Nucleic acid construct for inducing DDB2 gene silencing and application thereof

By specifically delivering the DDB2 gene shRNA into type II alveolar epithelial cells via an AAV vector, the lack of cell specificity and gene targeting in existing technologies has been overcome, achieving efficient and stable gene silencing, enhancing the lung's anti-aging and repair capabilities, and making it suitable for treating lung aging-related diseases.

CN121294449APending Publication Date: 2026-01-09XIN HUA HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511240264.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

Existing lung anti-aging and tissue repair strategies lack cell specificity and gene targeting. Conventional RNAi methods have low expression efficiency in lung tissue and are prone to off-target effects and interference with normal cell function. There is a lack of specific regulation of the DDB2 gene in alveolar type II epithelial cells.

Method used

A targeted expression system based on adeno-associated virus (AAV) vector was used to express the DDB2 gene shRNA using the SP-C promoter. The shRNA was then specifically delivered to AT2 cells via the AAV vector to achieve specific knockdown of DDB2, thereby alleviating oxidative damage and delaying cell senescence.

Benefits of technology

It improves the tissue specificity of gene intervention, reduces the risk of off-target effects, enhances the stability and processing efficiency of shRNA, and strengthens the anti-aging and repair capabilities of type II alveolar epithelial cells, making it suitable for the treatment of lung aging-related diseases such as chronic obstructive pulmonary disease and pulmonary fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294449A_ABST
    Figure CN121294449A_ABST
Patent Text Reader

Abstract

The invention discloses a nucleic acid construct for inducing DDB2 gene silencing and application of the nucleic acid construct. The designed targeted expression system based on the adeno-associated virus (AAV) vector is higher in specificity, non-target tissue can be prevented from being interfered, the tissue specificity of gene intervention is improved, and the off-target risk is small; the shRNA has high stability and processing efficiency, reduces immune response and interference effect, has high expression efficiency and strong histocompatibility, and is suitable for long-term expression intervention in vivo.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the interdisciplinary fields of molecular biology, gene therapy and regenerative medicine, and in particular to a nucleic acid construct for inducing DDB2 gene silencing and its application. Background Technology

[0002] Alveolar type II epithelial cells (AT2) are not only the main secretory cells of alveolar surfactant, but also an important stem cell-like cell population for lung tissue repair and regeneration after injury. With age or under conditions such as oxidative stress and inflammation, the proliferation and differentiation capacity of AT2 cells decline significantly, leading to alveolar structural damage and lung function deterioration, which in turn induces or aggravates age-related lung diseases such as chronic obstructive pulmonary disease and idiopathic pulmonary fibrosis.

[0003] DDB2 (Damage-specific DNA binding protein 2) was initially considered a key protein in the nucleotide excision repair pathway, but recent studies have revealed its increasing importance in regulating cellular senescence, oxidative stress response, and the cell cycle. DDB2 mediates the ubiquitination and degradation of antioxidant transcription factors, thereby inhibiting the expression of antioxidant enzymes, including SOD2 and CAT, which exacerbates ROS accumulation and cellular senescence.

[0004] RNA interference (RNAi) technology is an important strategy for inhibiting the expression of target genes. ShRNA, delivered via viruses, can achieve stable and efficient gene silencing in vivo. Adeno-associated virus (AAV) is a widely used delivery vector for gene therapy, possessing advantages such as low immunogenicity, good tissue specificity, and long-term stable expression. While gene silencing therapy has been achieved in tissues such as the liver, retina, and central nervous system, studies on specific silencing of alveolar epithelial cells, especially targeting aging markers such as DDB2, are still relatively rare.

[0005] Current strategies for lung anti-aging and tissue repair mostly rely on systemic drug intervention, which lacks cell specificity and gene targeting, easily causes side effects, and has limited therapeutic effects. Summary of the Invention

[0006] The purpose of this application is to provide an isolated polynucleotide.

[0007] Another objective of this application is to provide a nucleic acid construct.

[0008] Another objective of this application is to provide an expression medium.

[0009] Another objective of this application is to provide a cell.

[0010] Another object of this application is to provide a pharmaceutical composition.

[0011] Another objective of this application is to provide a method for preventing and / or treating lung diseases.

[0012] To address the aforementioned technical problems, a first aspect of the present invention provides an isolated polynucleotide, wherein the isolated polynucleotide comprises any sequence selected from the group consisting of:

[0013] (i) A sequence as shown in SEQ ID NO:1;

[0014] (ii) A sequence having at least 70% (preferably 80%, 90%, 95%, 97%, 99%) similarity to the sequence shown in SEQ ID NO:1;

[0015] (iii) A sequence complementary to the sequence shown in (i) or (ii).

[0016] In some preferred embodiments, the isolated polynucleotide is selected from any sequence from the group consisting of:

[0017] (i) A sequence as shown in SEQ ID NO:1;

[0018] (ii) A sequence having at least 70% (preferably 80%, 90%, 95%, 97%, 99%) similarity to the sequence shown in SEQ ID NO:1;

[0019] (iii) A sequence complementary to the sequence shown in (i) or (ii).

[0020] In some preferred embodiments, the isolated polynucleotide is a sequence as shown in SEQ ID NO:1.

[0021] A second aspect of the present invention provides a nucleic acid construct for expressing shRNA that can induce silencing, the construct comprising the isolated polynucleotides described in the first aspect of the present invention.

[0022] In some preferred embodiments, the nucleic acid construct includes a promoter.

[0023] In some preferred embodiments, the promoter is a lung tissue promoter.

[0024] In some preferred embodiments, the promoter is the U6 promoter.

[0025] In some preferred embodiments, the nucleic acid construct includes a promoter that drives gene-specific expression in type II alveolar epithelial cells.

[0026] In some preferred embodiments, the promoter is an AT2-specific promoter.

[0027] In some preferred embodiments, the AT2-specific promoter is selected from at least one of the SP-C promoter, ABCA3 promoter, SFTPA promoter, and LAMP3 promoter.

[0028] In some preferred embodiments, the promoter is the SP-C promoter, the Lysozyme M promoter, or the Nkx2.1 promoter and its variants.

[0029] In some preferred embodiments, the nucleic acid construct includes the SP-C promoter (SP-Cp).

[0030] In some preferred embodiments, the nucleic acid construct includes an shRNA backbone.

[0031] In some preferred embodiments, the shRNA backbone is a miR-155 backbone (MIR155), a miR-30 backbone, or a miR-451 backbone.

[0032] In some preferred embodiments, the nucleic acid construct includes EGFP.

[0033] In some preferred embodiments, the nucleic acid construct includes a miR-155 backbone (MIR155).

[0034] In some preferred embodiments, the nucleic acid construct includes an SV40 polyA signal.

[0035] In some preferred embodiments, the nucleic acid construct comprises SP-Cp-EGFP-MIR155(MCS)-SV40PolyA.

[0036] A third aspect of the present invention provides an expression vector comprising the nucleic acid construct for expressing shRNA that can induce silencing, as described in the second aspect of the present invention.

[0037] In some preferred embodiments, the expression vector is a viral vector.

[0038] In some preferred embodiments, the expression vector is AAV or lentivirus, preferably lung-affinity serotype AAV.

[0039] In some preferred embodiments, the expression vector is AAV6, AAV9, or AAV5.

[0040] In a fourth aspect, the present invention provides a cell comprising the nucleic acid construct for expressing shRNA that can induce silencing, as described in the second aspect of the present invention; or the expression vector described in the third aspect of the present invention.

[0041] In some preferred embodiments, the cells are animal cells.

[0042] In some preferred embodiments, the cells are subject cells.

[0043] In some preferred embodiments, the cells are present within the subject's body.

[0044] A fifth aspect of the present invention provides a method for inducing gene silencing, comprising the steps of: introducing a nucleic acid construct for expressing shRNA that can induce silencing, as described in the second aspect of the present invention, into a cell under conditions that can induce shRNA expression;

[0045] Alternatively, cells may be infected using the vector described in the third aspect of the present invention under conditions that induce shRNA expression.

[0046] A sixth aspect of the present invention provides a method for preventing and / or treating lung diseases, including lung aging-related diseases: the method includes the steps of:

[0047] The carrier described in the third aspect of the present invention is delivered to the subject;

[0048] Alternatively, administer a therapeutically effective dose of the expression vector to the subject.

[0049] In some preferred embodiments, the delivery or application is by intravenous injection or local injection, preferably by intravenous injection.

[0050] In some preferred embodiments, the lung aging-related diseases include chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis (IPF), lung cancer, pulmonary hypertension (PH), pulmonary infections (such as pneumonia, tuberculosis), acute respiratory distress syndrome (ARDS), sleep apnea syndrome (OSA), pulmonary embolism, or emphysema.

[0051] In a seventh aspect, the present invention provides a pharmaceutical composition comprising the expression vector described in the third aspect of the present invention and a pharmaceutically acceptable carrier or excipient.

[0052] Based on the prior art, the present invention has at least the following advantages:

[0053] Although DDB2 has been found to be closely related to oxidative stress and aging, there are currently no effective means to specifically regulate its function in type II alveolar epithelial cells. Conventional RNAi methods have low expression efficiency in lung tissue and lack cell selectivity, easily leading to off-target effects or interference with normal cell function. This invention develops a targeted expression system based on an adeno-associated virus (AAV) vector, which achieves shRNA expression of the DDB2 gene through the SP-C promoter, thereby specifically knocking down DDB2 in AT2 cells, alleviating oxidative damage, delaying cell senescence, and enhancing repair capacity. This technology will provide a new genetic intervention strategy for the prevention and treatment of lung aging-related diseases, pulmonary fibrosis, COPD, and repair after acute lung injury. It can also be used to establish DDB2 loss-of-function models to study its role in lung tissue homeostasis.

[0054] The targeted expression system based on adeno-associated virus (AAV) vector designed in this invention has higher specificity, can avoid interference with non-target tissues, improves the tissue specificity of gene intervention, and has a low off-target risk; shRNA has high stability and processing efficiency, while reducing immune response and interference effects. In addition, it has high expression efficiency and strong tissue affinity, making it suitable for long-term in vivo expression intervention.

[0055] It should be understood that, within the scope of this application, the above-described technical features of this application and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0056] One or more embodiments are illustrated by way of example with reference to the accompanying drawings, and these illustrative descriptions do not constitute a limitation on the embodiments.

[0057] Figure 1 This is a structural diagram of the carrier element according to an embodiment of the present invention;

[0058] Figure 2 These are photographs of lung tissue co-stained with GFP and SPC according to embodiments of the present invention;

[0059] Figure 3 These are expression maps of DDB2 and GAPDH in young and aged individuals according to embodiments of the present invention;

[0060] Figure 4 This is an expression map of DDB2 and GAPDH in young and aged mice according to an embodiment of the present invention;

[0061] Figure 5 This is a diagram of human and mouse DDB2 gene expression according to an embodiment of the present invention;

[0062] Figure 6This is a graph showing the expression of aging-related indicators in the lung tissue of young (2m) and aged (18m) mice according to an embodiment of the present invention;

[0063] Figure 7 This is a diagram showing the expression of the DDB2 gene in lung tissues of young (2m) and aged (18m) mice, and in lung tissues of young and aged rats, according to an embodiment of the present invention.

[0064] Figure 8 This is a schematic diagram of aging enzyme staining according to an embodiment of the present invention;

[0065] Figure 9 This is an experimental diagram of CCK8 according to an embodiment of the present invention;

[0066] Figure 10 This is a graph showing the results of Western blot analysis of the expression levels of aging-related proteins after siRNA transfection of MLE-12 according to an embodiment of the present invention. Detailed Implementation

[0067] the term

[0068] As used herein, the terms “comprising,” “including,” or “having,” and variations thereof are intended to cover the items listed thereafter and their equivalents, as well as additional items. The terms “an” and “a” as used herein do not indicate a limitation of quantity, but rather the presence of at least one of the referenced items.

[0069] As used in this invention, the term "DDB2 (damage-specific DNA-binding protein 2)" refers to a DNA repair factor involved in the nucleotide excision repair (NER) pathway, and has also been found to participate in processes such as cell cycle regulation, apoptosis, and epigenetic regulation. In various aging-related models, its increased expression is closely related to oxidative stress, inhibition of antioxidant genes, and accelerated aging processes.

[0070] As used in this invention, the term "SPC (Surfactant Protein C)" refers to an important protein specifically expressed by type II alveolar epithelial cells and is a key marker molecule for maintaining alveolar tension and structural integrity. It is commonly used as a regulatory element in AT2 cell-specific promoters and is frequently employed in gene expression regulation systems targeting AT2 cells.

[0071] As used in this invention, the term "type II alveolar epithelial cells (AT2 cells)" refers to a type of epithelial cell located in the alveoli, capable of secreting pulmonary surfactant, repairing damaged alveolar epithelium, and transforming into AT1 cells to rebuild the alveolar barrier. Their self-renewal and damage repair capabilities are crucial for maintaining lung tissue homeostasis and anti-aging.

[0072] As used in this invention, the term "adeno-associated virus (AAV)" refers to a small, non-pathogenic single-stranded DNA virus widely used in in vivo gene delivery systems. AAV is characterized by low immunogenicity, tissue-specific expression capability, and strong long-term expression stability, making it suitable for constructing gene therapy vectors.

[0073] As used herein, the term "SP-Cp-EGFP-MIR155(MCS)-SV40 PolyA" refers to an adeno-associated virus (AAV) expression vector constructed in embodiments of this invention for specific expression on alveolar type II epithelial cells. The definitions of each element are as follows:

[0074] SP-Cp: the promoter element of the lung surfactant protein C (SP-C) gene, specifically designed to target AT2 cell expression;

[0075] EGFP: Enhanced green fluorescent protein, used to trace cells that express EGFP;

[0076] MIR155 (MCS): Based on the human miR-155 precursor structure, a specific shRNA sequence is inserted into its multiple cloning site (MCS) to achieve RNAi silencing of the target gene (DDB2 in this case).

[0077] SV40 PolyA: The simian virus 40 polyadenylation signal sequence, used to terminate transcription and stabilize mRNA.

[0078] As used herein, the term "RNA interference (RNAi)" refers to a gene silencing mechanism mediated by double-stranded RNA, which inhibits the expression of a target gene by degrading specific mRNAs via shRNA or siRNA. In this study, the DDB2 gene was silenced by shRNA delivery via AAV to mouse alveolar type II epithelial cells.

[0079] In this invention, the active RNAi sequence is as follows:

[0080] Label Name TargetSeq AAV6-Ddb2-RNAi(P25C0408) CTCTAGCTTCTTACCAGGTAT(SEQ ID NO:1)

[0081] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the present application is further described below in conjunction with specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and weight parts. Unless otherwise specified, the experimental materials and reagents used in the following embodiments are commercially available.

[0082] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. It should be noted that the terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the exemplary embodiments of this application.

[0083] Example 1: Construction of a tissue-specific RNA interference vector based on adeno-associated virus (AAV)

[0084] To achieve specific silencing of the DDB2 gene (target gene ID: 107986) in alveolar type II epithelial cells (AT2 cells) and enhance its anti-aging and repair capabilities, this embodiment constructs a tissue-specific RNA interference vector based on adeno-associated virus (AAV). The specific steps are as follows:

[0085] 1. Carrier Construction

[0086] This embodiment uses an expression system driven by the human SP-C (Surfactant Protein C) promoter to construct the expression framework as follows:

[0087] SP-Cp-EGFP-MIR155(MCS)-SV40 PolyA

[0088] The system includes the following core modules:

[0089] SP-C promoter (SP-Cp): This is a type II alveolar epithelial cell-specific promoter that ensures shRNA is expressed only in target cells;

[0090] EGFP: Used to trace viral infection efficiency and positive expression cells;

[0091] miR-155 backbone (MIR155): serves as a shRNA chimerism platform, inserting shRNA sequences targeting the DDB2 gene into the MCS (multiple cloning site);

[0092] SV40 polyA signaling promotes transcription termination and mRNA stability.

[0093] The shRNA sequence targeting DDB2 was predicted and screened using bioinformatics to ensure high efficiency, high specificity, and low off-target risk. The shRNA sequence was then cloned into the MIR155 backbone site after PCR amplification.

[0094] See the schematic diagram of the carrier. Figure 1 .

[0095] The clone build information is as follows:

[0096]

[0097] Example 2: AAV Packaging and Delivery

[0098] (1) The constructed expression vector was co-transfected with AAV packaging plasmid into 293T cells.

[0099] 1. Twenty-four hours before transfection, AAV-293 cells in logarithmic growth phase were digested with trypsin, and the cell density was adjusted to approximately 5 x 10^6 cells / 15 ml with medium containing 10% serum. The cells were then reseeded in 10 cm cell culture dishes and incubated at 37°C in a 5% CO2 incubator. Transfection was initiated after 24 hours when the cell density reached 70%–80%.

[0100] 2. Replace the medium with one containing 2% serum 2 hours before transfection;

[0101] 3. Add the prepared DNA solutions (5 μg of GV vector plasmid, 5 H8 of pHelper vector plasmid, and 5 μg of AAV-RC plasmid) to a sterile centrifuge tube, mix them with the corresponding volume of Gilead transfection reagent, adjust the total volume to 1 mL, and incubate at room temperature for 15 min.

[0102] 4. Slowly add the mixture dropwise to the culture medium of AAV-293 cells, mix well, and incubate at 37°C in a 5% CO2 cell culture incubator; Note: The addition process must be thorough, and avoid blowing the cells away as much as possible.

[0103] 5. After culturing for 6 hours, discard the culture medium containing the transfection mixture, add 10 mL of PBS solution to wash once, gently shake the culture dish to wash away the remaining transfection mixture, and then discard it.

[0104] Slowly add 10 mL of cell culture medium containing 5% serum, and continue culturing at 37°C in a 5% CO₂ incubator for 48-72 h.

[0105] (2) AAV virus concentration and purification

[0106] 1. Collect AAV-293 cell supernatant and cells 72 h after transfection (0 h is considered the start time after transfection) according to cell state;

[0107] 2. Centrifuge at 3000g for 5 minutes at 4℃ to separate cells from the supernatant;

[0108] 3. Add the Gilead AAV virus concentration kit to the supernatant to obtain the virus from the supernatant. Resuspend the cell pellet in resuspension buffer, and freeze-thaw four times in liquid nitrogen at 37°C. Centrifuge. Then combine the two virus fractions.

[0109] 4. Balance the samples separately, and put the ultracentrifuge tubes containing the virus supernatant into the Beckman ultracentrifuge one by one. Set the centrifugation parameters to 63,000 rpm, centrifugation time to 2 h, and centrifugation temperature to 18℃.

[0110] 5. Aspirate the separated layer containing the virus. Place it in an ultrafiltration column for ultrafiltration until a colorless or pale pink clear liquid is obtained;

[0111] 6. Sterilize the obtained virus solution by passing it through a 0.22μm filter membrane and dispense it as required;

[0112] 7. Prepare samples for testing.

[0113] (3) AAV virus titer detection

[0114] 1. Prepare four 90 μL water aliquots for each sample, placing them in Eppendorf tubes. Take 10 μL of the sample and add it to the first aliquot, mix well, and name it -1. Then take 10 μL of the sample from this aliquot and add it to the second aliquot, naming it -2, and so on. Finally, obtain eight sample dilutions. Use the last five aliquots as templates for quantitative PCR.

[0115] 2. Take 10 μL of each sample and add it to 40 μL of water, mix well and name it -2. Prepare four 90 μL water aliquots, put them in Eppendorf tubes, then take 10 μL of each aliquot and add it to 90 μL of water, name it -3, and so on. The difference is that there are four dilutions; the last three are used for quantitative PCR.

[0116] 3. Calculate the required number of reaction wells. For each reaction, use 10 μL of 2xSYBR Green Mix, 0.5 μL each of forward and reverse primers, and 0.2 μL of Lox reference dye. Add water to bring the volume to 15 μL. Prepare one extra reaction system for every 20 reactions to avoid reagent shortages. Add the prepared reaction system to a 96-well plate, 15 μL per well. Add 5 mg of reagent to each sample. Set up replicate PCR reactions according to the SYBR Green kit instructions.

[0117] After obtaining the Ct values, a standard curve is obtained by using the logarithm of the standard concentration and the average Ct value. The titer of the sample to be tested is then calculated based on the standard curve and the calculation formula.

[0118] Calculation formula: Virus particle count (vg / mL) - Measured value / Dilution x 2** Since the qPCR standard is double-stranded DNA, while the AAV virus genome is single-stranded DNA, it is necessary to multiply by 2 when calculating the AAV titer.

[0119] Virus titer test results:

[0120] Label Name serotype Titer (vg / mL) AAV6-Ddb2-RNAi(P25C0407) 6 1.16E+12 AAV6-Ddb2-RNAi(P25C0408) 6 1.01E+12

[0121] Example 3: Experimental Animal Models and Tissue Acquisition

[0122] The experimental mice were 6-week-old male mice with a C57BL / 6 background. Tissue samples were collected 42 days after intratracheal instillation of the virus. EGFP-positive cells were observed via paraffin sectioning of lung tissue and immunofluorescence labeling to confirm expression localization. Lung tissue was also used for qPCR and Western blot analysis to detect DDB2 mRNA and protein levels to verify knockdown efficiency.

[0123] Adeno-associated virus tracheal infusion model

[0124] (1) Virus dosage: The lung epithelial-specific (SP-C promoter) knockdown DDB2 adeno-associated virus and the negative control virus were both viral vectors with specific promoters but no specific target sequence, and were synthesized by Jikai Gene Company. The adeno-associated virus was prepared to 1E12 v.g / ml, and the total amount of adeno-associated virus injected into each mouse was 5E10 v.g, with an injection volume of 50 μL. The control virus used the same dose and total amount.

[0125] (2) Tracheal instillation model: After anesthetizing wild-type C57 mice (Aphthyl 20 μL / g), the mice's limbs were fixed to the operating table with transparent tape, and the incisors were fixed with silk thread. The left hand gently moved the mouse's tongue to the upper left, and the right hand used tweezers to pick up a small cotton ball and gently wipe the secretions in the pharynx. With the aid of light, the arterial cannula (20 G) was inserted into the mouse's trachea through the glottis under direct vision. The cannula needle was removed, and a homemade small cotton ball was placed at the cannula opening. It was observed that the small cotton ball swayed with the mouse's respiratory rate, indicating that the cannula was inserted into the trachea. 50 μL of virus solution was drawn with a microsyringe and quickly dripped into the lungs through the cannula. 200 μL of air was injected with a 1 mL syringe. The tracheal tube was removed, the mouse was held upright between the ears, and the front of the mouse's chest cavity was gently patted. The mouse was placed on a warm blanket to recover from anesthesia and continued to be fed for 28 days. Lung tissue was then harvested.

[0126] (II) Immunofluorescence staining of paraffin sections of lung tissue

[0127] (1) The collected lung tissue was placed in 4% paraformaldehyde fixative and soaked thoroughly, and stored in the dark. After 48 hours, it was embedded in paraffin, dewaxed, and the section thickness was 4μm.

[0128] (2) Antigen retrieval: The slide was placed in citrate buffer and heated in a microwave oven to perform antigen retrieval.

[0129] (3) Permeabilize with 0.1% Triton X-100 / PBS for 10 min

[0130] (4) Primary antibody incubation: Prepare GFP antibody (Proteintech) and SPC antibody (Seville) at a ratio of 1:200 (diluted with 5% BSA) and add them to the tissue section. Place the tissue section in a black humidified box overnight.

[0131] (5) Secondary antibody incubation: The tissue sections were washed three times in PBS buffer for 5 minutes each time; the fluorescent secondary antibodies of different species were prepared at a ratio of 1:200 (diluted with 5% BSA), dropped onto the tissue sections, and incubated at 37°C in the dark for 1 hour.

[0132] (6) Nuclear staining: Tissue sections were washed three times in PBS buffer for 5 minutes each time. DAPI staining solution was added, and the sections were washed again after 5 minutes. After washing twice with PBS, anti-fluorescence quenching agent was added to the tissue sections, and the sections were mounted. The sections were observed and photographed under a fluorescence microscope.

[0133] (III) Real-time quantitative PCR (q-PCR)

[0134] RNA extraction

[0135] (1) When collecting mouse lung tissue samples, place a piece of lung tissue weighing approximately 20-30 mg in a 2 mL centrifuge tube, add 1 mL of Trizol reagent, and store at -80℃. Once all samples have been collected, remove the tube, thaw it on ice, add grinding beads, and grind at low temperature at a frequency of 50 Hz for 30 seconds per grinding cycle. Repeat this grinding cycle for the fourth time. When the sample has been ground sufficiently, check if it has been ground sufficiently. If it has not been ground sufficiently, proceed to the next step. If it has not been ground completely, repeat the grinding process until the sample has been ground sufficiently.

[0136] Discard the cell culture supernatant, wash once with PBS, and completely aspirate the liquid; add 1 mL of RNA lysis buffer Trizol to each well of the cell culture plate, and use a pipette to completely transfer the adherent cells to a 2 mL centrifuge tube.

[0137] (2) Add 1 / 3 volume of chloroform to the ground lung tissue homogenate or cell suspension, vortex thoroughly to mix, and place in a 4°C refrigerator for 20 minutes.

[0138] (3) Centrifuge the sample at low temperature. Set the centrifuge conditions to 12,000 rpm and centrifuge at 4°C for 20 minutes. After centrifugation, the sample is divided into three layers, from top to bottom: a colorless chloroform layer, a white film layer, and a red Trizol layer.

[0139] (4) Carefully transfer about 400 μL of the top colorless chloroform layer to a 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix by inverting, and store at -20°C overnight.

[0140] (5) Remove the sample and centrifuge at 12,000 rpm for 20 minutes at 4°C. The white precipitate at the bottom of the centrifuge tube after centrifugation is RNA.

[0141] (6) Discard the supernatant, add 500 μL of 75% ethanol solution prepared with DEPC water, gently blow away the precipitate, and centrifuge at 12,000 rpm for 5 minutes at 4°C. Repeat twice. After discarding the supernatant, carefully remove the remaining liquid and open the Eppendorf tube cap to evaporate excess ethanol.

[0142] (7) When the RNA becomes transparent, add 20 μL of enzyme-free water and mix by pipetting.

[0143] (8) The concentration and purity of RNA were determined using a NanoDrop 2000. The RNA purity was reflected by the absorbance at 260 nm and 280 nm (Optical Density, OD). A ratio between 1.8 and 2.0 indicated a qualified sample, which could then proceed to the next reverse transcription step. If the reaction was not to be performed immediately, the RNA sample could be stored at -80°C.

[0144] mRNA reverse transcription polymerase chain reaction

[0145] (1) Using Takara's PrimeScript quantitative reverse transcription kit containing gDNA TM The extracted RNA was reverse transcribed using the RT reagent kit with gDNA Eraser (Perfect Real Time). The reverse transcription system (20 μL) is as follows:

[0146] First, prepare the reaction solution:

[0147] ①Removal of gDNA reaction solution components

[0148]

[0149] ② Components of the RNA reverse transcription reaction solution

[0150]

[0151] Note: Prepare the required reaction solution by adding 2 to the sample quantity. Add the reaction solution to the reaction plate in the following order: gDNA removal mix + RNase Freewater + RNA + reverse transcription reaction solution mix.

[0152] (2) The reverse transcription conditions are as follows:

[0153] 37℃ for 15 minutes * 6

[0154] 85℃ for 5 seconds

[0155] 4℃*7

[0156] (3) Quantitative real-time PCR (qPCR)

[0157] Dilute the 20 μL cDNA sample (after reverse transcription) 10-fold with 180 μL of double-distilled water. Perform qPCR using the ChamQ UniversalSYBR qPCR Master Mix reagent kit from Novizan. The system is as follows:

[0158]

[0159] Add the mixture and diluted cDNA sample sequentially to a 96-well PCR plate, mix thoroughly, centrifuge, and then perform qPCR under the following conditions:

[0160]

[0161] Calculate the values ​​of each sample group according to the formula. -△△Ct value.

[0162] (4) List of primer sequences for the target gene

[0163]

[0164] (iv) Western blotting of proteins

[0165] tissue protein extraction

[0166] (1) Weigh 20 mg of lung tissue and place it in a 1.5 mL centrifuge tube. Add 200 μL of pre-chilled PBS, gently press out the blood using a plastic stick, centrifuge at 5000 rpm for 5 minutes, and remove the blood. Then add 400 μL of pre-chilled PBS and centrifuge at 7000 rpm for 7 minutes. Transfer the lung tissue to a 2 mL centrifuge tube. Add 200 μL of protein lysis buffer (strong RIPA:PMSF = 100:1, strong RIPA:protease phosphatase inhibitor mixture = 50:1).

[0167] (2) Low-temperature grinding: the grinding instrument is set to a frequency of 50Hz, a single grinding time of 30s, and a total of 5-6 grindings. The tissue homogenate is repeatedly frozen and thawed 2-3 times to fully lyse the protein.

[0168] (3) Centrifuge at 12,000 rpm and 4°C for 20 minutes. After centrifugation, transfer the cell supernatant to a new centrifuge tube.

[0169] (4) Add 5×loading buffer at a ratio of lysis buffer: 5×loading buffer = 4:1, shake thoroughly to mix, and then denature the protein. The conditions are 100℃ for 10 minutes.

[0170] Cell protein extraction

[0171] (1) After cell treatment, aspirate the culture supernatant and store at -80℃. Wash the cells twice with PBS and aspirate all the liquid.

[0172] (2) Mix strong RIPA lysis buffer and PMSF at a ratio of 100:1, and strong RIPA lysis buffer, EDTA, protease inhibitor, and phosphatase inhibitor at a ratio of 1:50.

[0173] (3) Add 100 μL of lysis buffer to each well of the cells cultured in the six-well plate, place on ice and shake gently for 30 minutes.

[0174] Use a cell scraper to scrape off the adherent cells and transfer them to a 1.5 mL centrifuge tube.

[0175] (4) Centrifuge at 12,000 rpm for 10 minutes in a low-temperature centrifuge, and transfer the supernatant to a new centrifuge tube.

[0176] (5) Denature the protein at 100℃ for 10 minutes.

[0177] BCA protein quantification

[0178] (1) Preparation of BCA working solution: Solution A: Solution B = 50:1, prepared according to the total number of samples + 2, and the working solution volume is 200μL / well.

[0179] (2) Preparation of protein standards: First, dilute the 5 mg / mL protein standard to 0.5 mg / mL, and add 0, 1, 2, 4, 8, 12, 16, 20 μL of the diluted protein standard (0.5 mg / mL) to one column of a 96-well plate in sequence, and add PBS to make up to 20 μL / well.

[0180] (3) Add protein samples and working solution: Take 2 μL of protein sample from each well and add it to a 96-well plate. Add 18 μL of PBS to bring the total to 20 μL. Add 200 μL of BCA working solution to both the standard and protein sample wells and incubate at 65°C for 30 minutes to develop the colorimetric reaction.

[0181] (4) Protein concentration determination using an ELISA reader: Detect the absorbance of the sample at A595 and plot a standard curve, then calculate the concentration of each sample using the formula.

[0182] Western blotting assay for proteins

[0183] (1) Preparation of SDS-polyacrylamide gel: Different concentrations of separating gel (7.5%, 10%, 15%) were selected based on the protein molecular weight, and prepared according to the instructions of the PAGE gel rapid preparation kit from Yamei Company. After fixing the 1.5mm gel preparation glass plate onto the preparation rack and ensuring no leakage, proceed with the following formulation:

[0184] Lower layer adhesive formulation

[0185]

[0186] Pour the prepared mixture into the glass plate, ensuring the distance between the surface of the lower layer of adhesive and the upper edge of the short glass plate is 0.5 cm longer than the comb teeth. Add 1 mL of 75% ethanol to cover the lower layer of adhesive. After the lower layer of adhesive has solidified (a clear boundary line will appear between the lower layer of adhesive and isopropanol after about 15 minutes), discard the upper layer of 75% ethanol and prepare the upper layer of adhesive according to the following formula:

[0187] Top layer adhesive formulation

[0188]

[0189] Inject the mixture into the glass plate, immediately insert the 15-hole or 10-hole comb teeth, let it stand, and wait for the top layer of adhesive to solidify (about 15 minutes).

[0190] (2) Electrophoresis: Place the gels in the electrophoresis tank, add the prepared 1× electrophoresis buffer between the two gels, and after confirming there is no leakage, remove the comb. Adjust the loading volume of each sample to 40 μg of total protein. Add protein pre-stained markers indicating molecular weight to the wells on both sides of the sample. First, adjust the voltage to 80V. After the sample reaches the separating gel, adjust the voltage to 120V until the bromophenol blue indicator reaches the bottom of the gel and stop electrophoresis.

[0191] (3) Transfer: Prepare filter paper, PVDF membrane (activated with methanol), pre-cooled transfer buffer, gasket, and transfer clamp. Soak the transfer clamp, gasket, and two layers of pre-cut thick filter paper in the recovered transfer buffer in sequence. Use plastic forceps to place the activated PVDF on top of the filter paper, then transfer the electrophoresis gel onto the membrane. Add two more layers of pre-cut thick filter paper on top of the gel. Use a 15mL centrifuge tube to roll on the filter paper to remove air bubbles. Add the gasket and clamp the transfer clamp tightly (white side of the transfer clamp close to the membrane, black side close to the gel). Place it in the transfer tank (black side of the transfer tank opposite the black side of the clamp, red side opposite the white side of the clamp). Pour the pre-cooled transfer buffer into the transfer tank, add two small ice packs, maintain a constant voltage of 100V, and control the initial current at around 120mA, with a maximum current not exceeding 300mA. The transfer time depends on the molecular weight and is approximately 80-100 minutes.

[0192] (4) Sealing: After the PVDF membrane is transferred, take it out and put it into a small box containing 5% skim milk. Sealing is done on a shaker at room temperature for 2 hours.

[0193] (5) Primary antibody incubation: Wash the blocked protein bands three times in TBST for 5 minutes each time. After washing, add primary antibodies (prepared with primary antibody dilution buffer) to the corresponding positions marked by the markers on the bands: DDB2 (1:1000), P53 (1:1000), P21 (1:1000), P16 (1:1000), β-actin (1:3000), and incubate overnight at 4°C.

[0194] (6) Secondary antibody incubation: Recover the primary antibody, add TBST to the band cassette and wash three times, 10 minutes each time. Prepare secondary antibodies of mouse or rabbit origin (1:5000) using secondary antibody dilution buffer, and add them to the bands incubated with primary antibodies of different species. Incubate on a shaker at room temperature for 1 hour.

[0195] (7) Strip exposure: Recover the secondary antibody, add TBST to the strip cassette and wash three times, 5 minutes each time. Prepare chemiluminescence developing solution by mixing solution A and solution B in equal proportions from the kit, and evenly drop the mixture onto the surface of the strip. Expose the strip in a Tianneng chemiluminescence imager, take pictures, and save the images. Statistical analysis will be performed using ImageJ software.

[0196] (V) β-galactosidase staining of senescent cells

[0197] (1) After the cells (or cell smears) are cultured in 6-well plates, remove the cell culture medium, wash twice with PBS, add 1 mL of β-galactosidase staining and fixing solution, and fix at room temperature for 15 min.

[0198] (2) Discard the fixative and wash the cells with PBS three times for 2 minutes each time.

[0199] (3) Use a pipette to remove the PBS completely, add 1 mL of β-galactosidase staining working solution to each well, and incubate at 37°C for 2 hours to overnight.

[0200] (4) Observe under a regular optical microscope. After the positive cells are stained, remove the staining working solution and wash with PBS several times.

[0201] (5) Add 2 mL of PBS to cover the cells. The staining is now complete. This sample can be stored at 4°C for 1 week.

[0202] (vi) Cell proliferation detection

[0203] 1. Seed cell suspension (100 μL / well) in 96-well plates. Typically, about 2000 cells are per well for cell proliferation experiments.

[0204] 2. According to experimental requirements, culture the product and administer 0-10 μL of a specific drug for stimulation for an appropriate period of time.

[0205] 3. Add 10 μL of CCK-8 solution to each well. If the initial culture volume is 200 μL, then add 20 μL of CCK-8 solution, and so on. Wells with the corresponding amount of cell culture medium and CCK-8 but without cells can be used as blank controls. If you are concerned that the drug used may interfere with the detection, you need to set up wells with the corresponding amount of cell culture medium, drug, and CCK-8 solution but without cells as blank controls.

[0206] 4. Continue incubation in the cell culture incubator for 1-4 hours. The specific time can be determined through preliminary experiments. In the preliminary experiments, the absorbance can be measured with a microplate reader after 0.5, 1, 2, and 4 hours, and then a time point with a suitable absorbance range can be selected for subsequent experiments.

[0207] 5. Measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0208] (vii) siRNA interference experiment

[0209] The synthesis of the DDB2 knockdown siRNA and control siRNA sequences was commissioned to Shanghai Gemma Gene Co., Ltd. Their sequences are as follows:

[0210]

[0211] The negative control consists of disordered small interfering fragments.

[0212] (1) First, centrifuge the Eppendorf tube containing siRNA at 12,000 rpm for 1 minute. Add 125 μL of DEPC water to each 1 OD siRNA to make a 20 μM solution.

[0213] (2) Primary cultured endothelial cells were seeded in 24-well or 6-well cell culture plates and used for cell interference experiments when the cell density reached 80%. The transfection kit used was Takara's Xfect TMRNA Transfection.

[0214] For Reagent, the transfection procedure should be performed according to the reagent instructions.

[0215]

[0216] (3) Mix Tube1 and Tube2 evenly, add the mixture from Tube2 to Tube1, incubate at room temperature for 15 minutes, add to the cell culture medium, and gently shake the culture plate to mix thoroughly. Continue culturing for 24 hours and then change the culture medium.

[0217] (4) Extract transfected cell proteins, detect transfection efficiency by Western blot, determine transfection efficiency, add appropriate treatment factors, and carry out subsequent experiments.

[0218] Tests showed that P25C0408 (Ddb2-RNAi-408) could effectively knock down the target gene, while P25C0407 (Ddb2-RNAi-407) had no knockdown activity.

[0219] Example 4: Functional Verification Experiment

[0220] In this embodiment, cellular senescence and proliferation markers were detected: siRNA was constructed using P25C0408, transfected at the cellular level, and SA-β-gal staining and CCK8 assays were used to assess cellular senescence and proliferation in alveolar epithelial cells; and anti-aging ability was detected: the expression levels of senescence-related proteins such as P53, P21, and P16 were measured. Preliminary experiments demonstrated that this system can achieve efficient and stable DDB2 gene knockdown in alveolar type II epithelial cells; after knockdown, AT2 cell senescence markers decreased and proliferation activity increased.

[0221] (1) Results of GFP and SPC co-stained lung tissues can be found in [reference]. Figure 2 .

[0222] (2) DDB2 expression is high in aging lung tissue (human and mouse) (WB and PCR). See [reference needed]. Figure 3-5 .

[0223] (3) Following AAV intratracheal instillation, PCR was performed on the lungs of young mice (2m). (See attached image) Figure 7 As shown in the figure, the DDB2 content decreased, and Ddb2-RNAi-407 did not have knockdown activity.

[0224] (4) Following AAV intratracheal instillation, lung tissue white blood cell (WB) and aging-related indices decreased in young (2m) and aged (18m) mice. See [reference needed]. Figure 6 .

[0225] (5) Different concentrations of H2O2 were used to treat for different durations to induce senescence. The knocked-down sequence was used to construct siRNA, which was then transfected into MLE-12. Senescence enzyme staining was performed. Figure 8 ), and then 250 μm was selected for treatment for 48 h for subsequent experiments.

[0226] (6) H2O2-induced senescence, knockdown sequences were used to construct siRNA transfected into MLE-12 cells, and CCK8 assays showed improved proliferation of senescent cells. Figure 9 ).

[0227] (7) H2O2-induced senescence, knockdown sequences were used to construct siRNA transfected into MLE-12 cells, and Western blotting showed improvement in senescence. See [link to relevant documentation]. Figure 10 .

[0228] Those skilled in the art will understand that the above embodiments are specific implementations of this application, and in practical applications, various changes can be made in form and detail without departing from the spirit and scope of this application.

Claims

1. An isolated polynucleotide, characterized in that, The isolated polynucleotides include sequences selected from any of the following groups: (i) A sequence as shown in SEQ ID NO:1; (ii) A sequence having at least 70% (preferably 80%, 90%, 95%, 97%, 99%) similarity to the sequence shown in SEQ ID NO:1; (iii) A sequence complementary to the sequence shown in (i) or (ii).

2. A nucleic acid construct for expressing shRNA that can induce silencing, characterized in that, The construct comprises the isolated polynucleotide as described in claim 1.

3. The nucleic acid construct according to claim 2, characterized in that, The nucleic acid construct includes a promoter, which is a lung tissue promoter or a U6 promoter; preferably, the promoter is a promoter that drives the specific expression of genes in type II alveolar epithelial cells.

4. The nucleic acid construct according to claim 2, characterized in that, The promoter is an AT2-specific promoter, which is selected from at least one of the SP-C promoter, ABCA3 promoter, SFTPA promoter and LAMP3 promoter, preferably the SP-C promoter.

5. The nucleic acid construct according to claim 2, characterized in that, The nucleic acid construct includes an shRNA backbone, which is a miR-155 backbone (MIR155), a miR-30 backbone, or a miR-451 backbone.

6. The nucleic acid construct according to claim 2, characterized in that, The nucleic acid construct includes EGFP; and / or the nucleic acid construct includes SV40 polyA signal.

7. The nucleic acid construct according to claim 2, characterized in that, The nucleic acid construct includes SP-Cp-EGFP-MIR155(MCS)-SV40 PolyA.

8. An expression carrier, characterized in that, The expression vector includes the nucleic acid construct as described in any one of claims 2-7.

9. The expression vector according to claim 8, characterized in that, The expression vector is a viral vector, preferably AAV or lentivirus, and more preferably AAV6, AAV9 or AAV5.

10. A cell, characterized in that, The cells comprise nucleic acid constructs as described in any one of claims 2-7; or expression vectors as described in claim 8 or 9.

11. A method for inducing gene silencing, characterized in that, The steps include: introducing the nucleic acid construct as described in any one of claims 2-7 into cells under conditions that induce shRNA expression; Alternatively, cells may be infected using the expression vector as described in claim 8 or 9 under conditions that induce shRNA expression.

12. A method for preventing and / or treating lung diseases, said lung diseases including age-related lung diseases, pulmonary fibrosis, COPD, or acute lung injury: the method includes the steps of: The expression vector as described in claim 8 or 9 is delivered to the subject; Alternatively, administer a therapeutically effective amount of the expression vector as described in claim 8 or 9 to the subject.

13. A pharmaceutical composition, characterized in that, The pharmaceutical composition includes the expression vector as described in claim 8 or 9, and a pharmaceutically acceptable carrier or excipient.