Application of hybridization probe to target binding in sample containing single-stranded DNA binding protein

By introducing bases, ribose, and phosphate esters into the hybridization probe, the hybridization problem caused by interference from single-stranded DNA binding proteins was solved, achieving efficient target binding in the presence of single-stranded DNA binding proteins, improving the sensitivity and speed of nucleic acid detection, and simplifying the operation steps.

CN121272014APending Publication Date: 2026-01-06CHANGZHOU FLUOSCIENCE MEDICAL TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410889682.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-03
Publication Date
2026-01-06

AI Technical Summary

Technical Problem

In the presence of single-stranded DNA binding proteins, the binding of hybridization probes to targets is interfered with, leading to reduced sensitivity of nucleic acid detection. Furthermore, existing methods increase the complexity and number of steps required for detection.

Method used

Modified hybridization probes, including base, ribose, and phosphate modifications, can efficiently hybridize with targets in the presence of single-stranded DNA binding proteins. These probes include those using artificial bases, ribose modifications, and phosphate modifications, and are suitable for isothermal amplification systems involving recombinase polymerase amplification.

Benefits of technology

It improves the sensitivity and speed of nucleic acid testing, simplifies the operation steps, and enhances the detection performance in isothermal amplification reactions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121272014A_ABST
    Figure CN121272014A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a hybridization probe in binding with a target in a sample containing a single-stranded DNA binding protein, the hybridization probe at least comprises a segment of nucleic acid sequence, and the nucleic acid sequence comprises at least one of the following items: modification of a basic group, modification of ribose and modification of phosphate. In the application of the invention, the hybridization probe can efficiently hybridize with the target in the presence of the single-stranded DNA binding protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the technical field of hybridization probes, and particularly relates to the application of a hybridization probe in binding to a target in a sample containing a single-stranded DNA-binding protein. Background Technology

[0002] Nucleic acid testing, with its advantages of high sensitivity and specificity, has become an important means of disease detection and screening for pathogenic microorganisms. Visualizing the target molecules during nucleic acid testing is a crucial issue that must be addressed. Currently, the most commonly used method is polymerase chain reaction (PCR), which involves heating the double-stranded target molecules repeatedly to break them down, followed by amplification under cooling and annealing conditions. However, PCR technology requires stringent experimental conditions, skilled technicians, and expensive testing equipment, which to some extent limits the widespread application of nucleic acid testing.

[0003] Nucleic acid isothermal amplification is an alternative to PCR. Its amplification is achieved under constant temperature conditions, without the need for a precisely controlled thermal cycling system. The equipment used is neither complex nor expensive. In particular, isothermal amplification technology combined with various nucleic acid visualization technologies and addressable detection technologies can achieve rapid detection of ultramultiple target molecules.

[0004] However, to achieve isothermal amplification, it is usually necessary to add proteins with single-strand binding activity to the system. This largely replaces the PCR heating and denaturation procedure, which is very beneficial for isothermal amplification reactions. However, in subsequent detection, single-stranded DNA binding proteins can also restrict the binding of hybridization probes to targets, which greatly reduces the detection sensitivity. Although removing single-stranded DNA binding proteins after isothermal amplification before detection improves the detection sensitivity, it increases the complexity of detection and operational steps, limiting the wider application of the technology.

[0005] If a probe can be developed that can efficiently hybridize with a target in the presence of single-stranded DNA-binding proteins, it will undoubtedly accelerate the detection speed of nucleic acids, improve the sensitivity of nucleic acid detection, and promote the further application of the technology. Summary of the Invention

[0006] This invention provides an application of a hybridization probe in samples containing single-stranded DNA-binding proteins to solve the technical problem of interference from single-stranded DNA-binding proteins (SSBs) in the presence of SSBs.

[0007] In one embodiment, the present invention provides an application of a hybridization probe to bind to a target in a sample containing a single-stranded DNA-binding protein, characterized in that the hybridization probe comprises at least one nucleic acid sequence, the nucleic acid sequence comprising at least one of the following: base modification, ribose modification, and phosphate ester modification.

[0008] The single-stranded DNA binding protein prevents newly formed single-stranded DNA from re-pairing to form double-stranded DNA. The single-stranded DNA binding protein originates from one or a combination of viruses, prokaryotes, and eukaryotes. Preferably, the single-stranded DNA binding protein includes, but is not limited to, Escherichia coli SSB and single-stranded DNA binding proteins derived from myovirus phages and their mutants or fragments, or combinations thereof.

[0009] Optionally, the single-stranded DNA-binding protein may include a thermostable mutant.

[0010] Optionally, the single-stranded DNA-binding protein in the sample may be added externally or may be present in the system itself.

[0011] In one embodiment, the base modification is selected from at least one of the group consisting of 5-pyrimidine modification, 8-purine modification, extracyclic cytosine modification, substitution of 5-bromouracil, substitution of 5-bromodeoxyuridine, and substitution of 5-bromodeoxycytidine.

[0012] In one embodiment, the modification of the base comprises replacing the base with an artificial base, and the artificial base is independently selected from at least one of the group consisting of xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-denitroxanthine, 7-denitroguanine, N4,N4-ethanol cytosine, N',N'-ethanol-2,6-diaminopurine, 5-methylcytosine, 5-(C3-C6)-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, and inosine.

[0013] In one embodiment, the modification of the ribose comprises the 2'-OH group and / or H of the sugar moiety of the nucleotide being independently substituted by a group selected from any one of the group consisting of OR, R, R'OR, SH, SR, NH2, NHR, NR2, NR”R, N3, CN, F, Cl, Br, and I.

[0014] In one embodiment, the modification of the ribose is selected from at least one of the group consisting of 2'-methoxyethyl (2-MOE), 2'-O-methyl (2'-OMe), 2'-O-ethyl (2'-OEt), 2'-O-aminopropyl, 2'-O-alkyl, 2'-O-allyl, 2'-O-butyl, 1-(4'-thio-PD-furanose), 2-O-4-C, and L-DNA and mirror-image nucleic acid analogs.

[0015] Optionally, the substituent at position 2 forms a ring with position 4.

[0016] Optionally, the 2 and 4 positions of the ribose are linked by -CH2-O- to form an LNA.

[0017] Optionally, the chemical bond between the carbon atoms at positions 2 and 3 of the ribose is broken, and the ribose is simultaneously saturated with H to form UNA and its mutants.

[0018] Optionally, the oxygen atom in the furan ring of the ribose can be independently replaced by S, Se, NH, or NR, where R represents alkyl, aryl, or polyvinyl alcohol.

[0019] In one embodiment, the modification of the ribose includes the substitution of the sugar ring, and the substitution of the sugar ring is selected from the group consisting of at least one of threose (TNA), cyclohexenylribose (CeNA), and pyranose nucleic acid (HNA).

[0020] In one embodiment, the modification of the phosphate ester is selected from at least one of the group consisting of thiophosphate ester bonds, selenophosphate ester bonds, alkyl phosphate triester bonds, aryl phosphate triester bonds, alkyl phosphate ester bonds, aryl phosphate ester bonds, hydrogenated phosphate ester bonds, and alkylamino phosphate ester bonds.

[0021] In one embodiment, the modification of the phosphate ester includes the substitution of the phosphate ester, the substitution of the phosphate ester being selected from at least one of the group consisting of substitution of peptide nucleic acids, substitution of morpholine nucleic acids and substitution of triazole bonds.

[0022] In one embodiment, the sample containing the single-stranded DNA-binding protein is reacted in a group selected from recombinase polymerase amplification (RPA) systems or dilutions thereof, strand displacement amplification (SDA) systems or dilutions thereof, strand invasion-based amplification (SIBA) systems or dilutions thereof, helicase-dependent amplification (HDA) systems or dilutions thereof, rolling circle amplification (RCA) systems or dilutions thereof, nucleic acid sequence-based amplification (NASBA) systems or dilutions thereof, and combinations thereof.

[0023] In one embodiment, the sample containing a single-stranded DNA-binding protein comprises a single-stranded DNA-binding protein selected from the group consisting of Escherichia coli single-stranded DNA-binding protein, myovirus phage DNA-binding protein and its mutants, fragments or combinations thereof.

[0024] In one embodiment, the hybridization probe is independently modified with one or more modifying groups / units.

[0025] In one embodiment, the modified group / unit is selected from units having optical signals, electrical signals, acoustic signals, magnetic signals, enzyme activity, active reactive groups, quenching groups, and minor groove binding groups.

[0026] In one embodiment, the modified groups / units are selected from dyes, including phosphorescent dyes, time-resolved fluorescent dyes, fluorescent dyes, activated fluorescent dyes, and latent fluorescent dyes; nanoparticles and microspheres, including fluorescent microspheres, quantum dots, carbon dots, colored latex spheres, fluorescent latex spheres, colloidal particles, colloidal gold particles, oxide clusters, redox molecules, luminescent molecules, enzymes, radioactive labels, electrochemical functional groups, enzymes, and enzyme-additive detectable enzyme substrates.

[0027] In one embodiment, the dye is selected from the group consisting of coumarin, halogenated ...

[0028] In one embodiment, the modified group / unit is selected from an activated fluorescent dye that can activate fluorescence under certain conditions.

[0029] In one embodiment, the activated fluorescent dye is selected from viscosity-responsive dyes, polarity-responsive dyes, pH-responsive dyes, and ion-responsive dyes.

[0030] In one embodiment, the modified group / unit is an enzyme that can react with a substrate to generate a detectable signal, and the preferred markers are horseradish peroxidase (HRP), luciferase (NanoLuc), alkaline phosphatase (AP), urease, and β-galactosidase.

[0031] In one embodiment, the active group is a group capable of undergoing a chemical reaction, selected from hydroxyl, mercapto, disulfide bond, amino, carboxyl active ester, azide group, 4-dibenzocyclooctol, heteroazines, and tetrazines.

[0032] In one embodiment, the quenching group has the property of quenching fluorescence by static quenching or contact quenching, and is selected from monoazo dyes, diazo dyes, gold nanoparticles (AuNPs), single-walled carbon nanotubes (SWNTs), graphene oxide (GO), nitroaniline, dinitroaniline, nitrobenzene, and dinitrobenzene.

[0033] In one embodiment, the quenching group is selected from Dabcyl, BHQ (Black Hole Quencher™), and BlackBerry. TM Deep Dark Quencher 1 (DDQ-1) quencher.

[0034] In one embodiment, the 3-end and 5-end of the probe are modified with one or more fluorescent groups, and the 3-end and 5-end of the probe are modified with one or more quenching groups capable of quenching the fluorescent group. Optionally, one or more quenching groups are modified between the 3-end and 5-end of the probe.

[0035] In one embodiment, the minor groove binding group is an MGB analog selected from one or a combination of CC1065 analogs, lecithin, terbinafine, berenilin, pyrantelin, pentamidine, 4,6-diamino-2-phenylindole, and pyrrolo[2,1-c][1,4]benzodiazepine.

[0036] In one embodiment, the modifying group / unit is optionally connected to the probe via a linking group, wherein the linking group is selected from alkylene groups, peptides, and polyvinyl alcohol.

[0037] In one embodiment, the 3' and 5' ends of the probe form a complementary pair to form a hairpin structure, i.e., the probe is a molecular beacon probe.

[0038] In one embodiment, the probe is modified with one or more viscosity-responsive dyes between its 3' and 5' ends; optionally, the viscosity-responsive dye is a cyanine dye, a hemicyanine dye, a thiazole orange (TO) dye, acridine dye, ethidium dye, proflavin dye, donomycin dye, rose alkaloid dye, anthracene dye, quinacrine dye, or 5'-, 6'-, 7'- or 8'-hydroxyquinoline, quinoline blue, quinoline violet, or quinoline red.

[0039] In one embodiment, the modifying group / unit is selected from antigens, antibodies, haptens, monosaccharides, polysaccharides, avidins, antibody mimics, cell receptors, ligands, lipids, biotin, avidin, streptavidin, exavidin, neutral avidin, traptavidin, metals, histidines, and any part or combination of these structures.

[0040] In one embodiment, the nucleic acid sequence of the hybridization probe has 5-100 nt; optionally, the hybridization probe has 5-80 bases; optionally, the hybridization probe has 5-50 nt; optionally, the hybridization probe has 5-40 nt; optionally, the hybridization probe has 5-30 nt; optionally, the hybridization probe has 5-20 nt; optionally, the hybridization probe has 5-10 nt.

[0041] In one embodiment, the hybridization probe is fixed on a solid support; optionally, the solid support is selected from one or a combination of polymer beads, agarose beads, polystyrene beads, acrylamide beads, solid core beads, porous beads, paramagnetic beads, glass beads, controlled-pore beads, microtiter beads, hydrogels, cyclic olefin copolymer beads, biomembranes, filter paper, plastic substrates, nylon, Langmuir-Broguet membranes, glass, germanium substrates, silicon substrates, silicon wafers, ceramics, laminates, flow-through chips, microspheres, nanoparticles, polytetrafluoroethylene sheets, polystyrene sheets, gallium arsenide substrates, gold plates, and silver substrates; preferably, the support is one or more from the group consisting of glass, silicon substrates, nitrocellulose membranes, cellulose acetate membranes, flow-through chips, and gold plates. Optionally, the solid support is selected from one or more from the group consisting of nitrocellulose membranes, cellulose acetate membranes, nylon membranes, flow-through chips, glass, silicon substrates, silicon wafers, microspheres, and plastics.

[0042] Optionally, the hybridization probe is used for one or a combination of capturing, enriching, and detecting nucleic acid targets.

[0043] Optionally, the hybridization probe is used for genotyping of nucleic acid targets.

[0044] Optionally, the hybridization probe is used for gene sequencing of nucleic acid targets.

[0045] Optionally, the nucleic acid target is generated by isothermal amplification.

[0046] Optionally, the amplification of the nucleic acid target is selected from spontaneous amplification. Optionally, the amplification of the nucleic acid target is selected from triggered amplification. Optionally, the amplification of the nucleic acid target is selected from nucleic acid triggering, protein triggering, monosaccharide or sugar triggering, lipid triggering, peptide triggering, metabolite triggering, small molecule triggering, and ion triggering.

[0047] The beneficial effects of the present invention are as follows: In the application of the hybridization probe of the present invention to bind to the target in samples containing single-chain binding proteins, the probe modified with bases, ribose, or phosphate esters has strong binding ability and low interference from single-chain binding proteins, thereby accelerating the detection speed and improving the detection sensitivity. Attached Figure Description

[0048] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0049] Figure 1 The fluorescence intensity of the natural probe and the modified hybridization probe is shown;

[0050] Figure 2 The test strips show the completed incubation results. A represents a strongly positive sample detected by a natural probe using a T-line capture probe; B represents a strongly positive sample detected by a non-natural probe using a T-line capture probe; C represents a weakly positive sample detected by a natural probe using a T-line capture probe; and D represents a weakly positive sample detected by a non-natural probe using a T-line capture probe.

[0051] Figure 3 This demonstrates the use of a complex constructed with a bG aptamer as the aptamer and a ligand linked to a dye as the reporter group for target addressability detection on a microfluidic chip; and

[0052] Figure 4 The results of square wave voltammetry measurements on the electrode after incubation for 30 minutes in the range of -0.35 to 1.5 V are shown in the graph. The electrode was prepared by adding the amplified product onto the electrode dried with nitrogen according to the amplification method of Example 1. Detailed Implementation Plan

[0053] The present invention will be further illustrated below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0054] According to an embodiment of the present invention, a hybridization probe is used to bind to a target in a sample containing a single-stranded binding protein, characterized in that the hybridization probe comprises at least one nucleic acid sequence, the nucleic acid sequence comprising at least one of the following: base modification, ribose modification, and phosphate ester modification.

[0055] The base modification may be selected from at least one of the group consisting of 5-pyrimidine modification, 8-purine modification, extracyclic cytosine modification, substitution of 5-bromouracil, substitution of 5-bromodeoxyuridine, and substitution of 5-bromodeoxycytidine.

[0056] The modification of the base includes replacing the base with an artificial base, and the artificial base is independently selected from at least one of the group consisting of xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-denitroxanthine, 7-denitroguanine, N4,N4-ethanol cytosine, N',N'-ethanol-2,6-diaminopurine, 5-methylcytosine, 5-(C3-C6)-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, and inosine.

[0057] The modification of the ribose involves the independent substitution of the 2'-OH group and / or H of the sugar moiety of the nucleotide by a group selected from any one of the group consisting of OR, R, R'OR, SH, SR, NH2, NHR, NR2, NR”R, N3, CN, F, Cl, Br, and I.

[0058] The modification of the ribose is selected from at least one of the group consisting of 2'-methoxyethyl, 2'-O-methyl, 2'-O-ethyl, 2'-O-aminopropyl, 2'-O-alkyl, 2'-O-allyl, 2'-O-butyl, 1-(4'-thio-PD-furanose), 2-O-4-C, and L-DNA.

[0059] The modification of the ribose includes the substitution of the sugar ring, and the substitution of the sugar ring is selected from the group consisting of at least one of threose, cyclohexenylribose, and pyranose nucleic acid.

[0060] The modification of the phosphate ester is selected from at least one of the group consisting of thiophosphate ester bonds, selenophosphate ester bonds, alkyl phosphate triester bonds, aryl phosphate triester bonds, alkyl phosphate ester bonds, aryl phosphate ester bonds, hydrogenated phosphate ester bonds, and alkylamino phosphate ester bonds.

[0061] The modification of the phosphate ester includes the substitution of the phosphate ester, wherein the substitution of the phosphate ester is selected from at least one of the group consisting of substitution of peptide nucleic acids, substitution of morpholine nucleic acids and substitution of triazole bonds.

[0062] The sample containing the single-chain binding protein is reacted in a group selected from the group consisting of recombinase polymerase amplification system or its dilution, chain substitution amplification system or its dilution, SIBA amplification system or its dilution, helicase-dependent amplification system or its dilution, rolling circle amplification system or its dilution, nucleic acid-dependent amplification system or its dilution, and combinations thereof.

[0063] The sample containing single-stranded binding proteins includes single-stranded binding proteins selected from the group consisting of Escherichia coli single-stranded DNA binding proteins, myovirus phage DNA binding proteins and their mutants, fragments or combinations.

[0064] During the patent term of this application, it is anticipated that many related processes for the application of hybridization probes to bind to targets in samples containing single-stranded DNA-binding proteins will be developed, and the scope of this application is intended to a priori include all such new technologies.

[0065] The terms “contains,” “includes,” “having,” and their variant forms mean “including but not limited to.”

[0066] It should be understood that, for clarity, certain features of the invention described in the context of individual embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, various features of the invention described in the context of a single embodiment may also be provided individually, or in any suitable sub-combination, or appropriately provided in any other described embodiment of the invention. Certain features described in the context of various embodiments should not be considered essential features of those embodiments unless the embodiment would not function without these elements.

[0067] To further illustrate the characteristics of the hybridization probe of the present invention in binding to a target in samples containing single-stranded DNA-binding proteins, the relevant test experiments and results of the application of the hybridization probe to the target in samples containing single-stranded DNA-binding proteins are described below. Those skilled in the art should understand that the examples described below are illustrative and not limiting, and should not limit the scope of protection of the present invention by the following illustrative examples.

[0068] Example

[0069] Preparation of test strips:

[0070] Sample pad preparation:

[0071] (a) The preparation of the treatment solution is shown in Table 1 below:

[0072] Table 1

[0073] Hepes (pH=8.0) 4 moles <![CDATA[Na2CO3]]> 2 moles Tween-20 0.5% PEG 10K 1 gram Purified water Adjust the volume to 100 ml

[0074] (b) Lay the fiberglass flat on the glass plate, spray the appropriate amount evenly with a measuring cylinder or syringe, and roll it flat with a roller.

[0075] (c) Lay the fiberglass flat on a stainless steel mesh and dry it overnight in an oven at 37°C;

[0076] (d) After removal, dry, seal and store in a dark place for later use.

[0077] Test strip application method:

[0078] In this experiment, both the T-line and C-line capture probes were modified with biotin. Before being sprayed onto the nitrocellulose membrane, streptavidin for membrane scrubbing was added to the capture probes so that the biotin labeled on the capture probes reacted with the streptavidin to fix the capture probes onto the nitrocellulose membrane, thus preventing them from being washed away by the liquid.

[0079] The steps of the capture probe and streptavidin modification method are as follows:

[0080] 75 μL of a 20 μM biotin-modified capture probe (Jierui Biotechnology Co., Ltd.) was mixed with 25 μL of a 1 mg / mL streptavidin solution and reacted at room temperature for 2 h to generate a biotin- and streptavidin-modified capture probe. The incubated sample was centrifuged at 6000 r / min for 20 min at 4 °C to remove the precipitate and stored at 4 °C for later use.

[0081] Using a gold-spraying scribing instrument, capture probes are scribbled onto a nitrocellulose membrane to form a detection line (T line); control capture probes are scribbled on the side near the absorbent pad to form a control line (C line); the coated nitrocellulose membrane is dried overnight at 45°C and stored in a dry environment at room temperature away from light for later use.

[0082] How to assemble the test strip:

[0083] The nitrocellulose membrane, sample pad, conjugate pad, and absorbent pad are sequentially glued onto the pad plate, with an overlap of 2 mm between adjacent pads. After assembly, the pads are cut into 3.6 mm wide test strips, packaged, and stored in a dry, room-temperature environment away from light for later use.

[0084] Example 1: Simulated Target

[0085] Referring to Table 2 below, it shows 12 modified hybridization probes used in the application of the hybridization probes of the present invention to bind to targets in samples containing single-stranded DNA binding proteins, namely: probes 3 to 14 (modified by SEQ ID NO: 2), wherein the chemical modification of probes 2-8 is ribose modification; the chemical modification of probes 9-11 is phosphate backbone modification; and the chemical modification of probes 12-14 is base modification.

[0086] Table 2

[0087]

[0088]

[0089]

[0090] Biotin represents the biotin label.

[0091] Following the above method for preparing the test strip, incubate the probe with streptavidin, trace it onto the T line of the NC membrane, dry it, and assemble the test strip.

[0092] Add the target to the RPA system to prepare a target positive sample with a final concentration of 100 nM. Add 60 μL to the test strip and perform lateral chromatography at 30 °C for 5 min. After incubation, read the test strip using a dry fluorescence reader.

[0093] Reference Figure 1 The results showed that probes 4, 6, and 7 performed best, with fluorescence intensity approximately 19 times that of the natural probe test strips. Other non-natural probes also captured signals superior to natural probes, with fluorescence intensity 2 to 3 times that of natural probes. This indicates that in the RPA system, non-natural probes are less affected by the RPA system and are more suitable for specific target detection within the RPA system.

[0094] Example 2:

[0095] Referring to Table 3 below, this experiment uses a ribose-modified non-natural probe to detect the foodborne pathogen Escherichia coli in an RPA amplification system.

[0096] Table 3

[0097]

[0098]

[0099] RPA reaction system: Isothermal amplification reaction system: containing 29.3 μL of buffer A, 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 2.5 μL of buffer B, and 13.0 μL of sample to be tested. Negative control: 29.3 μL of buffer A, 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 2.5 μL of buffer B, and 13.0 μL of ddH2O. Buffer A and buffer B were purchased from Beijing Junuode Biotechnology Co., Ltd.

[0100] RPA nucleic acid isothermal amplification reaction: incubate at 37℃ for 4 min, vortex for 15 s, and incubate at 37℃ for 10 min. Incubate the probe with streptavidin, streak it along the T line of the NC membrane, and assemble the test strip. Use Escherichia coli DNA as the positive sample and physiological saline (with only an equal volume) as the negative sample. Amplify according to the components and amplification method in Table 3 above. Incubate the amplified product with dye to a final dye concentration of 1 μM. After incubation, add 60 μL to the test strip and perform lateral chromatography at 30℃. Read the test strip using a dry fluorescence reader after incubation.

[0101] The results are shown in Table 4 below: In detecting high-concentration targets, both natural and non-natural probes could detect positive and negative samples normally. At the same target concentration, the fluorescence signal detected by the non-natural probe was stronger, approximately 6-8 times stronger than that of the natural probe. Even at lower target concentrations, the non-natural probe could still detect a significant fluorescence signal and distinguish it well from negative samples. However, the fluorescence signal detected by the natural probe was poor and could not be effectively distinguished from negative signals. Its detection sensitivity was an order of magnitude lower than that of the non-natural probe. This indicates that in the RPA system, the non-natural probe, as a capture probe, has higher detection sensitivity and better performance than the natural probe.

[0102] Table 4

[0103]

[0104] Example 3:

[0105] Referring to Table 5 below, this experiment uses a ribose-modified non-natural probe to detect Vibrio vulnificus in an RPA amplification system.

[0106] Table 5

[0107]

[0108]

[0109] Amplification system: 60 mmol / L Tris (pH 7.2), 6 mmol / L dithiothreitol, 5% polyethylene glycol, 5 mmol / L ATP, 1.5 mmol / L dNTPs, 100 μmol / L phosphoinositol, 50 ng / μL single-stranded DNA binding protein SSB (derived from E. coli), 10 ng / μL RecQ helicase, 50 ng / μL UvsX recombinase, 50 ng / μL UvsY recombinase, 70 ng / μL BSU DNA polymerase, 10 U RNase H, 1 U exonuclease III, 1 μmol / L primer F, 1 μmol / L primer R, 20 mmol / L magnesium acetate, 15 μL template. Incubate at 40°C for 20 min.

[0110] Incubate the probe with streptavidin, streak it along the T line on the NC membrane, and assemble the test strip. Use Vibrio vulnificus DNA as the positive sample and physiological saline (with an equal volume added) as the negative sample. Amplify according to the components and amplification method in the table above. Incubate the amplified product with dye to a final dye concentration of 1 μM. After incubation, add 60 μL to the test strip and perform lateral chromatography at 30°C. Read the test strip using a dry fluorescence reader after incubation.

[0111] The results are shown in Table 6 below. In detecting high-concentration targets, both natural and non-natural probes could detect positive and negative samples normally. At the same target concentration, the fluorescence signal detected by the non-natural probe was stronger, approximately 7-10 times stronger than that of the natural probe. When the target concentration was low, the non-natural probe could still detect a significant fluorescence signal and distinguish it well from negative samples. However, the fluorescence signal detected by the natural probe was poor and could not be effectively distinguished from the negative signal. The detection sensitivity was an order of magnitude lower than that of the non-natural probe, indicating that in the RPA system, the non-natural probe, as a capture probe, has higher detection sensitivity and better performance than the natural probe.

[0112] Table 6

[0113]

[0114]

[0115] Example 4:

[0116] Referring to Table 7 below, this experiment uses a ribose-modified non-natural probe to detect Pseudomonas aeruginosa in an RPA amplification system.

[0117] Table 7

[0118]

[0119] Genome extraction and RPA amplification: The DNA rapid extraction reagent provided in this kit is Easy Extract provided by Chongqing Weston Biotechnology Co., Ltd. The extraction steps are as follows: Take 200 μL of freshly cultured Pseudomonas aeruginosa culture, centrifuge at 5000×g for min to collect the bacteria, add 80 μL of DNA rapid extraction buffer, incubate at 56℃ for 10 min, incubate at 98℃ for 2 min, and store at -20℃.

[0120] The extracted genomic DNA was amplified using the following mixture: 60 mmol / L Tris (pH 7.2), 6 mmol / L dithiothreitol, 5% polyethylene glycol, 5 mmol / L ATP, 1.5 mmol / L dNTPs, 100 μmol / L phosphoinositol, 50 ng / μL single-stranded DNA-binding protein SSB (derived from myovirus phage), 10 ng / μL RecQ helicase, 50 ng / μL UvsX recombinase, 50 ng / μL UvsY recombinase, 70 ng / μL BSU DNA polymerase, 10 U RNase H, 1 U exonuclease III, 1 μmol / L primer F, 1 μmol / L primer R, 20 mmol / L magnesium acetate, and 15 μL template. The mixture was incubated at 40°C for 20 min.

[0121] Colloidal gold particles were prepared using the citric acid reduction method to obtain particles with a diameter of 30-40 nm. The gold particles were labeled with FAM antibody; the monoclonal antibody was purchased from a biopharmaceutical company. The labeling method was as follows: while stirring, the pH was adjusted to 6.5-7.0 using carbonated buffer, 3-4 μL of FAM antibody was added, and stirring was continued for 30 minutes. The absorbance was measured at OD525-530 nm = 1.7-2.0. The sample was then centrifuged at 4-8℃. After removing the supernatant, the precipitate was reconstituted using a buffer solution with a pH of 6.5-7.0, and the reconstitution solution was adjusted to 30-40 OD. The coated colloidal gold complex was added to 2 mg / mL BSA and 10 mM Tween 20, sprayed onto a glass fiber sample pad, and dried. Natural and non-natural probes were incubated with streptavidin, respectively, and streaked along the T-line of the NC membrane. The FAM antibody was streaked along the C-line of the NC membrane. The test strips were then assembled.

[0122] Using *Pseudomonas aeruginosa* DNA as a positive sample and physiological saline (with an equal volume added) as a negative sample, amplification was performed according to the above method. The amplified product was incubated with dye to a final dye concentration of 1 μM. After incubation, 60 μL was added to the test strip and lateral chromatography was performed at 30°C. The completed incubation results are shown in the image. Figure 2 As shown, A represents a strongly positive sample detected by a natural probe using a T-line capture probe; B represents a strongly positive sample detected by a non-natural probe using a T-line capture probe; C represents a weakly positive sample detected by a natural probe using a T-line capture probe; and D represents a weakly positive sample detected by a non-natural probe using a T-line capture probe. For strongly positive samples, both natural and non-natural probes using T-line capture probes can clearly detect the sample. However, the T-line color intensity of the natural probe using a T-line capture probe is significantly lower than that of the non-natural probe using a T-line capture probe. For weakly positive samples, the test strip using the non-natural probe using a T-line can still clearly detect the signal, while the test strip using the natural probe using the C-line cannot detect the signal.

[0123] Example 5:

[0124] Referring to Table 8 below, this experiment used a ribose-modified non-natural probe to detect HBV in an RPA amplification system.

[0125] Table 8

[0126]

[0127] The system consists of the following components:

[0128] 60 mmol / L Tris (pH 7.2), 6 mmol / L dithiothreitol, 5% polyethylene glycol, 5 mmol / L ATP, 1.5 mmol / L dNTPs, 100 μmol / L phosphoinositol, 50 ng / μL single-stranded DNA-binding protein SSB (derived from myovirus phage), 10 ng / μL RecQ helicase, 50 ng / μL UvsX recombinase, 50 ng / μL UvsY recombinase, 70 ng / μL BSU DNA polymerase, 10 U RNase H, 1 U exonuclease III, 1 μmol / L primer F, 1 μmol / L primer R, 20 mmol / L magnesium acetate, 15 μL template. Incubate at 40°C for 20 min.

[0129] Microsphere activation: 100 μL of time-resolved microspheres were dispersed in 4 mL of morpholine ethanesulfonic acid (MES) buffer solution at a concentration of 10 mmol. After ultrasonic dispersion, 0.2 mL of 5 mg / mL N-hydroxythiosuccinimide (sulfo-NHS) and 0.1 mL of 5 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) solution were added, and the mixture was shaken in a shaker at 37 °C for 2 h to activate the carboxyl groups. After centrifugation at 8000 rpm - 14000 rpm at 4 °C, the supernatant was carefully removed, 500 μL of sterile ultrapure water was added, and the mixture was ultrasonically dispersed. The above steps were repeated once.

[0130] Microsphere conjugation: Digoxin antibody was added to the activated microspheres to a final antibody concentration of 5 mg / mL. The system was then placed on a rotary mixer and incubated at 4 °C for 12 h. After centrifugation, the supernatant was removed, and 500 μL of reconstitution solution was added to dissolve the precipitate. The mixture was then sonicated and dispersed. 50 μL of blocking buffer containing 10% BSA was added and the mixture was blocked for 1 h. After centrifugation and washing, the mixture was stored at 4 °C for later use.

[0131] The coated latex ball complex was added to 2 mg / mL BSA and 10 mM Tween 20, sprayed onto a glass fiber sample pad, and dried for later use.

[0132] Natural and non-natural probes were incubated with streptavidin and streaked onto the T line of the NC membrane. Anti-digoxigenin antibody was then streaked onto the C line of the NC membrane to assemble the test strip.

[0133] Using HBV DNA as a positive sample and physiological saline as a negative sample with only an equal volume added, amplification was performed according to the above method. The amplified product was incubated with dye to a final dye concentration of 1 μM. After incubation, 60 μL was added to the test strip and lateral chromatography was performed at 30°C. The test strip was then read using a dry fluorescence reader after incubation.

[0134] The above samples were tested. Two test strips were used: one using a natural probe as the T-line capture probe, and the other using a non-natural probe as the T-line capture probe. A comparative experiment was conducted, and the results are shown in Table 9 below. Using a non-natural probe as the T-line capture probe in the test strip can reduce the detection limit of the product, thereby improving the detection sensitivity.

[0135] Table 9

[0136]

[0137]

[0138] Example 6:

[0139] Referring to Table 10 below, this experiment uses a ribose-modified non-natural probe to detect Mycobacterium tuberculosis in an HDA amplification system.

[0140] Table 10

[0141]

[0142] The HDA amplification system consists of the following components:

[0143] 10×HDA buffer A contains 350 mM Tris-acetate (pH 7.5) and 100 mM dithiothreitol; 10×HDA buffer B contains 10 mM Tris-acetate (pH 7.5), 1 mg / mL bovine serum albumin, and 100 mM magnesium acetate. HDA reaction component A (30 μl) consists of 5 μl of 10×HDA buffer A, the DNA sample to be tested, 15 pmol of upstream primer, 15 pmol of downstream primer, and 20 nmol dNTPs, brought to a final volume of 30 μl using ddH2O.

[0144] Reaction component A was heated at 95℃ for 2-10 min to denature the template, followed by heating at 37℃ for 1-4 min. Reaction component B (20 μl) was prepared by adjusting the volume to 20 μl with ddH2O using 5 μl of 10×HDA buffer B, 150 nmol ATP, 5 U exo-Klenow fragment, 100 ng UvrD helicase, 400-800 ng MutL protein, and 4.5 μg T4 gp32.

[0145] Add component B to component A and react at 37°C for 1-3 hours. Then, add 12.5 μl of stop buffer (0.1% sodium dodecyl sulfate, 50 mM Na2EDTA, 15% Ficoll and 0.2% Orange G) to terminate the reaction.

[0146] Natural and non-natural probes were incubated with streptavidin, respectively, and drawn on the T line of the NC membrane to assemble the test strip.

[0147] Mycobacterium tuberculosis DNA was used as a positive sample, and physiological saline was added only to the same volume as a negative sample. Amplification was performed according to the above method. The amplified product was incubated with dye to a final dye concentration of 1 μM. After incubation, 60 μL was added to the test strip and lateral chromatography was performed at 30°C. The test strip was then read using a dry fluorescence reader after incubation.

[0148] The results are shown in Table 11 below. In the HDA system, non-natural labeled probes have higher detection sensitivity and better performance than natural labeled probes.

[0149] Table 11

[0150]

[0151]

[0152] Example 7:

[0153] Referring to Table 12 below, this experiment uses a ribose-modified non-natural probe to detect Japanese encephalitis virus in a NASBA amplification system.

[0154] Table 12

[0155]

[0156] Biotin indicates biotin labeling; FAM indicates carboxyfluorescein labeling.

[0157] NASBA reaction system (20 μL):

[0158] The isothermal amplification reaction system consisted of: 50 mM Tris-HCl (pH 8.0), 50 mM KCl, 10 mM MgCl2, 10 mM DTT, 2 mM NTP, 0.5 mM dNTP, 10% DMSO, 0.125 μM upstream primer, 0.125 μM downstream primer, 6.4 U AMV reverse transcriptase, 32 U T7 RNA polymerase, 0.16 U RNase H, 8 U ribonuclease inhibitor, 0.02% bovine serum albumin (BSA), 2 μg RecA, 4.5 μg T4 gp32, and 5 μL of template RNA. The volume was adjusted to 20 μL using DEPC water.

[0159] NASBA nucleic acid isothermal amplification reaction: 41℃, 90min.

[0160] Incubate the probe with streptavidin, streak it along the T line of the NC membrane, and assemble the test strip.

[0161] RNA fragments of the NS1 gene transcribed from Japanese encephalitis virus in vitro were used as positive samples, and physiological saline with only an equal volume was used as negative samples. Amplification was performed according to the components and amplification methods in the table above. The amplified product was incubated with dye to a final dye concentration of 1 μM. After incubation, 60 μL was added to the test strip and lateral chromatography was performed at 30°C. The test strips were then read using a dry fluorescence reader after incubation.

[0162] The results are shown in Table 13 below. Both the non-naturally labeled probe and the non-naturally labeled beacon probe were able to detect strong fluorescence signals, and the sensitivity of both reached 10-12 mg / mL.

[0163] Table 13

[0164]

[0165]

[0166] Example 8

[0167] The application of the hybridization probe of this invention in binding to a target in samples containing single-stranded DNA-binding proteins, combined with a microfluidic chip:

[0168] Primers:

[0169] Forward primer 5'-3' (SEQ ID NO: 29):

[0170] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGTGGG

[0171] Reverse primer 5'-3' (SEQ ID NO: 30):

[0172] GGAGGCGCCAACTGAATGAACGAGTTGAAATGCGGATCAAGTTACTGCTTCGGCAGTACCTAGTGGGAAAAGTTCTTGGGTCCGTAACTAGTCGCGTCAC GTCATATAAAGTGTAATGTTACTAAAATG

[0173] T-line capture probe (modified with the sequence shown in SEQ ID NO: 31):

[0174] 5'-(TTGTAACTTGTACTCCGTAG)2-F TTTTTTTTTTTTTTT-biotin-3' (The ribose in parentheses here is 2-F substituted)

[0175] C-line capture probe (SEQ ID NO: 32):

[0176] 5'-ATAAAGTGTAATGTTACTAAAAAAAAAAAAAAAAAA-biotin-3';

[0177] Microfluidic chip spotting:

[0178] 100 μL of avidin-modified microspheres (300 μm particle size) from Suzhou Nanomicro Technology Co., Ltd. was placed in a clean centrifuge tube, 500 μL of sterile ultrapure water was added, the microspheres were dispersed by sonication, and centrifuged at 14000 rap / min at 4°C. The supernatant was carefully removed, and the above steps were repeated once.

[0179] Microsphere coupling: Add the cleaned microspheres to the PBS solution containing the capture probe to make the final concentration of the capture probe 1 μM. Then place the system on a rotary mixer and incubate at 4 °C for 30 min. After centrifugation, remove the supernatant, add 500 μL of reconstitution solution to dissolve the precipitate, sonicate to disperse, add 500 μL of sterile ultrapure water, sonicate to disperse, centrifuge at 14000 rpm / min at 4 °C, carefully remove the supernatant, repeat the above steps once, and store at 4 °C for later use.

[0180] The labeled microspheres were applied to a surface-modified glass slide using a scrubbing apparatus, incubated overnight in a constant temperature and humidity chamber, washed three times with PBS the next day, dried at 30 degrees Celsius for 24 hours, and then assembled into a chip for later use.

[0181] Using the target sample and amplification method described in Example 1, a dye molecule (SNAP-Cell 647-SiR, NEB) linked to bG and siloxane was added directly to the sample before amplification, with a final concentration of 1 μM. After amplification, the sample was placed on a microfluidic plate, as per reference... Figure 3 After incubation for 10 minutes, the fluorescence intensity on the microfluidic plate was read using a microfluidic plate fluorescence reader.

[0182] The results are shown in Table 14 below. Negative results showed no fluorescence at the detection line, while positive samples showed clearly detectable fluorescence at the detection line. This indicates that the complex constructed by using bG aptamer as the aptamer and linking the ligand and dye as the reporter group can perform addressable detection of the target on a microfluidic chip.

[0183] Table 14

[0184]

[0185] Example 9:

[0186] The application of the hybridization probe of this invention in binding to a target in samples containing single-stranded DNA-binding proteins, combined with the chemiluminescent molecule acridine ester:

[0187] Forward primer 5'-3' (SEQ ID NO: 33):

[0188] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGTGGG

[0189] Reverse primer 5'-3' (SEQ ID NO: 34):

[0190] GGAACCTCGCTTCGGCGATGATGGAGAGGCGCAAGGTTAACCG

[0191] CCTCAGGGTTCC GTCATATAAAGTGTAATGTTACTAAAATG

[0192] Capture probe (modified by the sequence shown in SEQ ID NO: 35):

[0193] 5'–(TTGTAACTTGTACTCCGTAG) 2-

[0194] MOE TTTTTTTTTTTTTTT-NH2-3'; where the nucleic acid sequence in parentheses is 2-

[0195] MOE modifier;

[0196] Slide markings:

[0197] Immerse the amino glass slide in 2.5% glutaraldehyde in PBS buffer (pH=7.2) and react at room temperature for 2 hours. After the reaction is complete, wash three times with PBS buffer, then three times with double-distilled water. Air dry at room temperature for later use. Add 1 μL of 3 μM capture probe aqueous solution and incubate overnight in a humid environment at room temperature. After incubation, wash three times with TETBS (150 mM NaCl, 20 mM Tris, 5 mM EDTA, 0.05% (v / v) Tween 20, pH=7.4) and TBS (150 mM NaCl, 20 mM Tris, pH=7.4) solutions to remove unbound oligonucleotide capture probes.

[0198] Immerse the slides in aldehyde blocking solution (0.12 g sodium borohydride dissolved in 30 mL PBS, followed by 10 mL anhydrous ethanol) for 15 min. The slides must be completely immersed in the blocking solution to block the aldehyde groups. Then, immerse the slides in 0.3 M glycine for 15 min. Rinse the slides again: rinse twice in 0.2% SDS, 2 min each time; then rinse twice with deionized water, 2 min each time.

[0199] Anhydrous triethylamine (1.5 mM) was added to 10 mL of anhydrous DMF with NHS-modified acridinium ester (NSP-SA-NHS) (1.05 mM) and DN-PEG3-NH2 ligand (1 mM). The mixture was stirred at room temperature under Ar protection. After the reaction was completed by TLC, the solvent was removed under reduced pressure. The residue was purified by reverse-phase preparative chromatography, freeze-dried, and stored at -20 °C for later use.

[0200] The sample was amplified according to the amplification method in Example 1. The amplified sample was mixed with acridinium ester-labeled ligand and incubated with a glass slide at room temperature for 30 min. After incubation, the sample was washed three times with TETBS (150 mM NaCl, 20 mM Tris, 5 mM EDTA, 0.05% (v / v) Tween 20, pH=7.4) and TBS (150 mM NaCl, 20 mM Tris, pH=7.4) solutions. 0.1 M sodium hydroxide solution and 0.1 M hydrogen peroxide solution were added. The sample was imaged using a gel imaging system under dark conditions, and grayscale calculation was performed using ImageJ.

[0201] The results are shown in Table 15 below. In negative samples, the chip signal was very weak, similar to the background fluorescence (values ​​were taken at the edge of the slide). Positive samples showed a clear signal at the detection site, indicating a positive result. Furthermore, the fluorescence at the chip detection point gradually increased with increasing target concentration. This demonstrates that the ligand-bound chemiluminescent molecule acridinium ester, acting as a reporter group, enables addressable detection of amplified targets on a gene chip. It also shows that the hybridization probe of this invention can be used for target binding in samples containing single-stranded DNA-binding proteins, and can also be used for the detection of ultramultiplexed targets.

[0202] Table 15

[0203]

[0204] Example 10:

[0205] Using SRB-2 as an aptamer and DN-PEG3-NH2-labeled methylene blue as a reporter group, this demonstrates the application of the aptamer-ligand-modified electrochemical signal group as a reporter group on a gold electrode, and the detection of the aptamer using electrochemical methods.

[0206] DN-PEG3-NH2 and NHS-methylene blue were labeled and purified according to the method in Example 9, and stored at -20°C in the dark for later use.

[0207] Primers:

[0208] Forward primer 5'-3' (SEQ ID NO: 36):

[0209] GGAACCTCGCTTCGGCGATGATGGAGAGGCGCAAGGTTAACCGC CTCAGGTTCCGGGAGCCTTGAATACACCAAAA

[0210] Reverse primer 5'-3' (SEQ ID NO: 37):

[0211] ATGATAATACGACTCACTATAGGGGTGTAGCACGATTGCAGCATT G

[0212] T-line capture probe (modified with the sequence shown in SEQ ID NO: 38):

[0213] 5'–AACGTGGGGATGGATTACCTCCTTTTTTTTTTTTTTTTTTTT SH 3', this nucleic acid capture probe is PNA modified;

[0214] The capture probe was dispersed in a Tris-TE buffer solution at pH 7 (20 mM Tris, with the addition of 140 mmol NaCl and 5 mmol MgCl2) to prepare a 10 μM solution. 2 μL was added dropwise to the pretreated gold electrode and incubated at room temperature for 24 h. After incubation, the electrode was washed three times with 10 mM Tris-HCl at pH 7.0 and stored at 4 °C for later use.

[0215] According to the amplification method in Example 1, the amplified product was dropped onto an electrode dried with nitrogen gas and incubated for 30 min. Square wave voltammetry was then performed on the electrode within the range of -0.35 to 1.5 V. The results are as follows: Figure 4 As shown, when a target is present, the electrode generates a significant electrochemical signal, while when no target is present, no significant electrochemical signal is detected. This indicates that the electrochemical signal group modified by the aptamer-ligand can be used as a reporter group to amplify the addressability detection of the target.

[0216] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of a hybridization probe for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that, The hybridization probe comprises at least one nucleic acid sequence comprising at least one of a base modification, a ribose modification, and a phosphate modification.

2. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The base modification is selected from at least one of the group consisting of a 5-position pyrimidine modification, an 8-position purine modification, a cytosine exocyclic modification, a 5-bromouracil substitution, a 5-bromodeoxyuridine substitution, and a 5-bromodeoxycytidine substitution.

3. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The base modification comprises a substitution of a base with an artificial base, and the artificial base is independently selected from at least one of the group consisting of a xanthine, a diamino purine, an 8-oxo-N6-methyladenine, a 7-deazaxanthine, a 7-deazaguanine, an N4,N4-ethanol cytosine, an N',N'-ethanol-2,6-diaminopurine, a 5-methylcytosine, a 5-(C3-C6)-alkynyl-cytosine, The base modification comprises a substitution of a base with an artificial base, and the artificial base is independently selected from at least one of the group consisting of a xanthine, a diamino purine, an 8-oxo-N6-methyladenine, a 7-deazaxanthine, a 7-deazaguanine, an N4,N4-ethanol cytosine, an N',N'-ethanol-2,6-diaminopurine, a 5-methylcytosine, a 5-(C3-C6)-alkynyl-cytosine, 4. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The ribose modification comprises a substitution of a 2'-OH group and / or H of a sugar moiety of a nucleotide with a group selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NHR, NR2, NR"R, N3, CN, F, Cl, Br, and I.

5. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The ribose modification is selected from at least one of the group consisting of a 2'-methoxyethyl, a 2'-O-methyl, a 2'-O-ethyl, a 2'-O-aminopropyl, a 2'-O-allyl, a 2'-O-butyl, a 1-(4'-thio-PD-ribofuranose), a 2-O-4-C, and a L-DNA modification.

6. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The ribose modification comprises a substitution of a sugar ring, and the substitution of the sugar ring is selected from at least one of the group consisting of a threose, a cyclohexenyl ribose, and a pyranose nucleic acid.

7. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The phosphate modification is selected from at least one of the group consisting of a phosphorothioate linkage, a phosphoroselenoate linkage, an alkyl phosphotriester linkage, an aryl phosphotriester linkage, an alkyl phosphate linkage, an aryl phosphate linkage, a hydrogenophosphonate linkage, and an alkyl phosphoramidate linkage.

8. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The phosphate modification comprises a substitution of a phosphate, and the substitution of the phosphate is selected from at least one of the group consisting of a substitution of a peptide nucleic acid, a substitution of a morpholino nucleic acid, and a substitution of a triazole linkage.

9. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The sample containing single-stranded DNA binding protein is reacted in an amplification system selected from the group consisting of a recombinase polymerase amplification system or a dilution thereof, a strand displacement amplification system or a dilution thereof, a SIBA amplification system or a dilution thereof, a helicase-dependent amplification system or a dilution thereof, a rolling circle amplification system or a dilution thereof, a nucleic acid-dependent amplification system or a dilution thereof, and combinations thereof.

10. Use of a hybridization probe according to claim 9 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The sample containing single-stranded DNA binding protein comprises a single-stranded DNA binding protein, and the source of the single-stranded DNA binding protein is selected from the group consisting of an E. coli single-stranded DNA binding protein, a myovirus phage DNA binding protein, and a mutant, fragment, or combination thereof.

11. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The hybridization probe is modified with at least one of the group consisting of a unit of optical signal, a unit of electrical signal, a unit of acoustic signal, a unit of magnetic signal, an enzyme unit, an active group, a quenching group, and a minor groove binding group.

12. Use of a hybridization probe according to claim 11 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The quenching group is selected from at least one of the group consisting of mono-azo dyes and di-azo dyes.

13. Use of a hybridization probe according to claim 11 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The quenching group is selected from at least one of the group consisting of gold nanoparticles and single-walled carbon nanotubes.

14. Use of a hybridization probe according to claim 11 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The quenching group is selected from at least one of the group consisting of graphene oxide, nitroaniline, dinitroaniline, nitrobenzene, and dinitrobenzene.

15. Use of a hybridization probe according to claim 11 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The active group is selected from at least one of the group consisting of hydroxyl, thiol, disulfide, amino, carboxyl active ester, azido group, 4-benzochalcophenone, azadibenzocyclooctyne, and tetrazine.

16. Use of a hybridization probe according to claim 11 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The enzyme unit is selected from at least one of the group consisting of horseradish peroxidase, luciferase, alkaline phosphatase, urease, and beta-galactosidase.

17. Use of a hybridization probe according to claim 11 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The minor groove binding group is selected from at least one of the group consisting of CC1065 analogs, fomivirsen, distamycin, netropsin, berenil, duocarmycin, pentamidine, 4,6-diamino-2-phenylindole, and pyrrolo[2,1-c][1,4]benzodiazepine.

18. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The hybridization probe is modified with at least one viscosity-responsive dye between the 3' end and the 5' end.

19. Use of a hybridization probe according to claim 18 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The viscosity-responsive dye is selected from at least one of the group consisting of cyanine dyes, hemicyanine dyes, thiazole orange dyes, acridine dyes, ethidium dyes, proflavine dyes, daunomycin dyes, ellipticine dyes, anthracene dyes, quinacrine dyes, and 5'-, 6'-, 7'-, or 8'-hydroxyquinoline, quinoline blue, quinoline violet, quinoline red.

20. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The hybridization probe is modified with at least one of the group consisting of phosphorescent dyes and fluorescent dyes.

21. Use of a hybridization probe according to claim 1 for binding to a target in a sample containing a single-stranded DNA binding protein, characterized in that: The hybridization probe is modified with at least one of the group consisting of time-resolved fluorescent dyes, activated fluorescent dyes, and cryptic fluorescent dyes.