Recombinant escherichia coli for synthesizing fusion protein containing ademetionine synthetase as well as construction method and application of recombinant escherichia coli
By constructing a fusion protein of SUMO lysing tag and Saccharomyces cerevisiae adenosine methionine synthase in Escherichia coli, the problems of low product purity, high cost and environmental pollution in the SAM synthesis method have been solved, and efficient and environmentally friendly industrial production has been achieved.
Patent Information
- Application Number
- CN202511390705.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2026-01-09
AI Technical Summary
Existing SAM synthesis methods suffer from problems such as low product purity, severe environmental pollution, high production costs, and poor enzyme stability, making it difficult to meet industrial needs.
A fusion protein containing S-adenosylmethionine synthase was constructed. By overexpressing the SUMO solubilization tag and the S-adenosylmethionine synthase gene of Saccharomyces cerevisiae in Escherichia coli, the enzyme's folding and solubility were optimized, the process flow was simplified, and the catalytic efficiency was improved.
It significantly improves the yield and substrate conversion of S-adenosylmethionine, simplifies the production process, reduces costs, and is environmentally friendly.
Smart Images
Figure CN121293369A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme engineering technology, specifically to a recombinant Escherichia coli that synthesizes a fusion protein containing S-adenosylmethionine synthase, its construction method, and its application. Background Technology
[0002] S-Adenosyl-L-methionine (SAM or SAMe) is a widely distributed active methyl donor in organisms, participating in more than 40 methylation reactions and playing a crucial role in physiological processes such as liver detoxification, neurotransmitter synthesis, phospholipid metabolism, and DNA / RNA methylation modification. Due to its significant biological activity, SAM has been developed as a pharmaceutical raw material, such as in drugs for treating liver damage and as a treatment for depression. As a functional health supplement, SAM can be used to improve cognitive function and alleviate osteoarthritis. Furthermore, SAM can be used as a feed additive, such as promoting animal growth and enhancing immunity. Currently, the global annual demand for SAM continues to grow, especially in the pharmaceutical and health supplement sectors, where its clinical applications and market size are expanding year by year. At present, the industrial production of SAM mainly relies on chemical synthesis, microbial fermentation, and enzymatic conversion, with enzymatic conversion being the primary method.
[0003] Chemical synthesis: Early industrial production largely employed chemical synthesis, using L-methionine and ATP as raw materials to generate SAM via adenosylation under alkaline conditions. However, this method has significant drawbacks: First, the reaction conditions are harsh, requiring high temperatures and strong alkalis, easily leading to the decomposition or isomerization of SAM into a mixture of R- and S-forms, resulting in low optical purity of the product, typically only 70%–80%, which is insufficient for pharmaceutical-grade requirements. Second, the reaction byproducts are complex, such as pyrophosphate and inorganic phosphates, which are difficult to separate and purify, requiring multiple chromatographic or crystallization steps, resulting in high costs. Third, ATP consumption is high and cannot be recovered, generating large amounts of phosphorus-containing wastewater, causing severe environmental pollution. Therefore, chemical synthesis has gradually been phased out of the market and is only used in a few low-end markets.
[0004] Microbial fermentation: With the development of biotechnology, the fermentation production of SAM using microorganisms, such as Saccharomyces cerevisiae and Escherichia coli, has become a research hotspot. Currently, microbial fermentation mainly achieves this through overexpression of SAM synthase or enhancement of the SAM synthesis pathway. However, this method still faces the following bottlenecks: First, SAM is an intracellular metabolite that needs to be released through cell disruption (such as ultrasound or enzymatic hydrolysis), resulting in low extraction yields, and the disruption process easily leads to enzyme inactivation and product degradation; Second, methionine is a direct precursor to SAM synthesis, but it is expensive, and excessive addition can easily lead to cytotoxicity, inhibiting cell growth and limiting further increases in fermentation yield; Third, insufficient dissolved oxygen during high-density fermentation, coupled with the fact that SAM synthesis requires a large amount of ATP and relies on aerobic metabolism, leads to premature cell death, prolonged fermentation cycles, and low production efficiency.
[0005] Enzymatic Conversion: This method uses SAM synthase as the core catalyst to convert L-methionine and ATP into SAM through an in vitro reaction. Theoretically, this method offers advantages such as high product optical purity (up to 95% or more) and mild reaction conditions. However, its industrial application is still limited by the following issues: First, SAM synthase has poor stability, with a half-life typically less than 24 hours, requiring frequent replacement of enzyme preparations and enhanced enzyme immobilization, thus increasing production costs. Second, ATP regeneration efficiency is low; for traditional processes relying on adenosine kinase or creatine phosphokinase to regenerate ATP, the energy conversion rate is even less than 50%, resulting in huge ATP consumption and soaring costs.
[0006] In summary, chemical synthesis methods are being phased out due to low purity and heavy pollution; microbial fermentation methods are limited by intracellular expression, precursor dependence, and long metabolic pathways, resulting in insufficient yield and efficiency; and enzymatic conversion methods need to address issues such as poor enzyme stability and high ATP costs. However, overall, enzymatic conversion methods still have significant advantages. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to provide a fusion protein containing S-adenosylmethionine synthase, which addresses the shortcomings of the prior art.
[0008] Another technical problem to be solved by the present invention is to provide recombinant Escherichia coli that synthesizes the above-mentioned fusion protein containing S-adenosylmethionine synthase.
[0009] Another technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned recombinant Escherichia coli.
[0010] The final technical problem to be solved by this invention is to provide the above-mentioned fusion protein containing S-adenosylmethionine synthase and the application of recombinant Escherichia coli in catalyzing the synthesis of S-adenosylmethionine from ATP and L-methionine.
[0011] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0012] A fusion protein containing S-adenosylmethionine synthase, the fusion protein comprising a SUMO lysing tag and S-adenosylmethionine synthase; the amino acid sequence of the fusion protein is shown in SEQ ID NO:1.
[0013] A recombinant *E. coli* strain for synthesizing the fusion protein of claim 1, wherein the gene encoding the SUMO lysis tag and the S-adenosylmethionine synthase gene SAM2 are overexpressed in the originating strain *E. coli*; wherein the gene encoding the SUMO lysis tag is derived from *Saccharomyces cerevisiae*; and the S-adenosylmethionine synthase gene SAM2 is derived from *Saccharomyces cerevisiae*.
[0014] The nucleotide sequence of the gene encoding the SUMO lysis tag is shown in SEQ ID NO:2; the nucleotide sequence of the SAM2 gene of adenosylmethionine synthase is shown in SEQ ID NO:3.
[0015] The Escherichia coli mentioned is Escherichia coli BL21(DE3).
[0016] The above-described method for constructing recombinant Escherichia coli involves inserting the encoding gene of the SUMO lysis tag and the SAM2 gene of adenosine methionine synthase into an expression vector to obtain a recombinant expression vector, and then introducing the recombinant expression vector into the Escherichia coli to obtain the recombinant expression vector.
[0017] The SUMO solubilization tag gene is inserted upstream of the SAM2 adenosylmethionine synthase gene, with only the EcoRI restriction site (GAATTC) between them. Inserting the SUMO solubilization tag sequence before the SAM2 adenosylmethionine synthase gene promotes proper folding of the adenosylmethionine synthase and improves its solubility.
[0018] The expression vector is an expression plasmid based on the T7 promoter.
[0019] Preferably, the expression vector is plasmid pET28a.
[0020] The application of the aforementioned fusion protein in catalyzing the synthesis of S-adenosylmethionine from ATP and L-methionine is also within the scope of protection of this invention.
[0021] The application of the aforementioned recombinant Escherichia coli in catalyzing the synthesis of adenosylmethionine from ATP or its disodium salt and L-methionine is also within the scope of protection of this invention.
[0022] Preferably, the recombinant Escherichia coli is induced to express using IPTG (isopropyl β-D-thiogalactoside), the cells are collected and broken, and then added to an enzymatic reaction system containing ATP or its disodium salt and L-methionine to carry out a catalytic reaction to obtain S-adenosylmethionine.
[0023] More preferably, the recombinant Escherichia coli is cultured to a cell OD value of [missing value]. 600 When the concentration of IPTG is 0.6–0.8, IPTG is added to the culture medium until the initial concentration of IPTG in the culture medium is 0.25–0.5 mM. Expression is induced for 16–18 h at 25–28 °C and 200–220 rpm. The cells are collected, resuspended in pure water until the cell content is 20–30 g / L, and broken to obtain crude enzyme solution. The crude enzyme solution is mixed evenly with an enzymatic reaction system containing ATP and L-methionine at a volume ratio of 1:1–2. The reaction is carried out at pH 6.5–7.5, temperature 35–37 °C, and 200–220 rpm for 4–6 h to complete the enzymatic reaction and synthesize S-adenosylmethionine.
[0024] The culture medium is LB liquid medium containing 25 mg / L kanamycin.
[0025] The enzymatic reaction system containing ATP or its disodium salt and L-methionine comprises the following components: 15-20 mM adenosine triphosphate or disodium adenosine triphosphate, 15-20 mM L-methionine, 30-40 mM MgCl2, 75-100 mM KCl, 75-100 mM sodium dihydrogen phosphate, 75-100 mM disodium hydrogen phosphate, 30-40 mM sodium p-toluenesulfonate, and water as the solvent.
[0026] Beneficial effects:
[0027] Compared with the prior art, the advantages of the present invention are:
[0028] (1) The recombinant Escherichia coli constructed in this invention heterologously expresses the S-adenosylmethionine synthase gene and inserts a SUMO soluble tag gene before the gene to promote the correct folding of S-adenosylmethionine synthase, improve its solubility, and significantly improve the substrate conversion rate and product yield when it catalyzes the synthesis of S-adenosylmethionine from the substrate ATP or its disodium salt and L-methionine. The molar conversion rate of substrate ATP reaches more than 70%, which can meet the requirements of large-scale industrial production.
[0029] (2) The recombinant Escherichia coli of the present invention can be directly applied to catalytic reactions after induction and expression and disruption, which reduces the steps of enzyme purification and separation, greatly simplifies the process and saves costs.
[0030] (3) The enzyme-catalyzed reaction process is relatively mild and harmless to the environment, equipment and operators. Attached Figure Description
[0031] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0032] Figure 1 Figure 1 shows the HPLC chromatograms for detecting S-adenosylmethionine content; Figure 2a is the HPLC chromatogram for detecting S-adenosylmethionine standard, and Figure 2b is the HPLC chromatogram for detecting S-adenosylmethionine-containing enzyme-catalyzed reaction solution in Example 2.
[0033] Figure 2 This is a colony photograph of the recombinant strain BL-SUMO-SAM2 of this invention.
[0034] Figure 3 This is a comparison chart showing the yield of S-adenosylmethionine synthesized by recombinant strains BL-SUMO-metk and BL-SUMO-SAM2 in Example 2.
[0035] Figure 4 This is a photograph of the crude enzyme solution obtained after induced expression of recombinant strains BL-SAM2 and BL-SUMO-SAM2 in Example 3.
[0036] Figure 5 This is a comparison chart showing the yield of S-adenosylmethionine synthesized by recombinant strains BL-SAM2 and BL-SUMO-SAM2 in Example 3. Detailed Implementation
[0037] The present invention will be further described below with reference to the following embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the present invention.
[0038] All technologies not mentioned in the embodiments are conventional technologies in the field. The Escherichia coli Trans1-T1, plasmid pET28a, pE-SUMO and other materials used in the following embodiments are commercial products that can be purchased directly.
[0039] The concentrations of ATP and S-adenosylmethionine mentioned in the examples refer to their final concentrations in the catalytic system, and the detection method is high-performance liquid chromatography (HPLC). The HPLC detection conditions for S-adenosylmethionine and ATP are as follows: Agilent TC-C18 (5 μm, 4.6 mm × 250 mm) column; mobile phase A is an aqueous solution containing 6.3 g / L ammonium formate and 1 g / L sodium octanesulfonate (pH = 3.0); mobile phase B is methanol; the volume ratio of mobile phases A to B is 95:5; and the flow rate is 0.8 mL / min. -1 The detector was a UV detector with a detection wavelength of 260 nm. The peak time for ATP was 4.1 min, and the peak time for S-adenosylmethionine was 23.6 min. Figure 1The HPLC chromatogram for detecting S-adenosylmethionine content.
[0040] Example 1: Construction of recombinant Escherichia coli BL-SUMO-SAM2
[0041] (1) Using the S-adenosylmethionine synthase gene from Saccharomyces cerevisiae S288C as a template, the SAM2 gene fragment was obtained by PCR amplification using SAM2-F / SAM2-R primers. The nucleotide sequence of the SAM2 gene is shown in SEQ ID NO:3. Primer SAM2-F contains the EcoR I restriction site, and primer SAM2-R contains the Hind III restriction site. The PCR amplification program was: 95℃ for 2 min, 95℃ for 20 s, 55℃ for 20 s, 72℃ for 10 s, for a total of 30 cycles; 72℃ for 5 min. The obtained sequence was recovered by 1% agarose gel electrophoresis.
[0042] (2) The plasmid pET28a was digested with EcoRI and HindIII (purchased from Takara). The digestion reaction system was: 1 μL of 10× buffer, 1 μL of EcoRI, 1 μL of HindIII, and 7 μL of the vector plasmid. The digestion system was reacted at 37℃ for 1 hour. The recovered vector fragment and the SAM2 gene fragment obtained in step (1) had homologous arms. Homologous recombination was performed using a one-step cloning kit (purchased from Novizan). The reaction system was: 2 μL of 5×CE II Buffer from Takara, 1 μL of Exnase II, 2 μL of the vector fragment, and 5 μL of the SAM2 gene fragment. The reaction system was reacted at 37℃ for 45 min. The ligation product was transformed into E. coli Trans1-T1, and positive strains were screened by PCR and DNA sequencing was performed to verify that the recombinant plasmid was correctly constructed, and the recombinant plasmid pET28a-SAM2 was obtained.
[0043] (3) Using plasmid pE-SUMO (purchased from Shanghai Yubo Biotechnology Co., Ltd., catalog number YB-0077) as a template, PCR amplification was performed using SUMO-F / SUMO-R primers to obtain the gene fragment encoding the lysing tag SUMO. The nucleotide sequence of the SUMO gene is shown in SEQ ID NO:2. SUMO-F contains the restriction enzyme site BamHI, and SAM2-R contains the restriction enzyme site EcoRI. The PCR amplification program was: 95℃ for 2 min, 95℃ for 20 s, 55℃ for 10 s, 72℃ for 10 s, for a total of 30 cycles; 72℃ for 5 min. The obtained sequences were recovered by 1% agarose gel electrophoresis.
[0044] (4) The recombinant plasmid pET28a-SAM2 was digested with BamHI and EcoRI (purchased from Takara). The digestion reaction system consisted of: 1 μL of 10× buffer, 1 μL of EcoRI, 1 μL of BamHI, and 7 μL of recombinant plasmid pET28a-SAM2. The digestion system was incubated at 37°C for 1 hour. The recombinant expression vector fragment recovered from the digestion had homologous arms with the gene fragment encoding the soluble tag SUMO obtained in step (3). Homologous recombination was performed using a one-step cloning kit (purchased from Novizan). The reaction system consisted of: 2 μL of 5×CE II Buffer from Takara, 1 μL of Exnase II, 2 μL of the recombinant expression vector fragment, and 5 μL of the gene fragment encoding the soluble tag SUMO. The reaction system was incubated at 37°C for 45 min. The ligation product was transformed into E. coli Trans1-T1, and positive strains were screened by PCR and their DNA was sequenced for verification. The recombinant plasmid was correctly constructed, and the recombinant plasmid pET28a-SUMO-SAM2 was obtained.
[0045] (5) Using a plasmid mini-prep kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.), recombinant plasmids pET28a-SAM2 and pET28a-SUMO-SAM2 were extracted from the cloned strains. The extracted recombinant plasmids were introduced into commercial Escherichia coli BL21(DE3) competent cells to obtain recombinant strains BL-SAM2 and BL-SUMO-SAM2. Figure 2 The image shows a colony photograph of the recombinant strain BL-SUMO-SAM2 obtained in this embodiment.
[0046] Following the method used to construct the recombinant strain pET28a-SUMO-SAM2, the recombinant strain BL-SUMO-metk was constructed: using the genome of Escherichia coli MG1655 as a template, PCR amplification was performed using metk-F / metk-R primers to obtain the S-adenosylmethionine synthase gene metk inherent in E. coli. This gene was then inserted into plasmid pET28a using a one-step cloning kit to construct the recombinant plasmid pET28a-metk. The gene encoding the lysing tag SUMO was then inserted into the recombinant plasmid pET28a-metk using another one-step cloning kit to obtain the recombinant plasmid pET28a-SUMO-metk. This plasmid was then introduced into E. coli BL21(DE)3 competent cells to obtain the recombinant strain BL-SUMO-metk.
[0047] The nucleotide sequences of the primers used in this embodiment are shown in Table 1.
[0048] Table 1. Nucleotide sequences of primers
[0049] Primers <![CDATA[Nucleotide sequence (5 ′ ~3 ′ ) <!-- 4 -->]]> SAM2-F GGGTCGCGGATCCGAATTCATGTCCAAGAGCAAAACTTTCTT SAM2-R CGAGTGCGGCCGCAAGCTTTTAAAATTCCAATTTCT SUMO-F GCAAATGGGTCGCGGATCCGCTAGCATGTCGGACTCAGAAGT SUMO-R TGCTCTTGGACATGAATTCGGATCCACCAaATCTGTTCTCTGTGAG metk-F GGGTCGCGGATCCGAATTCATGGCAAAACACCTTTTTACGTC metk-R CGATGCGGCCGCAAGCTTTTACTTCAGACCGGCAG
[0050] Example 2: Synthesis of S-adenosylmethionine catalyzed by recombinant strain BL-SUMO-SAM2
[0051] Recombinant strains BL-SUMO-metk and BL-SUMO-SAM2 were inoculated into LB liquid medium containing 25 mg / L kanamycin and cultured at 37°C and 200 rpm until the bacterial cell OD reached its maximum. 600 To achieve a concentration of 0.6–0.8, IPTG was added to LB liquid medium until the initial concentration of IPTG in the LB liquid medium was 0.5 mM, inducing the expression of recombinant strains BL-SUMO-metk and BL-SUMO-SAM2. After culturing at 28℃ and 200 rpm for 18 hours, the medium was centrifuged at 4000 rpm for 15 min, and the bacterial sludge was collected. An appropriate amount of bacterial sludge was weighed and resuspended in pure water to prepare a bacterial suspension with a cell concentration of 20 g / L. Crude enzyme solution was obtained after ultrasonic disruption. This crude enzyme solution was added to an enzyme-catalyzed reaction system containing 20 mM adenosine triphosphate disodium, 20 mM L-methionine, 40 mM MgCl2, 100 mM KCl, 100 mM sodium dihydrogen phosphate, 100 mM disodium hydrogen phosphate, and 40 mM sodium p-toluenesulfonate. The volume ratio of crude enzyme solution to the enzyme-catalyzed reaction system was 1:1. After thorough stirring, the reaction was carried out for 6 hours at pH 6.5–7.5, temperature 37℃, and rotation speed 200 rpm. After the reaction, the concentration of adenosine methionine in the catalytic solution was measured, and the molar conversion rate of substrate ATP to adenosine methionine was calculated.
[0052] Test results as follows Figure 3 As shown, the crude enzyme solution produced by the recombinant strain BL-SUMO-SAM2 can effectively catalyze the synthesis of S-adenosylmethionine. Furthermore, compared to overexpression of the S-adenosylmethionine synthase gene metk from *E. coli*, heterologous expression of the S-adenosylmethionine synthase gene SAM2 from *Saccharomyces cerevisiae* S288C resulted in significantly higher catalytic yield and molar conversion rate. Under the catalysis of the recombinant strain BL-SUMO-SAM2, the yield of S-adenosylmethionine reached 1.5 g / L, and the conversion rate of adenosine triphosphate disodium salt exceeded 70%.
[0053] Example 3: Verification of the effect of SUMO solubilization tag on improving S-adenosylmethionine synthesis efficiency
[0054] Recombinant strains BL-SAM2 and BL-SUMO-SAM2 were inoculated into LB broth containing 25 mg / L kanamycin and cultured at 37°C and 200 rpm until the bacterial OD600 reached 0.6–0.8. IPTG was then added to the LB broth until the initial concentration of IPTG in the LB broth was 0.5 mM to induce the expression of recombinant strains BL-SAM2 and BL-SUMO-SAM2. After further culturing at 28°C and 200 rpm for 18 hours, the culture medium was... The bacterial sludge was collected by centrifugation at 4000 rpm for 15 min. An appropriate amount of the sludge was weighed and resuspended in pure water to obtain a bacterial solution with a cell concentration of 20 g / L. After ultrasonic disruption, a crude enzyme solution was obtained. This crude enzyme solution was added to an enzyme-catalyzed reaction system containing 20 mM adenosine triphosphate disodium salt, 20 mM L-methionine, 40 mM MgCl2, 100 mM KCl, 100 mM sodium dihydrogen phosphate, 100 mM disodium hydrogen phosphate, and 40 mM sodium p-toluenesulfonate. The volume ratio of the crude enzyme solution to the enzyme-catalyzed reaction system was 1:1. After thorough stirring, the reaction was carried out under the conditions of pH 6.5–7.5, temperature 37℃, and rotation speed 200 rpm for 6 h. Samples were taken at 1 h, 2 h, and 6 h during the catalytic reaction to determine the concentration of the product S-adenosine methionine. By comparing the yield of S-adenosine methionine, the effect of the SUMO solubilization tag on the synthesis efficiency of S-adenosine methionine was verified.
[0055] like Figure 4 The images show the crude enzyme solutions obtained from recombinant strains BL-SAM2 and BL-SUMO-SAM2. It can be seen that the crude enzyme solution obtained after lysis of the bacterial culture of recombinant strain BL-SUMO-SAM2 is clearer and more transparent, and the solubility of S-adenosylmethionine synthase is significantly better. The accumulation results of the product S-adenosylmethionine are shown below. Figure 5 As shown in the figure, the accumulation of S-adenosylmethionine in the recombinant strain BL-SUMO-SAM2 at different time points was higher than that in the recombinant strain BL-SAM2. This indicates that inserting the SUMO solubilization tag sequence before the SAM2 gene of S-adenosylmethionine synthase can effectively promote the correct folding of the target protein, improve its solubility, and thus improve the synthesis efficiency of its enzymatic reaction.
[0056] This invention provides a recombinant *Escherichia coli* strain containing a S-adenosylmethionine synthase for synthesis, its construction method, and its application. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.
Claims
1. A fusion protein containing S-adenosylmethionine synthase, characterized in that, The fusion protein consists of a SUMO lysing tag and a S-adenosylmethionine synthase; the amino acid sequence of the fusion protein is shown in SEQ ID NO:
1.
2. A recombinant *E. coli* strain for synthesizing the fusion protein of claim 1, characterized in that, The SUMO lysis tag encoding gene and the S-adenosylmethionine synthase gene SAM2 were overexpressed in the starting strain *Escherichia coli*; the SUMO lysis tag encoding gene was derived from *Saccharomyces cerevisiae*; and the S-adenosylmethionine synthase gene SAM2 was derived from *Saccharomyces cerevisiae*.
3. The recombinant Escherichia coli according to claim 2, characterized in that, The nucleotide sequence of the gene encoding the SUMO lysing tag is shown in SEQ ID NO:2; the nucleotide sequence of the S-adenosylmethionine synthase gene SAM2 is shown in SEQ ID NO:
3.
4. The recombinant Escherichia coli according to claim 2, characterized in that, The Escherichia coli mentioned is Escherichia coli BL21(DE3).
5. The method for constructing recombinant Escherichia coli according to any one of claims 2 to 4, characterized in that, The gene encoding the SUMO lysis tag and the SAM2 gene of adenosylmethionine synthase were inserted into the expression vector to obtain a recombinant expression vector. The recombinant expression vector was then introduced into the Escherichia coli to obtain the final product. The SUMO lysis tag encoding gene is inserted upstream of the SAM2 adenosylmethionine synthase gene.
6. The construction method according to claim 5, characterized in that, The expression vector is an expression plasmid based on the T7 promoter.
7. The construction method according to claim 6, characterized in that, The expression vector is plasmid pET28a.
8. The use of the fusion protein according to claim 1 in catalyzing the synthesis of S-adenosylmethionine from ATP and L-methionine.
9. The use of the recombinant Escherichia coli according to any one of claims 2 to 4 in catalyzing the synthesis of adenosylmethionine from ATP and L-methionine.
10. The application according to claim 9, characterized in that, The recombinant E. coli was induced to express using IPTG, the cells were collected and lysed, and then added to an enzymatic reaction system containing ATP and L-methionine to catalyze the reaction and obtain S-adenosylmethionine.