g / L KH₂PO₄ and 8-12 g / L MgSO₄ in the glucose solution. This method effectively solves problems such as unreasonable feeding and high salt inhibition, significantly improving the yield of heparin precursor polysaccharide. Using the engineered strain HPZ8 for heparin precursor polysaccharide production, combined with the above fermentation method, this invention ultimately achieves a heparin precursor polysaccharide titer of 13.3 g / L in a 20 L fermentation volume after 24 hours of fermentation. Attached Figure Description

[0018] Figure 1 This is a graph showing the fermentation process under the constant-rate feeding strategy in Example 2; Figure 2 This is a graph showing the fermentation process under the pH feeding strategy in Example 3; Figure 3This is a fermentation curve diagram under the segmented step-by-step feeding strategy of Example 4; Figure 4 This is a fermentation curve showing the ionic strength of the optimized fed-batch culture medium in Example 5; Figure 5 This is a fermentation curve of optimized trace elements in Example 6; Figure 6 The proton NMR spectrum of heparin precursor polysaccharide products ( 1 (HNMR) image. Detailed Implementation

[0019] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0020] In the following examples, the LB solid medium consisted of: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar powder, and pH 7.0. The LLB liquid medium consisted of: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L sodium chloride, and pH 7.0. The initial fermentation medium consisted of: 27 g / L glucose monohydrate, 14 g / L KH₂PO₄, 14 g / L (NH₄)₂HPO₄, 4 g / L MgSO₄·7H₂O, 7 g / L citric acid, 2 mL / L trace element solution, and 2 g / L defoamer, and pH 7.0. The trace element solution consisted of: 20 g / L ferrous sulfate heptahydrate, 2.5 g / L manganese sulfate tetrahydrate, 2 g / L copper sulfate pentahydrate, 1 g / L ammonium molybdate tetrahydrate, and 2 g / L sodium borate decahydrate.

[0021] In the following examples, the content of heparin precursor polysaccharide was detected using the sulfuric acid-carbazole method. The detection method was as follows: (1) Borax-sulfuric acid solution: 18.068 g of sodium borate decahydrate (Na2B4O7·10H2O) was accurately weighed, dissolved in concentrated sulfuric acid, and diluted to 1 L. (2) Carbazole solution: 0.125 g of carbazole was accurately weighed, dissolved in anhydrous ethanol, and diluted to 100 mL. The solution was stored in a brown bottle and kept at 4°C protected from light. During the determination, 1 mL of sample was taken, and 5 mL of borax-sulfuric acid solution in an ice bath was slowly added. After shaking gently, the sample was placed in ice and cooled repeatedly until the heat release was complete. Then, the sample was heated in boiling water for 10 minutes and quickly cooled to room temperature with cold water. Then, 0.2 mL of carbazole solution was added, mixed well, and quickly cooled. Then, the sample was heated in boiling water for 15 minutes and cooled to room temperature again before measuring the OD.530 If the OD value exceeds the linear range, the sample should be appropriately diluted. For quantitative analysis, a standard curve was prepared using glucuronic acid as a standard: 20 mg of glucuronic acid was diluted to 100 mL to obtain a stock solution. Then, 0.5, 1.0, 1.5, 2.0, and 2.5 mL of the stock solution were diluted to 10 mL to prepare standard solutions of 10, 20, 30, 40, and 50 mg / L, respectively, and the OD values ​​were determined using the same method. 530 Value. OD is calculated by plotting glucuronic acid concentration (X, mg / L) on the x-axis. 530 Linear regression was performed with the value (Y) as the ordinate, and the equation Y = 0.0173X + 0.0052 (R² = 0.9999) was obtained. The results showed that heparosan had a good linear relationship in the concentration range of 0–329.960 mg / L. (3) After fermentation was completed, 1 mL of fermentation broth was taken, centrifuged at 12000 rpm for 1 min, the supernatant was separated, and the absorbance of the supernatant was measured at a wavelength of 530 nm. The content of heparin precursor polysaccharide was calculated according to the standard curve of glucuronic acid mentioned above.

[0022] Information about the primers involved in the following embodiments is shown in Table 1.

[0023] Table 1 Primer Name Sequence (5'-3') pTDL-F CTGCAGAAGCTTAGATCTATTACCC pTDL-R TCTAGAGAATTCAAAAAAAGCACCG Trc-F TTGACAATTAATCATCCGGC kfiD-R TTAGTCACATTTAAACAAATCG PTM-yeeP-F TAATACTAGTCATTCGTGAGAAAACAGATGGTTTTAGAGCTAGAAATAGC PTM-yeeP-R GCTCTAAAACCATCTGTTTTCTCACGAATGACTAGTATTATACCTAGGAC yeeP-up-F CTTTTTTTGAATTCTCTAGAGCAGGAAGATAAAGTCAATG yeeP-up-R GCCGGATGATTAATTGTCAAAAACAGCACCTGCTGATGTC yeeP-down-F CGATTTGTTTAAATGTGACTAAACACTCTGCCAGGGGAAATG yeeP-down-R ATAGATCTAAGCTTCTGCAGAGTAGTGTTGTTGGCGATAC PTM-yeeL-F TAATACTAGTAGCATAAATTGCAACAACAGGTTTTAGAGCTAGAAATAGC PTM-yeeL-R GCTCTAAAACCTGTTGTTGCAATTTATGCTACTAGTATTATACCTAGGAC yeeL-up-F CTTTTTTTGAATTCTCTAGACAACCAGTCATCACTGAAAG yeeL-up-R GCCGGATGATTAATTGTCAAGGCAGTACTTATGCATAGTA yeeL-down-F CGATTTGTTTAAATGTGACTAAAACTAACCTCGCCTCCCTAC yeeL-down-R ATAGATCTAAGCTTCTGCAGAGTGTCACCAGCAAAATAGG PTM-lafU-F TAATACTAGTGAGATGGAGATTGTTCCCCAGTTTTAGAGCTAGAAATAGC PTM-lafU-R GCTCTAAAACTGGGGAACAATCTCCATCTCACTAGTATTATACCTAGGAC pETL-F AAGCTTGCGGCCGCATAATG pETL-R GAATTCCATGGTCTGTTTCCTG kfiA-F GGAAACAGACCATGGAATTCATGATTGTTGCAAATATGTCATC kfiA-R TTACCCTTCCACATTATACAC kfiC-F TGTATAATGTGGAAGGGTAATTTCACAGGAAACAGACCATGAACGCGAATATAAATT kfiC-R cattatgcggccgcaagcttCTATTGTTCAATTATTCCTGA pCDFL1-F aagcttgcggccgcataatg pCDFL1-R GAATTCCATGGTCTGTTTCCTG pCDFL2-F TTAACCTAGGCTGCTGCC pCDFL2-R ATTTCGATTATGCGGCCGTG kpsC-F GGAAACAGACCATGGAATTCATGATTGGCATTTACTCGCC kpsC-R CATTATGCGGCCGCAAGCTTTTAGCCAAATCTGACCTTGC kpsS-F GGAAACAGACCATGGAATTCATGCAAGGTAATGCACTAAC kpsS-R CATTATGCGGCCGCAAGCTTTTAATAAACCGCATTAACC kpsC-F2 CACGGCCGCATAATCGAAATTTGACAATTAATCATCCGGC kpsC-R2 GTGGCAGCAGCCTAGGTTAATTAGCCAAATCTGACCTTGC kpsE-F GGAAACAGACCATGGAATTCATGTTGATAAAAGTGAAGTCTG kpsE-R CATTATGCGGCCGCAAGCTTTTAGTCTCGGTGATCTTCAAT kpsD-F GGAAACAGACCATGGAATTCATCAATTTTAATCAATTTTAC kpsD-R CATTATGCGGCCGCAAGCTTTTACAAAGACAGAATCACTTT kpsD-F2 CACGGCCGCATAATCGAAATTTGACAATTAATCATCCGGC kpsD-R2 GTGGCAGCAGCCTAGGTTAATTACAAAGACAGAATCACTTT kpsT-F GGAAACAGACCATGGAATTCATGATTGATTGAATTTGAC kpsT-R CATTATGCGGCCGCAAGCTTTCATTCAATATCTAAAGCTTG kpsM-F GGAAACAGACCATGGAATTCATGGCAAGAAGTGGATTTGA kpsM-R CATTATGCGGCCGCAAGCTTTCATGATGTCAGCATTGCC kpsM-F2 CACGGCCGCATAATCGAAATTTGACAATTAATCATCCGGC kpsM-R2 GTGGCAGCAGCCTAGGTTAATCATGATGTCAGCATTGCC kpsTM-LF TTAACCTAGGCTGCTGCCAC kpsTM-LR TCATGATGTCAGCATTGCC kpsS-TM-F AGGCAATGCTGACATCATGATTTCACACAGGAAACAGACCATGCAAGGTAATGCACTAAC kpsS-TM-R GTGGCAGCAGCCTAGGTTAATTAATAATAAACCGCATTAACC Example 1: Construction of engineered strain HPZ8 for producing heparin precursor polysaccharide Using Escherichia coli Nissle 1917 (EcN) with genotype EcN / ΔendA / ΔpfkA as the substrate bacteria (denoted as strain HPZ1), the engineered bacteria HPZ8, which produces heparin precursor polysaccharide, was constructed by overexpressing the glmS, kfiD, kfiA, kfiC, kpsS, kpsT, and kpsM genes.

[0024] The nucleotide sequences of the glmS gene are shown in SEQ ID NO.1; the kfiD gene is shown in SEQ ID NO.2; the kfiA gene is shown in SEQ ID NO.5; the kfiC gene is shown in SEQ ID NO.6; the kpsS gene is shown in SEQ ID NO.7; the kpsT gene is shown in SEQ ID NO.8; the kpsM gene is shown in SEQ ID NO.9; the endA gene is shown in SEQ ID NO.10; and the pfkA gene is shown in SEQ ID NO.11.

[0025] The construction process is as follows: (1) Construction of plasmid pTarget-yeeP::glmS-kfiD The 20 bp preceding the PAM site within the coding sequence of the yeeP gene (nucleotide sequence shown in SEQ ID NO.3) was selected as the sgRNA. Primers PTM-yeeP-F / PTM-yeeP-R were designed for PCR amplification using the original pTarget plasmid as a template. The original plasmid template was eliminated by adding restriction endonuclease Dpn I to the amplified PCR product, followed by digestion at 37℃ for 1 h and then inactivation at 80℃ for 5 min. Subsequently, the digested product was linearized by PCR amplification using primers PTDL-F / PTDL-R. Simultaneously, two primer pairs, yeeP-up-F / yeeP-up-R and yeeP-down-F / yeeP-down-R, were used to amplify the upper homologous fragment Up and the lower homologous fragment Down using the EcN genome as a template, respectively. The glmS-kfiD gene fragment was amplified using primers Trc-F / kfiD-R with plasmid pETduet-glmS-kfiD as a template. Next, using yeeP-up-F / yeeP-down-R as primers, and the homologous fragments Up and Down, along with the glmS-kfiD gene fragment as templates, fusion PCR was performed to obtain the DNA fragment Donor (Up+glmS-kfiD+Down). The DNA fragment Donor and the linearized pTarget were purified using a PCR Cleanup kit, and the concentration and purity of the DNA fragment were determined using Nano Drop. Finally, Donor and the linearized pTarget were ligated into a circular plasmid using the ClonExpress One Step Cloning Kit. Ligation was performed at 50°C for 1 h, followed by incubation at 4°C on ice. The reaction product was then transformed into DH5α competent cells. Once a single colony grew, the plasmid construction was verified, and the plasmid was extracted.

[0026] (2) Preparation of HPZ1 transcompetent cells and construction of HPZ1 / pEcCas strain Strain HPZ1 was activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar and cultured overnight at 37°C. 1 mL of seed culture was then transferred to 100 mL of LB agar and cultured at 37°C until the bacterial concentration (OD500) reached the target concentration. 600The concentration of the bacterial culture was approximately 0.5. The bacterial culture was placed on ice for 10 min, centrifuged at 5500 rpm for 6 min to collect the bacterial cells, and the supernatant was discarded. 50 mL of pre-cooled and sterilized 0.1 M CaCl2 solution was added, mixed thoroughly, and incubated on ice for 30 min. The culture was then centrifuged at 6000 rpm for 6 min to collect the bacterial cells, and the supernatant was discarded. Based on the bacterial volume, 500 μL–1 mL of pre-cooled and sterilized 0.1 M CaCl2 solution containing 15% glycerol was added to resuspend the bacterial cells. The cells were then aliquoted and stored at -80°C.

[0027] Take 100 μL of the above competent cells, thaw them completely, add about 300 ng of pEcCas plasmid, incubate on ice for 30 min, then heat shock in a 42℃ water bath for 90 s, immediately place on ice for 5 min, add 800 μL of pre-cooled and sterilized LB liquid medium, incubate at 37℃ and 180 rpm on a shaker for 30 min, centrifuge at 5500 rpm for 2 min, aspirate the excess supernatant, resuspend the cells and spread them on solid medium containing Kan resistance, incubate overnight at 37℃, and verify by colony PCR whether the pEcCas plasmid was successfully introduced into strain HPZ1.

[0028] (3) Preparation of electrocompetent strains HPZ1 / pEcCas and construction of strain HPZ2 The strain HPZ1 / pEcCas was activated by streaking on LB solid medium containing Kan resistance and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB medium, with 1% L-Ara and 1‰ Kan added. The mixture was then incubated overnight at 37°C. Subsequently, 1 mL was transferred to a 50 mL LB shake flask, with 1% L-Ara and 1‰ Kan added, and cultured until OD was reached. 600 To approximately 0.6. Place the shake flask on ice for 10 min, centrifuge at 5500 rpm for 6 min to collect the bacterial cells, discard the supernatant, add 50 mL of pre-chilled sterile deionized water, resuspend thoroughly, centrifuge at 6000 rpm for 6 min to collect the bacterial cells, add deionized water again to wash, centrifuge at 6000 rpm for 6 min to collect the bacterial cells, and add 500 μL-1 mL of pre-chilled sterile deionized water containing 10% glycerol according to the bacterial cell volume, resuspend the bacterial cells and aliquot, and store at -80℃.

[0029] The HPZ1 / pEcCas electrotransfer competent cells were placed on ice and allowed to thaw naturally. 500 ng of pTarget-yeeP::glmS-kfiD plasmid was added, and the mixture was gently pipetted and transferred to a dried 0.2 cm diameter electrode cup. The cup was shaken to remove internal air bubbles and external moisture was wiped away. The electroporator was set to level 2 to electroporate the electrode cup, and 800 μL of pre-cooled and sterilized LB liquid medium was immediately added. The cells were incubated at 37°C for 4 h on a shaker. The cells were then collected and plated onto LB solid medium containing Kan and SD antibodies, and incubated overnight at 37°C. After single colonies grew, colony PCR and sequencing were used to verify successful editing.

[0030] (4) Elimination of HPZ2 strain plasmid To reduce the metabolic stress on the bacteria, plasmids need to be eliminated after successful gene editing. A single colony is picked and inoculated onto LB agar, with 1% (1 M) L-rhamnose (L-Rha) and Kan resistance added. The culture is incubated at 37°C with shaking for 12 h, then streaked onto Kan-only solid medium and incubated overnight at 37°C. Once a single colony grows, it is spotted onto LB agar containing SD resistance to verify successful pTarget elimination. Alternatively, a single colony with successfully eliminated pTarget is picked and inoculated onto LB agar, incubated at 37°C with shaking for 12 h, then streaked onto antibiotic-free solid medium containing glucose and sucrose and incubated at 37°C. Once a single colony grows, it is spotted onto agar-containing plates to verify successful pEcCas elimination. The successfully eliminated single colony is identified as strain HPZ2.

[0031] (5) Following the methods in steps (1) to (4), the pseudogene yeeL (nucleotide sequence as shown in SEQ ID NO.4) in the genome of strain HPZ2 is replaced with the glmS-kfiD gene expression cassette to construct engineered strain HPZ3.

[0032] (6) Construction of overexpression plasmid pETduet-kfiAC and strain HPZ4 Using the EcN genome as a template, kfiA and kfiC gene fragments were amplified by PCR using two primer pairs, kfiA-F / kfiA-R and kfiC-F / kfiC-R, respectively. Then, using the kfiA and kfiC gene fragments as templates, fusion PCR was performed using kfiA-F / kfiC-R primers to obtain the kfiAC gene fragment, which has 20 bp homologous regions upstream and downstream of the pETduet-1 plasmid. Using universal primers pETL-F and pETL-R, the pETduet-1 plasmid was linearized at the multiple cloning site. The kfiAC gene fragment was ligated and circularized with the linearized pETduet-1 using the ClonExpressOneStepCloning Kit and introduced into DH5α competent cells. After single-cell growth, the overexpression plasmid pETduet-kfiAC was obtained by colony PCR and sequencing verification. Following the method in step (2), HPZ3 was converted into competent cells. The overexpression plasmid pETduet-kfiAC was then transformed into competent cells of HPZ3. After single colonies grew, HPZ4 was obtained by colony PCR and sequencing verification.

[0033] (7) Construction of overexpression plasmid pCDFduet-kpsSTM and strain HPZ8 Using the EcN genome as a template, the fragment was amplified by PCR using kpsS-TM-F and kpsS-TM-R primers to obtain the kpsS gene fragment, which has a 20 bp homology with the upstream of the pCDFduet-kpsTM plasmid and the downstream of the kpsM gene. The pCDFduet-kpsTM plasmid was linearized using primers kpsTM-LF and kpsTM-LR. Then, the kpsS gene fragment was ligated and circularized with the linearized pCDFduet-kpsTM plasmid using the ClonExpressOneStepCloningKit and introduced into DH5α competent cells. The overexpression plasmid pCDFduet-kpsSTM was obtained after single colony growth. The primers involved are shown in Table 1. Following the method in step (6), pCDFduet-kpsSTM was introduced into the competent cells of strain HPZ4. After single colony growth, strain HPZ8 was obtained by colony PCR and sequencing.

[0034] The starting strain HPZ1, engineered strains HPZ2, HPZ3, HPZ4, and HPZ8 were activated by streaking on LB solid medium and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB medium and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of initial fermentation medium for fermentation for 16 h. The starting strain HPZ1 was used as a control. After fermentation, the fermentation broth was centrifuged and the supernatant was collected. The content of heparin precursor polysaccharide was detected using the sulfuric acid-carbazole method. The results are shown in Table 2.

[0035] Table 2 Heparin precursor polysaccharide potency (mg / L) HPZ2 280.5 HPZ3 311.4 HPZ4 403.2 HPZ8 521.6 Starting strain HPZ1 205.8 Example 2: Constant-rate fed-batch fermentation of engineered strain HPZ8 This embodiment uses the engineered strain HPZ8, constructed in Example 1, for producing heparin precursor polysaccharides, and performs 20L fermentation. The fermentation steps are as follows: 1. Seed culture preparation: The engineered strain HPZ8 was taken from a -80°C glycerol storage tube, streaked onto an LB agar plate, and incubated at 37°C for 16 hours to obtain single colonies. One plump single colony was picked and inoculated into a 250 mL shake flask containing 50 mL of LLB liquid medium. The flask was then incubated at 37°C and 220 rpm for 16 hours to obtain the primary seed culture. At an inoculation rate of 1% (v / v), the primary seed culture was transferred to a 3 L shake flask containing 1 L (two 1 L flasks) of fresh LLB medium. The flasks were incubated under the same conditions (37°C, 220 rpm) for another 8 hours until OD (dose retardation) was reached. 600 It is rated at 9.0, and is used as a secondary seed solution.

[0036] 2. Fermentation Culture: All secondary seed culture was inoculated into a 50 L fermenter (Shanghai Baoxing Bio-Equipment Engineering Co., Ltd.). The initial fermentation working volume was 20 L, consisting of 18 L of seed culture and 2 L of seed culture. The fermentation control parameters were set as follows: temperature 37±0.5°C, tank pressure 0.05 MPa, initial stirring speed of 200 rpm with dissolved oxygen control (maintaining dissolved oxygen >30%), and pH maintained at 6.8~7.2 by automatically adding 25% (v / v) ammonia solution.

[0037] 3. Feeding Strategy: When the residual sugar concentration in the fermentation broth reaches 9.4 g / L, indicating that fermentation has lasted for 4 hours, feeding begins at this point, including: (1) Carbon source replenishment: Using a glucose replenishment bottle, a concentrated glucose solution with a concentration of 500 g / L is added at a constant rate of 8.0 g / L·h (calculated as glucose).

[0038] (2) Salt replenishment: At the same time, add salt replenishment solution to the glucose replenishment bottle so that the final salt concentration of the glucose replenishment bottle is: KH2PO4 27 g / L, MgSO4·7H2O 20 g / L.

[0039] 4. Results: The fermentation process curve under the constant-rate feeding strategy is shown in the figure below. Figure 1 As shown. Sampling and testing at 48 hours of fermentation revealed a cell density (OD). 600 The titer reached 43.75, and the heparin precursor polysaccharide titer was 4.1 g / L. The entire fermentation cycle was 48 hours, and the final space-time yield was 2.05 g·L⁻¹·d⁻¹.

[0040] Example 3 Feedback fermentation of engineered strain HPZ8 This embodiment uses the engineered strain HPZ8, which produces heparin precursor polysaccharides constructed in Example 1, to optimize a 20L fermentation process. The only difference between this embodiment and Example 2 is the carbon source feeding strategy. Everything else is the same as in Example 2.

[0041] The carbon source feeding strategy in this embodiment is as follows: The pH-Stat feedback mode is adopted: when the pH value is higher than the set value (7.0) by 0.1 units, the concentrated glucose solution of 500g / L will be automatically added.

[0042] Results of this embodiment: The fermentation process curve under the pH feeding strategy is shown in the figure below. Figure 2 After 48 hours of fermentation, OD 600 The titer was only 21.25, and the heparin precursor polysaccharide potency was 1.5 g / L. This method had the worst performance due to severe signal interference.

[0043] Example 4: Fermentation of engineered strain HPZ8 using a step-by-step controlled feeding method This embodiment uses the engineered strain HPZ8, which produces heparin precursor polysaccharides constructed in Example 1, to optimize a 20L fermentation process. The only difference between this embodiment and Example 2 is the carbon source feeding strategy. Everything else is the same as in Example 2.

[0044] The carbon source feeding strategy in this embodiment is as follows: Segmented step-by-step feeding is adopted: Phase 1 (0-12 h): Add 500 g / L of concentrated glucose solution at a rate of 15.0 g / L·h (based on glucose feed).

[0045] Phase 2 (12 h until end of fermentation): Reduce the sugar feeding rate to 8.0 g / L·h.

[0046] Results of this embodiment: After 24 hours of fermentation, the cell density (OD) 600 The titer significantly increased to 97.4, and the heparin precursor polysaccharide titer reached 7.9 g / L. This indicates that the fed-batch fermentation strategy effectively promoted cell growth and product synthesis. The fermentation curve under the fed-batch fermentation strategy in this embodiment is shown in [reference needed]. Figure 3 .

[0047] Example 5: Fermentation of engineered strain HPZ8 using a step-by-step controlled feeding method This embodiment uses the engineered strain HPZ8, constructed in Example 1, to optimize a 20L fermentation process. The fermentation steps differ from those in Example 2 only in the carbon source feeding strategy and the salt feeding strategy. Everything else is the same as in Example 2.

[0048] The carbon source feeding strategy in this embodiment is as follows: Segmented step-by-step feeding is adopted: Phase 1 (0-12 h): Add 500 g / L of concentrated glucose solution at a rate of 15.0 g / L·h (based on glucose feed).

[0049] Phase 2 (12 h until end of fermentation): Reduce the sugar feeding rate to 8.0 g / L·h.

[0050] The salt feeding strategy in this embodiment is as follows: Add salt feed solution to the glucose feed bottle to make the final salt concentration of the liquid in the glucose feed bottle: KH2PO4 10 g / L, MgSO4·7H2O 10 g / L.

[0051] The fermentation curve for this embodiment is shown below. Figure 4 After 24 hours of fermentation, the cell density (OD) 600 The concentration was further increased to 110.5, and the potency of the heparin precursor polysaccharide exceeded 10.9 g / L, with a space-time yield of 10.9 g·L⁻¹·d⁻¹. This indicates that reducing the ionic strength of the fed-batch medium effectively relieved the metabolic inhibition caused by high salt.

[0052] Example 6: Optimization of Trace Element Addition This embodiment uses the engineered strain HPZ8, constructed in Example 1, to optimize a 20L fermentation process. The only difference between this embodiment and Example 5 is that the initial fermentation medium contains 1 mL / L of trace element solution. Everything else is the same as in Example 5.

[0053] Results: The fermentation curve under optimized trace element conditions in this embodiment is shown in the figure. Figure 5 After 24 hours of fermentation, the cell density (OD) 600 The titer of heparin precursor polysaccharide increased to 117.7, and the titer of heparin precursor polysaccharide further increased to 13.3 g / L, demonstrating the effect of further releasing the potential of the strain through fine regulation of trace elements.

[0054] Example 7 Purification and structural confirmation of heparin precursor polysaccharide The fermentation broth obtained in Example 6 was used for product purification: Inactivation: Heat the fermentation broth at 100℃ for 20 min to inactivate the bacteria.

[0055] Resin adsorption: Dilute the inactivated fermentation broth by 1:1 and adjust the pH to 6.5 with hydrochloric acid. Add pre-activated LH42 heparin sodium resin at a ratio of 1 kg: 1 L, and gently stir in the tank for 5 hours for adsorption.

[0056] Gradient elution: Pack the polysaccharide-adsorbed resin column and wash with pure water until the eluent is clear. Equilibrate with 2 column volumes of 0.02 M Tris-HCl buffer (pH 7.5). Prewash with 3 column volumes of 0.02 M Tris-HCl + 0.2 M NaCl (pH 7.5). Elute with 3 column volumes of 0.02 M Tris-HCl + 1.5 M NaCl (pH 7.5), starting collection when heparin precursor is detected in the eluent and continuing until the signal disappears.

[0057] Enzyme treatment: 0.01% (v / v) of super nuclease was added to the elution collection and treated at 37°C for 3 hours; then 0.1% (m / v) of papain was added and treated at 60°C for 3 hours to remove nucleic acid and protein impurities.

[0058] Ultrafiltration desalination: The enzyme-treated solution is concentrated and desalted using a nanofiltration membrane with a molecular weight cutoff of 3 kDa until the concentrate potency is ≥10 g / L.

[0059] Freeze-drying: The ultrafiltration concentrate was pre-frozen at -20°C and then placed in a freeze dryer for vacuum drying for 24 hours to obtain a white flocculent solid.

[0060] Structural confirmation: The product obtained by freeze-drying was subjected to 1H NMR spectroscopy (NMR spectroscopy). 1 H NMR analysis, results are shown in […]. Figure 6 The characteristic peaks at chemical shifts δ 5.4 ppm and 4.6 ppm in the spectrum were completely consistent with the spectrum of the heparin precursor polysaccharide standard, confirming that the obtained product was the heparin precursor polysaccharide with the target structure.

[0061] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0062] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A fermentation method of Escherichia coli EcN for producing heparosan, characterized by: The method comprises the following steps: The E. coli EcN is inoculated into a fermentation medium, and the fermentation is carried out until the residual sugar concentration in the fermentation liquor is 8-10 g / L, and then the following feeding is carried out: The glucose solution is fed into the fermentation liquor at a rate of 12-16 g / (L·h) for 10-14 hours, and then the glucose solution is fed into the fermentation liquor at a rate of 7-10 g / (L·h) until the fermentation is completed; the concentration of the glucose solution is 480-520 g / L; The salt is fed into the fermentation liquor at the same time when the glucose solution is fed, and the final concentration of the salt in the glucose solution is as follows: KH2PO4 7-15 g / L, MgSO4 8-12 g / L.

2. The fermentation process of E. coli EcN as claimed in claim 1, wherein: The E. coli EcN is constructed by overexpressing endA / Δ pfkA the gene glmS gene, kfiD gene, kfiA gene, kfiC gene, kpsS gene, kpsT gene, kpsM in the EcN strain with genotype EcN / Δ 3. The fermentation process of E. coli EcN as claimed in claim 2, characterized in that: glmS The nucleotide sequence of the gene is shown as SEQ ID NO. 1; kfiD The nucleotide sequence of the gene is shown as SEQ ID NO. 2; kfiA The nucleotide sequence of the gene is shown as SEQ ID NO. 5; kfiC The nucleotide sequence of the gene is shown as SEQ ID NO. 6; kpsS The nucleotide sequence of the gene is shown as SEQ ID NO. 7; kpsT The nucleotide sequence of the gene is shown as SEQ ID NO. 8; kpsM The nucleotide sequence of the gene is shown as SEQ ID NO. 9; endA The nucleotide sequence of the gene is shown as SEQ ID NO. 10, pfkA The nucleotide sequence of the gene is shown as SEQ ID NO.

11.

4. The fermentation process of E. coli EcN as claimed in claim 1, wherein: The fermentation medium comprises: Glucose monohydrate 25-30 g / L, KH2PO4 10-15 g / L, (NH4)2HPO4 10-15 g / L, MgSO4 3-5 g / L, citric acid 5-10 g / L, trace element solution 0.8-1.2 mL / L, and antifoaming agent 1.5-3 g / L.

5. The fermentation process of E. coli EcN as claimed in claim 4, wherein: The trace element solution comprises: Ferrous sulfate heptahydrate 20 g / L, manganese sulfate tetrahydrate 2.5 g / L, copper sulfate pentahydrate 2 g / L, ammonium molybdate tetrahydrate 1 g / L, and sodium borate decahydrate 2 g / L.

6. The fermentation process of E. coli EcN as claimed in claim 1, wherein: The fermentation temperature is 35-39℃.

7. The fermentation process of E. coli EcN as claimed in claim 1, wherein: The pH is controlled to be 6.5-7.5 during the fermentation.

8. The fermentation process of E. coli EcN as claimed in claim 1, wherein: The dissolved oxygen of the fermentation liquor is controlled to be at least 30% during the fermentation.

9. The heparin precursor polysaccharide prepared by the fermentation method according to any one of claims 1-8.

Images