Primer, kit, application and method for identifying the relationship of protoglabrus protogenos by microsatellite marker

Abstract

This application discloses a primer, kit, application, and method for identifying microsatellite markers for identifying the kinship of mandarin fish. There are ten pairs of primers, which are divided into five groups for double PCR reaction, enabling low-cost, high-efficiency, and standardized large-scale kinship identification and pedigree management of mandarin fish.

Description

Technical Field

[0001] This application relates to the field of animal molecular genetics, and in particular to primers, kits, applications and methods for identifying microsatellite markers for identifying kinship in mandarin fish. Background Technology

[0002] The spotted mandarin fish (Siniperca scherzeri) is a valuable economic fish species endemic to the Yangtze River, Pearl River, and southeastern coastal water systems of my country. Due to its tender flesh and high economic value, it has become an important species for intensive pond and cage aquaculture. In the past decade, the annual demand for spotted mandarin fish fry in China has exceeded 1.5 billion. However, artificial breeding has long relied on wild-caught parent fish, leading to increasingly prominent problems such as inbreeding depression, mixed germplasm, and declining genetic diversity.

[0003] Currently, the industry is experiencing widespread problems such as slower growth rates, higher rates of deformities, and reduced stress resistance, which severely restricts the healthy and sustainable development of mandarin fish farming. Therefore, establishing an accurate and efficient kinship identification system for mandarin fish, and confirming the pedigree and genetic management of core breeding populations, has become an urgent need for the protection of mandarin fish germplasm resources and the selection of superior varieties. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this application provides primers, reagent kits, applications, and methods for identifying microsatellite markers in mandarin fish, enabling low-cost, high-efficiency, and standardized large-scale parentage testing and pedigree management of mandarin fish.

[0005] Firstly, this application provides primers for identifying the kinship of mandarin fish. There are ten pairs of primers, which are divided into five groups for double PCR reactions. The ten pairs of primers are as follows:

[0006] BG1-F, sequence as shown in SEQ ID No. 1; BG1-R, sequence as shown in SEQ No. 2; BG2-F, sequence as shown in SEQ ID No. 3; BG2-R, sequence as shown in SEQ No. 4; BG3-F, sequence as shown in SEQ ID No. 5; BG3-R, sequence as shown in SEQ No. 6; BG4-F, sequence as shown in SEQ ID No. 7; BG4-R, sequence as shown in SEQ No. 8; BG5-F, sequence as shown in SEQ ID No. 9; BG5-R, sequence as shown in SEQ No. 10; BG6-F, sequence as shown in SEQ ID No. 11; BG6-R, sequence as shown in SEQ No. 12; BG7-F, sequence as shown in SEQ ID No. 13; BG7-R, sequence as shown in SEQ No. 14; BG8-F, sequence as shown in SEQ ID No. 15; BG8-R, sequence as shown in SEQ No. 16; BG7-F, sequence as shown in SEQ ID No. 17; BG8-F, sequence as shown in SEQ ID No. 18; BG8-R, sequence as shown in SEQ No. 19; BG1-F, sequence as shown in SEQ No. 10; BG6-F, sequence as shown in SEQ ID No. 11; BG6-R, sequence as shown in SEQ No. 12; BG7-F, sequence as shown in SEQ ID No. 13; BG7-R, sequence as shown in SEQ No. 14; BG8-F, sequence as shown in SEQ ID No. 15; BG8-R, sequence as shown in SEQ No. 19; BG2-F, sequence as shown in SEQ ID No. 10; BG2-F, sequence as shown in SEQ ID No. 11; B As shown in No. 16; BG9-F, sequence as shown in SEQ ID No. 17; BG9-R, sequence as shown in SEQ No. 18; BG10-F, sequence as shown in SEQ ID No. 19; BG10-R, sequence as shown in SEQ No. 20;

[0007] The annealing temperature for each primer pair is 56℃.

[0008] Furthermore, in the primers for identifying the kinship of mandarin fish provided in this application, BG1 is used in combination with BG2, BG3 is used in combination with BG4, BG5 is used in combination with BG6, BG7 is used in combination with BG8, and BG9 is used in combination with BG10.

[0009] Secondly, this application also provides a kit comprising primers for identifying microsatellite markers for identifying the kinship of mandarin fish provided in the first aspect.

[0010] Thirdly, this application also provides an application of primers for identifying the kinship of mandarin fish using microsatellite markers, which applies the primers for identifying the kinship of mandarin fish provided in the first aspect to identify the kinship of mandarin fish.

[0011] Fourthly, this application also provides a primer screening method for microsatellite markers used to identify the kinship of mandarin fish, which is used to screen out the primers provided in the first aspect for identifying the kinship of mandarin fish. The method includes:

[0012] Provide N microsatellite sequences with repeating units of more than 3 bases to design N primer pairs; where N is greater than or equal to 10.

[0013] Based on microsatellite marker technology, the M pairs of primers were screened using genomic DNA templates from mandarin fish samples to obtain ten pairs of primers.

[0014] Fifthly, this application also provides a method for identifying the kinship of mandarin fish using microsatellite marker technology, which includes:

[0015] S1. Extract genomic DNA from different populations of spotted mandarin fish;

[0016] S2. Using the mandarin fish genomic DNA extracted in S1 as a DNA template, and using the primers provided in the first part, which are divided into five groups, PCR amplification is performed to obtain the amplification product.

[0017] S3. The amplification products were subjected to electrophoresis and silver staining using polyacrylamide gel to obtain the silver staining results.

[0018] S4. Based on the silver staining results, UPGMA cluster analysis diagrams were drawn using genetic analysis software to obtain clustering results, and the genetic relationships of different mandarin fish populations were identified based on the clustering results.

[0019] Furthermore, in the method for identifying the kinship of spotted mandarin fish using microsatellite marker technology provided in this application, the PCR amplification reaction system has a capacity of 25 μL, and the contents are as follows:

[0020] 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 0.5 μL each of the upstream and downstream of two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water.

[0021] Furthermore, in the method for identifying the kinship of spotted mandarin fish using microsatellite marker technology provided in this application, the PCR amplification reaction procedure is as follows:

[0022] Pre-denaturate at 94℃ for 3 minutes;

[0023] The process was repeated sequentially: denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 45 seconds, for a total of 35 cycles.

[0024] Extend at 72°C for 10 minutes and store at 4°C.

[0025] Furthermore, in the method for identifying the kinship of mandarin fish using microsatellite labeling technology provided in this application, the amplified products are subjected to electrophoresis and silver staining using 12% polyacrylamide gel.

[0026] Furthermore, in the method for identifying the kinship of spotted mandarin fish using microsatellite marker technology provided in this application, the genetic analysis software includes MEGA software.

[0027] This application provides primers, a reagent kit, applications, and methods for identifying microsatellite markers in mandarin fish, which have the following advantages compared to existing technologies:

[0028] 1. Higher genetic resolution: This application, through large-scale transcriptome and genome data mining, has for the first time screened and verified 10 microsatellite loci with high polymorphism and strong stability, and constructed a special microsatellite combination system suitable for mandarin fish. Compared with the problems of limited number of loci and insufficient polymorphism in the prior art, this invention significantly improves the genetic discrimination ability and can achieve accurate identification at the individual and family levels.

[0029] 2. Significantly improved detection efficiency: The dual PCR amplification system optimizes 10 pairs of primers into 5 sets of dual reaction systems, which can amplify two sites at the same time. Compared with the traditional single-site PCR amplification method, it saves about 50% of reagent and time costs, significantly improves detection throughput, and is suitable for rapid screening of large-scale breeding populations.

[0030] 3. Simple operation and wide applicability: Compared with the high requirements of experimental platforms and bioinformatics analysis capabilities for high-throughput technologies such as SNP, this application can be completed based on conventional PCR and polyacrylamide gel electrophoresis, without the need for expensive equipment or complex algorithm support, making it particularly suitable for use in grassroots seed farms, small and medium-sized breeding enterprises and field resource surveys.

[0031] 4. Overcoming the shortcomings of traditional methods: Traditional morphological or physical marker methods are difficult to operate and have large errors in the early stage of mandarin fish. However, the present invention is based on molecular markers at the DNA level, which is not affected by individual development stage, environmental factors or human judgment, and realizes non-invasive, accurate and traceable kinship identification, which is especially suitable for family management in the early seedling stage.

[0032] 5. Promote the standardization of the mandarin fish breeding system: This application establishes for the first time a microsatellite marker-assisted breeding technology system specifically for mandarin fish, providing a standardized tool for pedigree confirmation, genetic diversity monitoring, inbreeding coefficient control and breeding of superior varieties of mandarin fish core breeding populations. It helps to solve problems such as slow growth and increased deformity rate caused by inbreeding depression and mixed germplasm in the current industry.

[0033] 6. Possesses ecological restoration and resource protection value: By accurately identifying the genetic background of different geographical populations or families, this invention can provide a scientific basis for the propagation and release of spotted mandarin fish, the delineation of germplasm resource protection areas, and population tracing in aquatic ecological restoration, thereby avoiding pollution from foreign germplasm and improving the efficiency of ecological restoration.

[0034] In summary, this application has outstanding technical advantages and broad application prospects in the protection of spotted mandarin fish germplasm resources, genetic improvement, parentage identification and sustainable industrial development, filling the gap in domestic research on microsatellite marker systems for spotted mandarin fish. Attached Figure Description

[0035] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0036] Figure 1 The UPGMA clustering analysis diagram of spotted mandarin fish in the example is shown. Detailed Implementation

[0037] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0038] It should be understood that, when used in this specification and the appended claims, the terms "comprising" and "including" indicate the presence of the described features, integrals, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or collections thereof.

[0039] It should also be understood that the terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the scope of the application. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” are intended to include the plural forms unless the context clearly indicates otherwise.

[0040] It should also be further understood that the term “and / or” as used in this application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0041] In related technologies, fish pedigree confirmation mainly relies on physical markers (tags, fin clipping, fluorescent dyes, etc.) or comparison of morphological characteristics.

[0042] Physical markers are difficult to apply in the early stages of spotted mandarin fish breeding (<3 cm), easily causing mechanical damage and affecting survival rates. Morphological methods are susceptible to environmental factors, developmental stages, and human error, making it difficult to distinguish between full siblings, half siblings, and unrelated individuals. Furthermore, chemical and electronic markers are costly and have strict requirements on fish size, making them unsuitable for large-scale breeding populations. Therefore, relying on physical markers or morphological comparisons can no longer meet the demands of modern spotted mandarin fish breeding for high-throughput, precise pedigree management.

[0043] With the development of molecular biology, various DNA marker technologies have been applied to the analysis of fish genetic structure and identification of kinship, including random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), mitochondrial DNA sequence, single nucleotide polymorphism (SNP), and microsatellite markers (SSR).

[0044] RAPD and AFLP have poor reproducibility and insufficient codominance, making it difficult to distinguish between heterozygotes and homozygotes; mitochondrial DNA only reflects maternal genetic information; although SNP has high throughput, its development cost is high and it has high requirements for experimental platforms and bioinformatics, which limits its widespread application in small and medium-sized breeding enterprises and grassroots seedling farms.

[0045] Meanwhile, microsatellite markers have advantages such as codominance, high polymorphism, good repeatability, short experimental cycle, and simple operation, and have been successfully applied in various economic fish species, including salmon, cyprinids, and catfish. By screening for polymorphic microsatellite loci, microsatellite markers can enable individual identification, parentage testing, and genetic diversity assessment even in the absence of pedigree records.

[0046] However, the development of microsatellite markers for mandarin fish started relatively late, and the number of publicly available loci is limited. Moreover, most of these loci are concentrated in population genetic structure studies, and a high-resolution microsatellite ensemble system that can be used for large-scale parentage testing and core family management has not yet been established.

[0047] Therefore, this application provides primers, reagent kits, applications, and methods for identifying microsatellite markers for identifying the kinship of mandarin fish, which can realize low-cost, high-efficiency, and standardized large-scale kinship identification and pedigree management of mandarin fish.

[0048] In some embodiments, this application provides primers for microsatellite markers to identify the kinship of mandarin fish. There are ten pairs of primers, which are divided into five groups for duplex PCR reactions. The ten pairs of primers are as follows:

[0049] BG1-F, sequence as shown in SEQ ID No. 1; BG1-R, sequence as shown in SEQ No. 2; BG2-F, sequence as shown in SEQ ID No. 3; BG2-R, sequence as shown in SEQ No. 4; BG3-F, sequence as shown in SEQ ID No. 5; BG3-R, sequence as shown in SEQ No. 6; BG4-F, sequence as shown in SEQ ID No. 7; BG4-R, sequence as shown in SEQ No. 8; BG5-F, sequence as shown in SEQ ID No. 9; BG5-R, sequence as shown in SEQ No. 10; BG6-F, sequence as shown in SEQ ID No. 11; BG6-R, sequence as shown in SEQ No. 12; BG7-F, sequence as shown in SEQ ID No. 13; BG7-R, sequence as shown in SEQ No. 14; BG8-F, sequence as shown in SEQ ID No. 15; BG8-R, sequence as shown in SEQ No. 16; BG7-F, sequence as shown in SEQ ID No. 17; BG8-F, sequence as shown in SEQ ID No. 18; BG8-R, sequence as shown in SEQ No. 19; BG1-F, sequence as shown in SEQ No. 10; BG6-F, sequence as shown in SEQ ID No. 11; BG6-R, sequence as shown in SEQ No. 12; BG7-F, sequence as shown in SEQ ID No. 13; BG7-R, sequence as shown in SEQ No. 14; BG8-F, sequence as shown in SEQ ID No. 15; BG8-R, sequence as shown in SEQ No. 19; BG2-F, sequence as shown in SEQ ID No. 10; BG2-F, sequence as shown in SEQ ID No. 11; B As shown in No. 16; BG9-F, sequence as shown in SEQ ID No. 17; BG9-R, sequence as shown in SEQ No. 18; BG10-F, sequence as shown in SEQ ID No. 19; BG10-R, sequence as shown in SEQ No. 20;

[0050] The annealing temperature for each primer pair is 56℃.

[0051] Specifically, the sequence of BG1-F is: TGTGACTGCTCCGACTTTAC, and the sequence of BG1-R is: TGGCTCAGACTGATTACTGC.

[0052] The sequence of BG2-F is: AGTATTGTTCGGCCTCTG, and the sequence of BG2-R is: CCCTGCTGCGTTTATC;

[0053] The sequence of BG3-F is: CACAAACGTCCCGAAAG, and the sequence of BG3-R is: AATTATTACCGAGCTAACACTC;

[0054] The sequence of BG4-F is: GACGCAGAAAGCCCATC, and the sequence of BG4-R is: AGTCCCAGACGCCAGAAT.

[0055] The sequence of BG5-F is: TCTCAAAACATGGCCTAA, and the sequence of BG5-R is: AACATAGCATTACCAGCAT.

[0056] The sequence of BG6-F is: TCACAGTTGCGTGTCCAT, and the sequence of BG6-R is: AAACAGCCGATATTCATTG;

[0057] The sequence of BG7-F is: TCAGTTTTCAAGCGATA, and the sequence of BG7-R is: AAAAGCGACTTACATG;

[0058] The sequence of BG8-F is: CTGGGTTGTTTCTCGTTC, and the sequence of BG8-R is: AGGCAGGTCACTTGTTGT.

[0059] The sequence of BG9-F is: AAGCGGTTGTTACTGTGATGC, and the sequence of BG9-R is: AGATTGACGGGCTGAAC.

[0060] The sequence of BG10-F is: TCCTCAGCCACTAATGTG, and the sequence of BG10-R is: GCAATGCGATAACTTCTG.

[0061] In some embodiments, BG1 is used in conjunction with BG2, BG3 is used in conjunction with BG4, BG5 is used in conjunction with BG6, BG7 is used in conjunction with BG8, and BG9 is used in conjunction with BG10.

[0062] In this application, the microsatellite molecular marker F1 corresponding to primer pair BG1 is shown in SEQ ID No. 21, and its specific sequence is as follows:

[0063] cagtaaaatctgtctgcctgcaggtgaaccctcaggcgtctctgtccatgtctctggctcagactgattactgcagacagcagggcttcgaccctcagagtcctctctgcgctcacatcatcctgtctggatctgtgatggaggtacacgCACACACA CACACACAcgcacacacacctgtgtatccaggtggtaaagtcggagcagtcacatgaccctctcctccctcctcttgtccaggtgaacggcacggaggcggactttgctaagaaagctctgttcagtcgacatccggagatgatcgactggccgtctg

[0064] The microsatellite molecular marker F2 corresponding to primer pair BG2 is shown in SEQ ID No. 22, and its specific sequence is as follows:

[0065] atttgttgtaaatttattgctaaaacttctcacttgaatttgaccttttttaaagcaggttttgaatagaactgtatgcatgaaactgagctgatcgtgtgtacatgacactcgccctgctgcgtttatcagaccacaagcccacccgacCACACACACACACACACACACAC ACACACACACACACACACACActgctgctgtagcgctggcttcctgatgtgctttatattcgagctatctctgctcttatctgacttcatttatatcagacgtaccgtctccagaggccgaacatactgaagtgaccagagatcgctgagcgcgataatctggtctttcatc

[0066] The microsatellite molecular marker F3 corresponding to primer pair BG3 is shown in SEQ ID No. 23, and its specific sequence is as follows:

[0067] GagtgacggttctgacggtcgtctgtgtgtctgcgttacctgaaggactcgtgtcccggtgtgtcgatgatcagcatgccggggatcttcaggttgtctttgtcaaactgcacaaacacaaacagttaaattattaccgagctaacactcGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTgcgcgtgttgtcgtcgtacgtttttaaccatcctggtctgatcctcaatcgtctctttcgggacgtttgtggctccgatctgctgagtgattcctccggcctccccgtcctggacatgagtgtgtcgcagctacacacacacacacacac

[0068] The microsatellite molecular marker F4 corresponding to primer pair BG4 is shown in SEQ ID No. 24, and its specific sequence is as follows:

[0069] cctccctctctctcctctttggccccgcccacctgatcttgaccccccctgtatataaaaagttttcggtgtgtggcggctcccgagtcccagacgccagaatggaaacgctcctctgcgcgctcactggcacaccttcctctcctccttCTCCTCCTCCTCCTC CTCCTCCTCCTCCTCatcgtcttcgtcttaattgcgcatcggcactccggcagcaccacacagggagtcacgagcaagaacgaaacatgtgtagagaatagaaaccgtgaggatgatgatgatgatgatgggctttctgcgtctgtgatggactgaactttaaaa

[0070] The microsatellite molecular marker F5 corresponding to primer pair BG5 is shown in SEQ ID No. 25, and its specific sequence is as follows:

[0071] taattgaattaataactataaccaaaactacaattaatagctagtaggttgaaggatttggagttcaacatagcattaccagcattattatacacaagcatttattaatataataaaagcaaaacacacaataaaaatgcactttctacagGTGTGTG TGTGTGTaggagaaaaacaaaatggatgcctggattcaaaatggcggcagaggactcatggttagacaaagaaagtaaattcaaaatggcggcttaggccatgtttgagaaagtgtgtgtgttaaaagctaaactggagtgtatgtgtgaaccgttt

[0072] The microsatellite molecular marker F6 corresponding to primer pair BG6 is shown in SEQ ID No. 26, and its specific sequence is as follows:

[0073] TactaagggtgcgccgattgattggccactgatcataaacagccgatattcattggtctttacaaaagcagatcagaagagccgatcagatgacgcaatgccgcccaggtatattaacggccagcgagtgggtgttcgcagaaaagcactGAGAG AGAGAaacgttaactggtattacattagaagaagcggacatggtggatattttacaagcatggacacgcaactgtgaaaagtgagcacacctggttggtgacaatgtcattcggtaccacgttggtttcaatcgtttcgataggctaagcagagt

[0074] The microsatellite molecular marker F7 corresponding to primer pair BG7 is shown in SEQ ID No. 27, and its specific sequence is as follows:

[0075] cagaataaaagcgacttacatgtggtgagtttttaaggcgtcgatgtttttacatttggctgttgtttttaagctgcaaaataaatcaagatttagtatctgatacactttataaaatgtaatatgttgccggaagaaaaattagctaATATATATATATATATATATATATATATATA TATATATATATATATATATATATATATATtcaatacaagatggaatttttttaaatatatgtctaaataaaaatatattattttgtgtattttaattctaaagtgtattatatctattttatattattattgttgttcgcctttattctgaaaggtaatatcgcttgaaactgacatat

[0076] The microsatellite molecular marker F8 corresponding to primer pair BG8 is shown in SEQ ID No. 28, and its specific sequence is as follows:

[0077] ggcctcgtgacacactctgcaggctcataaaaagaggcaggtcacttgttgtactcatgaaattcaatatctgacatgatatttgatgcgtggagctgatgaaccgggtgctgctcagggacacacactgaacatcggccaactctgctcTGTGTGTGTGTGTG TGTGTGTGTGTGTGgttgtctttatatactgactgaacgagaaacaacccaggtgttcagctgatgttgaacagatgttgatacaggggcctgaagtcccgccaaaataaaagcagagacctgctacctgcattgttttgctaaacttccagatatcagttccc

[0078] The microsatellite molecular marker F9 corresponding to primer pair BG9 is shown in SEQ ID No. 29, and its specific sequence is as follows:

[0079] GtgtgtgagagagagagagagagacatggcagggttgtgttgaatcagtctcctcagtataaggtcagagcttttgtgtcggctgtcgtgcagcctgaatgcagattgacgggctgaaccctgcagcctggcaccccattaaaattcacaGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTgatctaactgcaggctctatatgaaaaacacactgtgactccagtgcatggtggtggttgtttccttagtttgctgcatcacagtaacaacgcttcatgaatgcaacttctgtgcaacgtttggggaaatcaataaaaatcaggaattg

[0080] The microsatellite molecular marker F10 corresponding to primer pair BG10 is shown in SEQ ID No. 30, and its specific sequence is as follows:

[0081] TtgttggttttttgtaaataatattataaagagtacggtctagacctgctctgtaggaaaagtgcaatgcgataacttctgctataaattggcgctatataaataaaattgaattgaattaatggagacgggacgatccataaagaggttTGTGT GTGTGatcagatgtcgccctcctctttcacacacaacattctgtgggtcactctgtgtctgagacacttcccacattagtggctgaggaggggggcggaggggtacacatcccccaagaggcctgtaagcagggggttttgttagaaaaatcccc

[0082] In some embodiments, this application also provides a kit comprising primers for microsatellite markers used to identify kinship among mandarin fish. Specifically, the kit can be used for genetic diversity analysis of mandarin fish populations to identify kinship among them.

[0083] In some embodiments, this application also provides the application of primers for identifying microsatellite markers for identifying the kinship of mandarin fish, which are used to identify the kinship of mandarin fish and distinguish the genetic diversity of mandarin fish populations.

[0084] In some embodiments, this application also provides a method for identifying the kinship of mandarin fish using microsatellite tagging technology, comprising:

[0085] S1. Extract genomic DNA from different populations of spotted mandarin fish;

[0086] S2. Using the mandarin fish genomic DNA extracted in S1 as a DNA template, and using the primers provided in this application in five groups, PCR amplification was performed to obtain the amplification product.

[0087] S3. The amplification products were subjected to electrophoresis and silver staining using polyacrylamide gel to obtain the silver staining results.

[0088] S4. Based on the silver staining results, UPGMA cluster analysis diagrams were drawn using genetic analysis software to obtain clustering results, and the genetic relationships of different mandarin fish populations were identified based on the clustering results.

[0089] In some embodiments, the PCR amplification reaction system has a capacity of 25 μL, and consists of:

[0090] 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 0.5 μL each of the upstream and downstream of two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water.

[0091] In some embodiments, the PCR amplification reaction procedure is as follows:

[0092] Pre-denaturate at 94℃ for 3 minutes;

[0093] The process was repeated sequentially: denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 45 seconds, for a total of 35 cycles.

[0094] Extend at 72°C for 10 minutes and store at 4°C.

[0095] In some embodiments, the amplified products are subjected to electrophoresis and silver staining using a 12% polyacrylamide gel.

[0096] In some embodiments, the genetic analysis software includes MEGA (Molecular Evolutionary Genetics Analysis) software.

[0097] In some embodiments, this application also provides a primer screening method for microsatellite markers used to identify the phylogenetic relationships of mandarin fish, which is used to screen out the primers provided in this application for identifying the phylogenetic relationships of mandarin fish. The method includes:

[0098] Provide N microsatellite sequences with repeating units of more than 3 bases to design N primer pairs; where N is greater than or equal to 10.

[0099] Based on microsatellite marker technology, the M pairs of primers were screened using genomic DNA templates from mandarin fish samples to obtain ten pairs of primers.

[0100] In this application, before screening the primers, it is necessary to select mandarin fish samples and extract mandarin fish genomic DNA. During the extraction process, the Tiangen Blood Tissue Genomic DNA Extraction Kit developed by Tiangen Biotech Co., Ltd. can be used. The kit includes buffer LP1, buffer LP2, buffer LP3, wash buffer PW, adsorption column CB3, and elution buffer.

[0101] Specifically, in the process of selecting mandarin fish samples, three full-sib families of mandarin fish can be taken from the mandarin fish farm, with 10 offspring samples taken from each family, for a total of 30 samples. The first family sample is marked as 1-10, the second family sample is marked as 11-20, and the third family sample is marked as 21-30.

[0102] During the extraction of mandarin fish genomic DNA template, the mandarin fish genomic DNA was extracted using the Tiangen Blood Tissue Genomic DNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing). The extracted DNA was stored at -20℃ for long-term preservation.

[0103] Furthermore, in the process of screening primers for microsatellite markers to identify the kinship of mandarin fish, primers can be obtained and preliminarily screened. Then, the universality of primers for polymorphic sites can be detected, followed by double PCR amplification. Finally, detection and identification can be performed, and thus 10 pairs of better primers can be screened out. At the same time, genetic structure analysis can be performed based on the results of double PCR amplification.

[0104] In the process of obtaining primers, microsatellite search software can be used to search for microsatellite fragments in the mandarin fish genome and transcriptome obtained from previous sequencing. Among the fragments containing microsatellites, 500 microsatellite sequences with repeat units of more than 3 bases are selected. Microsatellite primers are designed using Primer 6 software, and a total of 500 pairs of primers are designed and sent to a primer company for synthesis.

[0105] During the initial primer screening, six mandarin fish genomic DNA templates were randomly selected from the extracted mandarin fish genomic DNA templates to screen the synthesized primers and select microsatellite markers that could be stably amplified. The PCR reaction system was as follows: the PCR amplification reaction system had a volume of 25 μL and consisted of: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTPs, 3 μL of 2 mmol / L MgCl2, 0.5 μL each of the forward and reverse ends of the two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water. The PCR amplification reaction program was as follows: pre-denaturation at 94℃ for 3 minutes; followed by denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, and extension at 72℃ for 45 seconds, for a total of 35 cycles; final extension at 72℃ for 10 minutes, and storage at 4℃.

[0106] During the universality detection of primers for polymorphic sites, microsatellite markers with good polymorphism, few deletions, and stable amplified bands were selected. Thirty mandarin fish genomic DNA samples were selected from the extracted mandarin fish genomic DNA template, and the selected microsatellite markers with good polymorphism, few deletions, and stable amplified bands were subjected to PCR amplification again. The microsatellite markers were then evaluated. The PCR reaction system was 25 μL, consisting of: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTPs, 3 μL of 2 mmol / L MgCl2, 0.5 μL each of the forward and reverse ends of the two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water. The PCR amplification reaction program was as follows: pre-denaturation at 94℃ for 3 minutes; denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, extension at 72℃ for 45 seconds, for a total of 35 cycles; extension at 72℃ for 10 minutes, and storage at 4℃.

[0107] During the duplex PCR amplification process, after amplifying the genomic DNA of 30 mandarin fish samples, microsatellite markers that still exhibit good polymorphism, few deletions, and stability can be screened. These markers are then randomly paired to form duplex PCR primer sets, and the DNA from the aforementioned 30 samples is amplified using the duplex PCR amplification system. The PCR reaction system has a volume of 25 μL and consists of: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 0.5 μL each of the forward and reverse ends of the two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 13.5 μL of ultrapure water. The PCR amplification reaction program was as follows: pre-denaturation at 94℃ for 3 minutes; denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, extension at 72℃ for 45 seconds, for a total of 35 cycles; extension at 72℃ for 10 minutes, and storage at 4℃.

[0108] Finally, during the detection and identification process, the above-mentioned mandarin fish PCR products can be separated by electrophoresis using a 12% non-denaturing polyacrylamide gel, silver-stained, and photographed. This allows for the selection of ten optimal primer pairs. The sequences of the ten primer pairs are as follows:

[0109] BG1:F:TGTGACTGCTCCGACTTTAC

[0110] R:TGGCTCAGACTGATTACTGC

[0111] BG2:F:AGTATGTTCGGCCTCTG

[0112] R:CCCTGCTGCGTTTATC

[0113] BG3:F:CACAAACGTCCCGAAAG

[0114] R:AATTATTACCGAGCTAACACTC

[0115] BG4:F:GACGCAGAAAGCCCATC

[0116] R:AGTCCCAGACGCCAGAAT

[0117] BG5:F:TCTCAAACATGGCCTAA

[0118] R:AACATAGCATTACCAGCAT

[0119] BG6:F:TCACAGTTGCGTGTCCAT

[0120] R:AAACAGCCGATATTCATTG

[0121] BG7:F:TCAGTTTCAAGCGATA

[0122] R:AAAAGCGACTTACATG

[0123] BG8:F:CTGGGTTGTTTCTCTCGTTC

[0124] R:AGGCAGGTCACTTGTTGT

[0125] BG9:F:AAGCGTTGTTACTGTGATGC

[0126] R:AGATTGACGGGCTGAAC

[0127] BG10:F:TCCTCAGCCACTAATGTG

[0128] R:GCAATGCGATAACTTCTG

[0129] The annealing temperature for each primer pair is 56℃.

[0130] In addition, during the genetic structure analysis, the results of the double PCR amplification can be digitized and analyzed using MEGA software to construct a UPGMA clustering analysis diagram, as shown in the figure below. Figure 1As shown, the 30 mandarin fish specimens were divided into three branches: 1 to 10 clustered in one branch, 11 to 20 in another, and 21 to 30 in yet another. Therefore, it can be confirmed that the UPGMA clustering analysis diagram and the sampling classification are consistent, further demonstrating that the 10 primer pairs provided in this application can assess the genetic relationships of mandarin fish, offering a new technical method and means for studying the genetic diversity and phylogenetic analysis of mandarin fish.

[0131] This application utilizes the extraction and quality testing of mandarin fish genomic DNA templates, PCR amplification, electrophoresis detection, and polymorphism evaluation to perform genotyping on mandarin fish individuals from different geographical origins or populations. Combined with cluster analysis, it accurately identifies the kinship relationships between individual mandarin fish and between populations, thus overcoming the technical deficiencies of unclear genetic background and insufficient number of molecular markers in existing mandarin fish germplasm identification. This provides reliable technical support for the protection of mandarin fish germplasm resources, identification of kinship, breeding of superior varieties, and genetic improvement, and promotes the in-depth development of molecular marker-assisted breeding and genomics research in mandarin fish.

[0132] The above description is merely a specific embodiment of this application, but the scope of protection of this application is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in this application, and these modifications or substitutions should all be covered within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.

Claims

1. A primer of a microsatellite marker for identifying the genetic relationship of Procyprinus, characterized in that, The ten pairs of primers are divided into five groups for double PCR reaction, and the ten pairs of primers are as follows: BG1-F, the sequence of which is shown as SEQ ID No. 1, BG1-R, the sequence of which is shown as SEQ No. 2; BG2-F, the sequence of which is shown as SEQ ID No. 3, BG2-R, the sequence of which is shown as SEQ No. 4; BG3-F, the sequence of which is shown as SEQ ID No. 5, BG3-R, the sequence of which is shown as SEQ No. 6; BG4-F, the sequence of which is shown as SEQ ID No. 7, BG4-R, the sequence of which is shown as SEQ No. 8; BG5-F, the sequence of which is shown as SEQ ID No. 9, BG5-R, the sequence of which is shown as SEQ No. 10; BG6-F, the sequence of which is shown as SEQ ID No. 11, BG6-R, the sequence of which is shown as SEQ No. 12; BG7-F, the sequence of which is shown as SEQ ID No. 13, BG7-R, the sequence of which is shown as SEQ No. 14; BG8-F, the sequence of which is shown as SEQ ID No. 15, BG8-R, the sequence of which is shown as SEQ No. 16; BG9-F, the sequence of which is shown as SEQ ID No. 17, BG9-R, the sequence of which is shown as SEQ No. 18; BG10-F, the sequence of which is shown as SEQ ID No. 19, BG10-R, the sequence of which is shown as SEQ No. 20; The annealing temperature of each pair of primers is 56℃.

2. The primer of the microsatellite marker for identifying the genetic relationship of Procydiurn sinensis according to claim 1, characterized in that, BG1 is used in cooperation with BG2, BG3 is used in cooperation with BG4, BG5 is used in cooperation with BG6, BG7 is used in cooperation with BG8, and BG9 is used in cooperation with BG10.

3. A kit characterized in that, The primer for identifying the genetic relationship of Procyprinus palatus according to claim 1 or 2.

4. The use of a primer of a microsatellite marker for identifying the genetic relationship of Procyprinus. The primer for identifying the genetic relationship of Procyprinus palatus according to claim 1 or 2 is applied to identify the genetic relationship of Procyprinus palatus. ​ 5. A method for identifying the genetic relationship of Procyprinus pallopogon by microsatellite marker technology, characterized in that, It comprises: S1, extracting the genomic DNA of Procyprinus palatus in different groups respectively; S2, taking the genomic DNA of Procyprinus palatus extracted in S1 as a DNA template, and performing PCR amplification by using the primers provided in claim 1 or 2 which are divided into five groups to obtain an amplification product; S3, performing electrophoresis and silver staining on the amplification product by using polyacrylamide gel to obtain a silver staining result; S4, based on the silver staining result, drawing a UPGMA clustering analysis diagram by using genetic analysis software to obtain a clustering result, and identifying the genetic relationship of different groups of Procyprinus palatus according to the clustering result.

6. The method for identifying the genetic relationship of the Procypridium parent fish by using the microsatellite marker technology according to claim 5, characterized in that, The reaction system of the PCR amplification has a volume of 25 μL, and is respectively composed of 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 0.5 μL of the upper and lower primers of each pair of primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of a DNA template, and 13.5 μL of ultrapure water. The reaction procedure of the PCR amplification is as follows:

7. The method for identifying the genetic relationship of the Procypridium proninum according to claim 5, characterized in that, Pre-denaturation at 94℃ for 3 minutes; ​ Denature at 94℃ for 30 seconds, anneal at 56℃ for 30 seconds, and extend at 72℃ for 45 seconds, for 35 cycles. Extend at 72℃ for 10 minutes, and store at 4℃.

8. The method for identifying the genetic relationship of the Procypridium parent fish by using the microsatellite marker technology according to claim 5, characterized in that, The amplification products were electrophoresed on 12% polyacrylamide gel and silver-stained.

9. The method for identifying the genetic relationship of the Procypridium parent fish by using the microsatellite marker technology according to claim 5, characterized in that, The genetic analysis software includes MEGA software.

Images