Curcuma wenyujin sesquiterpene synthase CwTPS8 as well as coding gene and application thereof
By cloning the sesquiterpene synthase gene CwTPS8 from Curcuma wenyujin and heterologously synthesizing sesquiterpenoids in a microbial cell factory, the problem of extracting sesquiterpenoids from Curcuma wenyujin was solved, and the efficient production of compounds with broad pharmacological activities was achieved.
Patent Information
- Application Number
- CN202511346278.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-19
- Publication Date
- 2026-01-09
Smart Images

Figure CN121294412A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a sesquiterpene synthase CwTPS8 in Curcuma longa and its encoding gene and its applications. Background Technology
[0002] Wen Yujin ( Curcumawenyujin YH Chen et C. Ling) is a perennial herb belonging to the genus Curcuma in the family Zingiberaceae. It is mainly produced in Ruian, Zhejiang Province, and is one of the famous "Eight Treasures of Zhejiang". This medicinal herb has the effects of regulating qi and relieving depression, promoting blood circulation and relieving pain, and promoting bile secretion and reducing jaundice. Its volatile oil is mainly composed of sesquiterpenes, among which caryophyllene and humulene are representative core skeletons and derivatives, exhibiting significant pharmacological activities such as anti-inflammatory, anti-tumor, and neuromodulatory effects, showing broad application prospects in the fields of medicine and functional foods.
[0003] However, obtaining these sesquiterpenoid compounds through traditional plant extraction methods faces numerous limitations, including long plant growth cycles, low content of active ingredients, difficulties in extraction and separation, and complex chemical isomers. These challenges hinder stable, efficient, and large-scale production, severely restricting their development and utilization. Synthetic biology offers a breakthrough alternative. The core of this strategy lies in discovering and identifying key functional genes—sesquiterpene synthases, especially highly efficient enzyme genes that can specifically catalyze the formation of caryophyllene or humulene skeletons. By introducing these core genetic elements into engineered microorganisms (such as yeast), reconstructing biosynthetic pathways, and establishing cellular factories, efficient, green, and sustainable production of target compounds can be achieved. Therefore, cloning and characterizing novel, highly efficient sesquiterpene synthase genes from medicinal plants such as Curcuma longa, especially synthases targeting the core skeletons of caryophyllene and humulene, which have broad pharmacological activities and market application prospects, is of great significance for promoting the development of related industries.
[0004] In the prior art, studies have reported sesquiterpene synthases and their encoding genes from various sources, and their applications in the biosynthesis of terpenoid bioactive components. For example, Chinese patent document CN109097350A discloses a *Phoebe zhennan* sesquiterpene synthase SgSTPS2, its encoding gene, and its applications. This *Phoebe zhennan* sesquiterpene synthase SgSTPS2 can prepare linalool, geraniol methyl ether, and geraniol using geraniyl pyrophosphate as a substrate. Chinese patent document CN117568323A discloses a *Aquilaria sinensis* sesquiterpene synthase, its encoding gene, and its applications. Using *Aquilaria sinensis* sesquiterpene synthase as a catalytic enzyme and farnesyl pyrophosphate as a substrate, an enzymatic biosynthetic reaction can be carried out to biosynthesize sesquiterpene compounds including juniperene, geraniol, pentosanene, or mollene. However, despite the abundance of sesquiterpene active components in Curcuma longa, the sesquiterpene synthase genes that generate these compounds have not been sufficiently explored, and enzyme genes that can catalyze the generation of 1,11-cyclized products (such as caryophyllene and humulene) have not yet been reported. Summary of the Invention
[0005] The purpose of this invention is to provide a sesquiterpene synthase CwTPS8 and its encoding gene from Curcuma longa by studying the key enzyme genes involved in the synthesis pathway of sesquiterpenoids in Curcuma longa, and then to produce Curcuma longa sesquiterpenoids through a microbial cell factory using synthetic biology strategies.
[0006] The specific technical solution adopted is as follows: A sesquiterpene synthase CwTPS8 from Curcuma longa has the amino acid sequence shown in SEQ ID NO.1.
[0007] A sesquiterpene synthase gene from Curcuma longa CwTPS8 Its nucleotide sequence is shown in SEQ ID NO.2, encoding Curcuma longa sesquiterpene synthase CwTPS8.
[0008] This invention cloned a sesquiterpene synthase gene from Curcuma longa. CwTPS8 The protein it encodes can be used to prepare β-caryophyllene, α-humulene and other sesquiterpenoids of turmeric using farnesyl pyrophosphate (FPP) as a substrate.
[0009] In this invention, based on the disclosed gene sequence and the amino acid sequence of the encoded product, one or more amino acids can be substituted, deleted, or added without affecting its activity to obtain a mutant sequence of the encoded product. Such mutant sequence is also within the protection scope of this invention.
[0010] The present invention also provides a recombinant vector containing the Curcuma longa sesquiterpene synthase gene. CwTPS8 .
[0011] Furthermore, the recombinant vector is a recombinant plasmid, comprising the original vector and the *Curcuma longa* sesquiterpene synthase gene inserted into the multiple cloning site of the vector. CwTPS8 Original vectors include, but are not limited to, pMAL-His vector and pESC-Trp vector, which can guide exogenous genes. CwTPS8 It is expressed in host cells and then used for the heterologous synthesis of the turmeric sesquiterpene synthase CwTPS8 and the catalytic synthesis of sesquiterpenoid compounds.
[0012] The present invention also provides a genetically engineered bacterium comprising the recombinant vector described above.
[0013] Furthermore, suitable microbial host cells can be selected according to the intended use. Host cells can be, but are not limited to, prokaryotic Escherichia coli, eukaryotic yeast, etc. The host cells must possess the farnesyl pyrophosphate synthesis pathway and be able to heterologously express the turmeric sesquiterpene synthase gene. CwTPS8 .
[0014] This invention also provides a method for preparing the aforementioned Curcuma longa sesquiterpene synthase CwTPS8, comprising the following steps: (1) Obtain the gene with the nucleotide sequence shown in SEQ ID NO.2, and construct an expression vector using the gene; (2) The expression vector was transferred into the host cell to obtain a genetically engineered bacterium that can produce Curcuma longa sesquiterpene synthase CwTPS8; (3) Culture genetically engineered bacteria and isolate and purify the turmeric sesquiterpene synthase CwTPS8.
[0015] This invention also provides the application of the aforementioned Curcuma longa sesquiterpene synthase CwTPS8 in the catalytic synthesis of sesquiterpenoid compounds by farnesyl pyrophosphate (FPP).
[0016] Furthermore, the sesquiterpenoid compound is at least one of β-caryophyllene, α-humulene, cypermethrin, caryophyllene alcohol, and Neointermedeol (CAS: 5945-72-2).
[0017] Furthermore, the sesquiterpenoid compounds are β-caryophyllene and α-humulene.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention cloned a sesquiterpene synthase gene from Curcuma longa. CwTPS8The technology was used to construct recombinant vectors and genetically engineered bacteria to heterologously synthesize Curcuma longa sesquiterpene synthase CwTPS8. CwTPS8 can catalyze the synthesis of sesquiterpenoid compounds from farnesyl pyrophosphate (FPP) in vitro. This technology can be used for subsequent production of sesquiterpenoid compounds through microbial cell factories. Furthermore, the synthesized sesquiterpenoid compounds include β-caryophyllene and α-humulene. β-caryophyllene possesses various physiological activities, including anticancer, anti-inflammatory, antioxidant, and neuroprotective activities. It not only has anticancer activity itself but can also significantly enhance the anticancer activity of other chemotherapeutic drugs by increasing cell membrane permeability. α-humulene also has anti-inflammatory and anticancer activities and has been widely studied due to its broad antibacterial, antidiabetic, anti-allergic, and anti-inflammatory properties. In addition to the two main sesquiterpenoid products mentioned above, small amounts of cedreidyldiol and two potential compounds, caryophyllene alcohol and Neointermedeol, were also produced in Saccharomyces cerevisiae. This invention lays the foundation for the heterologous synthesis and further development and utilization of sesquiterpenoids such as β-caryophyllene and α-humulene. Attached Figure Description
[0019] Figure 1 The SDS electrophoresis results of CwTPS8 in Example 4 are shown.
[0020] Figure 2 The image shows the GC-MS analysis of the CwTPS8 in vitro enzymatic reaction products in Example 4. β-Caryophyllene is a standard, and α-Humulne is a product of an enzyme with a special function.
[0021] Figure 3 The following are the enzymatic steady-state kinetic curves of CwTPS8 in Example 4: (A) is the kinetic curve of α-humulene; (B) is the kinetic curve of β-caryophyllene.
[0022] Figure 4 In Example 6 CwTPS8 GC-MS analysis of fermentation products in Saccharomyces cerevisiae.
[0023] Figure 5 To analyze Example 6 using the NIST database CwTPS8 Results of two other hypothesized products from in vivo fermentation of Saccharomyces cerevisiae. Detailed Implementation
[0024] To make the objectives, features, and advantages of this invention more apparent and understandable, a detailed description is provided below through specific embodiments. Many specific details are set forth in the following description to provide a thorough understanding of the invention. However, the invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Technical features in various embodiments of the invention can be combined appropriately without mutual conflict.
[0025] Unless otherwise specified, the operating methods in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Contents not described in detail in this specification are prior art known to those skilled in the art. Unless otherwise specified, the experimental materials used in the examples below can be purchased from conventional biochemical reagent companies.
[0026] Example 1: Gene Cloning (1) Obtaining the cDNA of Curcuma longa RNA was extracted from methyl jasmonate-induced turmeric samples (flowers, leaves, and stems) for 6 h using the CTAB method, and 1 μg of RNA was reverse transcribed into cDNA using a TaKaRa reverse transcription kit (RR092A) and stored at -20℃.
[0027] (2) CwTPS8 ORF amplification Using cDNA as a template, full-length cloning was performed using primers CwTPS8-F: CTGATGATGGCCCAGCTTGT (SEQ ID NO.3) and CwTPS8-R: GCATTGCCCTGATAAGACATACTCT (SEQ ID NO.4).
[0028] The PCR system consisted of: 25 μL Phanta Max Master DNA; 2 μL CwTPS8-F; 2 μL CwTPS8-R; 1.5 μL plasmid template; and ddH2O to a final volume of 50 μL.
[0029] The PCR conditions were as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 56°C annealing for 15 s, 72°C extension for 1 min 30 s, 35 cycles followed by 72°C extension for 5 min, and storage at 4°C.
[0030] (3) PCR product recovery and purification The PCR products obtained above were detected by agarose gel electrophoresis. A DNA band of about 1700 bp was excised and purified according to the instructions of the Nanjing Novizan gel extraction kit. The concentration of the recovered DNA was measured.
[0031] (4) CwTPS8 Cloning vector construction and transformation According to the instructions of the pEASY-Blunt-Zero cloning vector kit, take 1 μL of pEASY-Blunt-Zero vector and 4 μL of... CwTPS8 After purifying the DNA fragments and mixing them thoroughly, ligation was performed at 25 °C for 20 min. Following the instructions of the Trans1-T1 competent cell transformation kit, the ligation product was transformed into Trans1-T1 competent cells, and the cells were coated with a solution containing 100 mg L... -1 Amp was cultured in LB solid medium at 37 °C for 10–14 h.
[0032] Once single colonies have grown on the plate, perform bacterial PCR using TransFast TaqPCR SuperMix 2×TransFast. PCR system: 2 × TransFast TaqPCR SuperMix 5 μL; M13-F 0.4 μL; M13-R 0.4 μL; bacterial culture 1 μL; ddH2O to 10 μL.
[0033] M13-F (SEQ ID NO.5): GTAAAACGACGGCCAGT; M13-R (SEQ ID NO.6):CAGGAAACAGCTATGAC; PCR conditions: 94 °C pre-denaturation for 3 min, 94 °C denaturation for 5 s, 58 °C annealing for 15 s, 72 °C extension for 1 min, 35 cycles followed by 72 °C extension for 5 min, and storage at 4 °C.
[0034] The PCR products were detected by agarose gel electrophoresis. If the target band appeared, the corresponding bacterial culture was sent to a sequencing company for sequencing. If the sequencing results matched the expected sequence, the gene was successfully cloned. CwTPS8 The full-length strain was preserved, and the plasmid was extracted and named pEASY-CwTPS8 for later use.
[0035] (5) Experimental results Using methyl jasmonate-induced *Curcuma longa* cDNA as a template and transcriptome data as a reference, full-length cloning was successfully performed to obtain... CwTPS8 The complete open reading frame (ORF) of a gene. CwTPS8The gene is 1644 bp in length (SEQ ID NO.2), encoding 547 amino acids (SEQ ID NO.1), with a protein molecular weight of 64 kDa and an isoelectric point of 5.30. This enzyme contains the conserved motifs "DDxxD" and "(N / D)Dxx(S / T)xxxE" of class I terpene synthases.
[0036] Example 2 CwTPS8 Construction of prokaryotic expression vectors Will CwTPS8 ORF was constructed into the prokaryotic expression vector pMAL-His, and BamHI was selected as the restriction site.
[0037] (1) Vector digestion The vector digestion system was as follows: 10 × Fast Digest buffer 5 μL; BamHI 3 μL; pMAL-His 1000 ng; ddH2O to a final volume of 50 μL. The digestion conditions were: 37 °C, 2 h.
[0038] (2) CwTPS8 Amplification Using pEASY-CwTPS8 obtained in Example 1 as a template, primers containing a homologous sequence of 15-20 bp near the BamHI site of the pMAL-His vector were used to amplify the inserted fragment. pMAL-His-TPS8-F (SEQ ID NO. 7): GGAAGGATTTCAGAATTCGGAATGATGGCCCAGCTTGTTGATGG; pMAL-His-TPS8-R (SEQ ID NO. 8): GTGGTGGTGGTGGTGGTGGGAAATAGGAAAGGATTCAACCAATATG; The PCR system and conditions are the same as in Example 1 (2).
[0039] (3) Recovery and purification of linearized vector and target DNA fragment The digested vector and PCR product were run on 1.5% agarose gel electrophoresis. Bands of approximately 5600 bp and 1700 bp were excised, respectively. The target fragments were recovered using a recovery kit from Nanjing Novizan. The nucleic acid concentration was accurately measured and set aside for later use.
[0040] (4) Seamless cloning The purified carrier and CwTPS8Gene fragments were mixed at a molar ratio of 1:3 and homologous recombination was performed using the pEASY-UniSeamless Cloning and Assembly kit. The system consisted of: 2×Assembly Mix 5 μL; pMAL-His 100 ng; CwTPS8 1 μL of plasmid template; add ddH2O to a final volume of 10 μL, and react at 50 °C for 30 min.
[0041] After the reaction, the reaction solution was transformed into Trans1-T1 competent cells, plated on LB solid medium containing 100 mg / L Amp, and incubated statically for 10-14 hours. Once single colonies had grown, they were verified by colony PCR. Colonies showing the target band were sent to a sequencing company for sequencing. If the sequence ligation was correct, the glycerol-containing bacteria were preserved, and the recombinant plasmid pMAL-His-CwTPS8 was extracted.
[0042] Example 3 CwTPS8 Construction of eukaryotic expression vectors Will CwTPS8 ORF was constructed into the yeast eukaryotic expression vector pESC-Trp, and BamHI was selected as the restriction site.
[0043] (1) Vector digestion The enzyme digestion system and conditions are the same as in Example 2 (1).
[0044] (2) CwTPS8 Amplification Using pEASY-CwTPS8 obtained in Example 1 as a template, primers containing a homologous sequence of 15-20 bp near the BamHI site of the pESC-Trp vector were used to amplify the inserted fragment. pESC-Trp-TPS8-F (SEQ ID NO.9): CGTCAAGGAGAAAAAACCCCGCTGATGATGGCCCAGCTTGT; pESC-Trp-TPS8-R (SEQ ID NO. 10): TAGTGAGTCGTATTACGGATCGCATTGCCCTGATAAGACATACTCT; The PCR system and conditions are the same as in Example 1 (2).
[0045] (3) Recovery and purification of linearized vector and target DNA fragment The digested vector and PCR product were run on 1.5% agarose gel electrophoresis. Bands of approximately 6600 bp and 1700 bp were extracted, respectively. The target fragments were recovered using the Nanjing Novizan gel recovery kit, and the nucleic acid concentration was accurately measured for later use.
[0046] (4) Seamless cloning The reaction steps are the same as (4) in Example 2.
[0047] After the reaction, the reaction solution was transformed into Trans1-T1 competent cells, plated on LB solid medium containing 100 mg / L Amp, and incubated statically for 10-14 hours. Once single colonies emerged, they were verified by colony PCR. Colonies showing the target band were sent to a sequencing company for sequencing. If the sequence ligation was correct, the glycerol-containing bacteria were preserved, and the recombinant plasmid pESC-Trp-CwTPS8 was extracted.
[0048] Example 4 CwTPS8 In vitro functional identification (1) Induction of recombinant bacterial expression 5 μL of pMAL-His-CwTPS8 and pMAL-His were transformed into TransteeDE3 competent cells, respectively. Positive single clones were selected and transferred to LB medium containing ampicillin. The cells were then cultured in shake flasks at 37 ℃ and 200 rpm for 12 hours for activation. Subsequently, they were inoculated into 100 mL of the same medium and cultured in shake flasks at 37 ℃ and 200 rpm until OD (October Expected). 600 The concentration was 0.6-0.8. 0.4 mM IPTG was added, and the mixture was induced at 20 °C and 180 rpm for 20 min.
[0049] (2) Protein purification and product extraction After induction, the bacterial cells were harvested by centrifugation, resuspended in lysis buffer, and then sonicated. The sonication conditions were: 200 W power, 10 s sonication, 3 s pause, for a total of 5 min; after sonication, the cells were centrifuged at 9000 rpm for 45 min at 4 ℃, and the supernatant and bacterial cells were collected. The supernatant of the recombinant His-labeled protein was then mixed with Ni... 2+ Combined, the column was shaken at 4 ℃ for 2 h, while pre-equilibrating with three volumes of ordinary buffer. The protein supernatant was transferred to a nickel-triacetate nickel-NTA (Ni-NTA) column, and then washed with buffer 1 (Tris-HCl (pH 8.0) 20 mM; imidazole 30 mM; NaCl 250 mM). The target protein was eluted with buffer 2 (Tris-HCl (pH 8.0) 20 mM; imidazole 100 mM; NaCl 250 mM), and all were collected. Finally, the target protein was concentrated using an ultrafiltration tube, and the buffer was replaced with an enzyme buffer (HEPES 50 mM; MgCl2 10 mM; DTT 5 mM; glycerol 5% (v / v)). Using bovine serum albumin (BSA) as a standard, the protein concentration was determined using the Beyotime BCA protein assay kit. SDS-PAGE was performed on both the control and experimental groups to identify the target protein CwTPS8. The purified and concentrated protein (i.e., Curcuma longa sesquiterpene synthase CwTPS8) was reacted with the substrate farnesyl pyrophosphate (FPP) at 30 °C, 100 rpm, and covered with an equal volume of n-hexane for 3 hours. After the reaction, the n-hexane layer was collected, concentrated to 200 μL with nitrogen, and stored at 4 °C.
[0050] (3) Product identification Qualitative analysis of the samples was performed using an Agilent 7000 gas chromatography-mass spectrometry (GC-MS) system. The detection conditions were as follows: DB-5ms column (30 m × 0.25 mm × 0.25 μm), injection volume 1 μL, initial temperature 80 ℃, and a 10℃·min⁻¹ concentration. -1 Raise to 240 °C, hold for 2 min, then reduce to 20 °C / min. -1 The temperature was raised to 260 °C and held for 2 min; the electron energy was 70 eV, the injection port temperature was 275 °C, the ion source temperature was 280 °C, and the sample was scanned in the range of 30-350 m / z.
[0051] (4) Experimental results The target protein CwTPS8 has been successfully purified using the above purification method, and the results are as follows: Figure 1 As shown. Furthermore, the in vitro enzymatic reaction... CwTPS8 To verify the functionality, heterologous expression of E. coli was used. CwTPS8 The encoded protein was purified and reacted with the substrate FPP. The fermentation product was then analyzed by GC-MS, and the results are as follows: Figure 2 As shown, compared with the empty vector control strain, the CwTPS8 recombinant strain exhibited two distinct characteristic peaks at 6.9 min and 7.3 min, namely peak 1 and peak 2. Comparison with the mass spectra of β-caryophyllene standards and strains producing α-humulene revealed that the Curcuma longa sesquiterpene synthase CwTPS8 specifically catalyzes the production of the main products β-caryophyllene and α-humulene from FPP.
[0052] Example 5: Determination of CwTPS8 Enzyme Steady-State Kinetics (1) Measurement conditions: To determine the catalytic activity of the target protein CwTPS8 purified in Example 4, it was diluted to a concentration of 20 µg / mL using cryo-enzyme buffer (50 mM HEPES, 10 mM MgCl2, 5 mM DTT, 5% (v / v) glycerol, pH 7.5). Simultaneously, different concentrations of FPP (10 µM, 25 µM, 50 µM, 100 µM, 125 µM, and 150 µM) were prepared. The diluted protein and different concentrations of FPP were incubated at 30°C for 10 minutes, covered with an equal volume of n-hexane. Then, ethylenediaminetetraacetic acid (EDTA) was added to the reaction mixture to terminate the reaction, followed by thorough vortexing. Finally, the mixture was centrifuged at 10,000 g for 1 minute, and the n-hexane layer was collected. After three extractions with n-hexane, the extract was concentrated to 70 µL under a nitrogen stream for GC-MS detection. GraphPad Prism was used for computation. K m and V max Values. All data are from three independent experiments.
[0053] (2) Product determination Same as (3) in Example 4.
[0054] (3) Experimental results: Using the above-described assay conditions, the steady-state kinetic curve and parameters of the target protein CwTPS8 have been successfully determined, and the results are as follows: Figure 3 As shown in (A)-(B); parameters include: α-humulene: K m 28.17 µM; V max 1.038 µM / min; K cat / K m 0.002s -1 / µM; β-Caryophyllene: K m 27.99 µM; V max 13.29 µM / min; K cat / K m 0.0254 s -1 / µM.
[0055] Example 6 CwTPS8 In vivo functional identification (1) Preparation of yeast competent cells and transformation with eukaryotic expression vector Y94 *Saccharomyces cerevisiae*, enhanced with a terpenoid pathway, was selected as the host cell. Following the instructions of the Zymo Frozen-EZ YeastTransformation II Kit™, competent yeast cells were prepared. The recombinant plasmids pESC-Trp-CwTPS8 and pESC-Trp, successfully constructed in Example 3, were transformed into Y94 competent cells. The cells were then plated on SD-Trp solid medium and incubated statically at 30 °C for 2-3 days. Once single colonies emerged, colony PCR was performed using high-fidelity PCR polymerase for verification. Positive single colonies were activated using liquid medium, streaked onto SD-Trp solid medium, and preserved as glycerol culture.
[0056] (2) Fermentation of recombinant strains Single clones of the recombinant strain and single clones of the empty vector-transformed strain were respectively transferred to 5 mL of SD-Trp liquid medium and incubated at 30 °C and 200 rpm for 24 h until OD reached. 600 Approximately 5; The obtained bacterial solution was calculated according to the final concentration OD. 600 =0.05 was diluted in 100 mL of SD-Trp liquid medium with glucose as the carbon source. After culturing for 2 days, the carbon source was replaced with galactose, and fermented at 30 °C and 200 rpm for 3 days. Three biological replicates were made for each strain.
[0057] (3) Extraction of fermentation products Add an equal volume of n-hexane to the crushed sample, shake thoroughly to extract, remove the upper organic phase, repeat the extraction three times, and combine the organic phases; The extract obtained in the above steps was evaporated to dryness using a rotary evaporator, and then resuspended in 1 mL of chromatographic grade n-hexane. The resuspended solution was filtered through a 0.22 μm organic phase filter membrane, placed in a sealed liquid chromatography vial, and stored for later use.
[0058] (4) Product identification Same as (3) in Example 4.
[0059] (5) Experimental results A eukaryotic expression vector containing the CwTPS8 coding sequence was transformed into *Saccharomyces cerevisiae* FY94, a strain with enhanced terpene biosynthesis. Fermentation was induced with galactose, and the fermentation products were extracted and analyzed by GC-MS. The results are shown below. Figure 4 and Figure 5 As shown, compared with the empty vector control strain, the CwTPS8 recombinant strain produced five characteristic peaks. Comparison with the standard revealed that, in addition to producing β-caryophyllene and α-humulene, it also produced the byproduct cephalotaxine (peak 5). Furthermore, comparison with the NIST database revealed the potential presence of two other compounds: caryophyllene alcohol (peak 3) and Neointermedeol (peak 4).
[0060] The embodiments described above provide a detailed explanation of the technical solutions of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A sesquiterpene synthase CwTPS8 from Curcuma longa, characterized in that, The amino acid sequence is shown in SEQ ID NO.
1.
2. A sesquiterpene synthase gene from Curcuma longa CwTPS8 Its characteristics are, The nucleotide sequence is shown in SEQ ID NO.2, encoding the Curcuma longa sesquiterpene synthase CwTPS8 as described in claim 1.
3. A recombinant vector, characterized in that, Contains the Curcuma zedoaria sesquiterpene synthase gene as described in claim 2 CwTPS8 .
4. The recombinant vector according to claim 3, characterized in that, The recombinant vector is a recombinant plasmid, comprising the original vector and the turmeric sesquiterpene synthase gene inserted into the multiple cloning site of the vector. CwTPS8 The original vector is either pMAL-His or pESC-Trp.
5. A genetically engineered bacterium, characterized in that, It includes the recombinant vector as described in claim 3 or 4.
6. The genetically engineered bacterium according to claim 5, characterized in that, The host cell contains the farnesyl pyrophosphate synthesis pathway.
7. The method for preparing Curcuma longa sesquiterpene synthase CwTPS8 according to claim 1, characterized in that, Includes the following steps: (1) Obtain the gene with the nucleotide sequence shown in SEQ ID NO.2, and construct an expression vector using the gene; (2) The expression vector was transferred into the host cell to obtain a genetically engineered bacterium that can produce Curcuma longa sesquiterpene synthase CwTPS8; (3) Culture genetically engineered bacteria and isolate and purify the turmeric sesquiterpene synthase CwTPS8.
8. The application of the Curcuma longa sesquiterpene synthase CwTPS8 according to claim 1 in the catalytic synthesis of sesquiterpenoid compounds by farnesyl pyrophosphate (FPP).
9. The application according to claim 8, characterized in that, The sesquiterpenoid compound is at least one of β-caryophyllene, α-humulene, cypermethrin, caryophyllene alcohol, and Neointermedeol.
10. The application according to claim 8, characterized in that, The sesquiterpenoids mentioned are β-caryophyllene and α-humulene.
Citation Information
Patent Citations
Sindora glabra sesquiterpenoid synthase SgSTPS2 as well as encoding gene and application thereof
CN109097350A
Aquilaria sinensis sesquiterpene synthase as well as coding gene and application thereof
CN117568323A