Gene for coding split-ring loganin synthase obtained by gene cloning and separation from gentiana macrophylla pall, split-ring loganin synthase, recombinant plasmid, recombinant bacterium and application of split-ring loganin synthase

Abstract

The invention belongs to the technical field of recombinant proteins, and particularly relates to a gene for coding a split-ring loganin synthase, the split-ring loganin synthase, a recombinant plasmid, a recombinant bacterium and an application of the split-ring loganin synthase in catalyzing loganin acid to generate a split-ring iridoid compound, wherein the gene is cloned and separated from a gene in gentiana macrophylla pall. The sequence of the gene for coding the split-ring loganin synthase is as shown in SEQ ID NO.01, and the amino acid sequence of the split-ring loganin synthase is as shown in SEQ ID NO.02. The recombinant plasmid contains a sequence shown in SEQ ID NO. 01. The recombinant bacteria comprise recombinant yeast WAT11 or recombinant agrobacterium GV3101 and the like containing recombinant plasmids. The ring-splitting loganin synthase produced and expressed by the recombinant yeast WAT11 can be used for catalyzing loganin acid to generate sweroside, gentiopicroside or ring-splitting loganin acid. The split-ring loganin synthase produced and expressed by the recombinant agrobacterium GV3101 catalyzes loganin acid in tobacco leaves to produce gentiopicroside.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of recombinant proteins, in particular to a gene encoding secologanin synthase, secologanin synthase, recombinant plasmid, recombinant bacteria and application of secologanin synthase in catalyzing secologanin acid to generate secologanenol. BACKGROUND

[0002] The heterologous expression system of model plants is often used for in vivo functional verification of functional genes, and common heterologous expression methods of genes include yeast eukaryotic expression system and model plant expression system.

[0003] The yeast expression system can perform post-translational processing and modification (such as glycosylation and phosphorylation) on exogenous proteins to a certain extent, so as to be closer to the natural structure and function of eukaryotic proteins, and is particularly suitable for expressing eukaryotic genes and preparing high-activity target proteins. The yeast cells also synthesize the carbon skeleton of terpenoids through the MVA pathway and the MEP pathway, which is highly similar to the terpenoid synthesis pathway in plants, thereby providing an adaptive environment for the expression of terpenoid synthesis pathway proteins. In addition, the endoplasmic reticulum membrane system of yeast can provide sufficient space for the synthesis and folding of membrane proteins, and the recombinant proteins expressed using this system can usually exhibit normal functions similar to those of plant cells.

[0004] The transient expression technology is a technology for transferring a target gene into a target cell in a relatively short time, establishing a temporary high-efficiency expression system in the cell, and obtaining short-term high-level expression of the target gene. Compared with various limitations of traditional genetic regeneration transgenic technology, the plant transient expression technology has the core advantages of simple operation, safety, stable expression, and short test period. In plant genetic transformation research, the Agrobacterium-mediated method is the most widely used, most clear in mechanism, and most ideal in effect among the carrier transfer methods in plant genetic engineering due to its efficient T-DNA transfer mechanism and stable genetic characteristics with the assistance of Vir genes.

[0005] The transient expression system based on this system can quickly detect gene function within 24-72 hours. In the synthesis of medical compounds, the synthesis enzyme gene is often introduced in a targeted manner to realize precise catalysis of complex biochemical reactions in plant cells and obtain target products. For example, researchers have reconstructed a complete etoposide glycoside synthesis pathway in tobacco, realizing the large-scale synthesis of the compound.

[0006] At present, there is a lack of examples and experience in the in vitro biosynthesis of secologanenol terpenoids (julocan, gentiopicroside and secologanin acid) in plants, and it is urgent to synthesize key enzymes in the synthesis pathway of secologanenol terpenoids in vitro to provide basic research data for the synthesis of related compounds. SUMMARY

[0007] The application aims to solve the problems of the lack of in vitro synthesis of the above-mentioned seco-iridoid compounds, and provides a seco-loganic acid synthase, a recombinant plasmid for expressing the seco-loganic acid synthase, a recombinant bacterium, and application of the seco-loganic acid synthase in catalyzing the generation of jujuboside, gentiopicroside and seco-loganic acid.

[0008] The technical solution of the present application

[0009] Firstly, the present application provides a gene for coding seco-loganic acid synthase, which is isolated from crude Gentiana crassicaulis by gene cloning, and the gene sequence is shown in SEQ ID NO. 01.

[0010] The above-mentioned base sequence of the seco-loganic acid synthase cloned from crude Gentiana crassicaulis can also be obtained from Gentiana straminea.

[0011] A seco-loganic acid synthase, the amino acid sequence of which is shown in SEQ ID NO. 2, is encoded by the above-mentioned gene sequence of SEQ ID NO: 01.

[0012] In the above-mentioned gene cloning process, the sequence of the upstream primer is shown in SEQ ID NO. 03, and the sequence of the downstream primer is shown in SEQ ID NO. 04.

[0013] Secondly, the present application provides a recombinant plasmid, which contains the above-mentioned gene for coding seco-loganic acid synthase isolated from crude Gentiana crassicaulis by gene cloning. The expression vector used in the preparation process of the recombinant plasmid is a eukaryotic expression vector, a prokaryotic expression vector, etc., and is preferably a pHB, pESC or pET plasmid.

[0014] The obtained recombinant plasmid is preferably a recombinant plasmid pHB-GcSLS, pESC-GcSLS or pET-GcSLS containing the gene sequence for coding seco-loganic acid synthase (GcSLS).

[0015] The homologous arm primer pair used in the above-mentioned preparation process of the recombinant plasmid is as follows:

[0016] When the recombinant plasmid is pHB-GcSLS, the homologous arm primer pair includes forward primer pHB-GcSLS F and reverse primer pHB-GcSLS R. The nucleotide sequence of the forward primer pHB-GcSLS F is shown in SEQ ID NO: 5, and the length of the homologous arm sequence from the 5' end to the 3' end is 20 bp. The nucleotide sequence of the reverse primer pHB-GcSLS R is shown in SEQ ID NO: 6, and the length of the homologous arm sequence from the 5' end to the 3' end is 20 bp.

[0017] When the recombinant plasmid is pESC-GcSLS, the homology arm primer pair comprises forward primer pESC-GcSLS F and reverse primer pESC-GcSLS R; wherein the nucleotide sequence of the forward primer pESC-GcSLS F is shown as SEQ ID NO: 7, and the length of the homology arm sequence from the 5' end to the 3' end is 20 bp; the nucleotide sequence of the reverse primer pESC-GcSLS R is shown as SEQ ID NO: 8, and the length of the homology arm sequence from the 5' end to the 3' end is 20 bp.

[0018] When the recombinant plasmid is pET-GcSLS, the homology arm primer pair comprises forward primer pET-GcSLS F and reverse primer pET-GcSLS R; wherein the nucleotide sequence of the forward primer pET-GcSLS F is shown as SEQ ID NO: 9 (TCCGAATTCGAGCTCATGGAGGTGGATC), and the length of the homology arm sequence from the 5' end to the 3' end is 15 bp; the nucleotide sequence of the reverse primer pET-GcSLS R is shown as SEQ ID NO: 10 (AGTGCGGCCGCAAGCTTCTCAAGCTTC), and the length of the homology arm sequence from the 5' end to the 3' end is 17 bp.

[0019] Thirdly, the present application provides a recombinant bacterium, preferably recombinant E. coli TOP10 containing recombinant plasmid pHB-GcSLS and recombinant Agrobacterium GV3101, recombinant yeast WAT11 containing recombinant plasmid pESC-GcSLS, or suitable recombinant E. coli BL series containing recombinant plasmid pET-GcSLS, such as recombinant E. coli BL21, etc.

[0020] Fourthly, the present application provides a method for expressing and producing seco-loganic acid synthase using the above-mentioned recombinant bacterium.

[0021] The present application is only illustrated by taking recombinant Agrobacterium GV3101 and recombinant yeast WAT11 as examples, which specifically comprises the following steps:

[0022] When the recombinant bacterium used is recombinant yeast WAT11, the method for expressing and producing seco-loganic acid synthase using the same comprises the following steps:

[0023] The fermentation culture, galactose-induced expression, cell wall breaking and separation of the recombinant yeast WAT11 are performed to obtain yeast microsomal protein, i.e. seco-loganic acid synthase, which is dissolved by TEG Buffer to obtain a yeast microsomal protein solution, i.e. a solution containing seco-loganic acid synthase; and the solution is stored at -20℃.

[0024] The application of the secologanin synthase expressed by the recombinant yeast WAT11 described above in catalyzing the production of jiontogenin, swertiamarin or secologanin acid from loganin acid, specifically includes the following steps:

[0025] The NADPH-Na4, FAD-Na2, FMN, DTT, G-6P-Na2, G-6-PD, the solution containing the secologanin synthase, the substrate loganin acid and the aqueous solution of sodium citrate are mixed in a volume ratio of NADPH-Na4:FAD-Na2:FMN:DTT:G-6P-Na2:G-6-PD:yeast microsomal protein solution:substrate loganin acid:aqueous solution of sodium citrate of 20:2.5:2.5:1:1:2:100:20:5, and then the temperature is controlled at 28℃ and the rotation speed is 220rpm for 18-25h to obtain a reaction solution;

[0026] The obtained reaction solution is added with 3 times the volume of glacial acetic acid to terminate the reaction, and the liquid is evaporated by nitrogen blowing for 3.5h, 1.5 times the volume of the reaction solution of 70v / v% methanol aqueous solution is added for redissolution, and the obtained solution is detected to contain jiontogenin, swertiamarin and secologanin acid. According to the purpose of the experiment, high performance liquid chromatography column can be used to separate jiontogenin, swertiamarin and secologanin acid.

[0027] According to the ion fragment mass ratio in the application example, it can be inferred that the secologanin synthase produced by the recombinant yeast WAT11 described above can also be used for biocatalysis of loganin to produce secoxyloganin.

[0028] When the recombinant bacteria used is the recombinant Agrobacterium GV3101, the method for expressing and producing secologanin synthase is as follows:

[0029] The fermentation culture and AS induction expression of the recombinant Agrobacterium GV3101 obtain the recombinant Agrobacterium GV3101 bacterial solution containing secologanin synthase;

[0030] The application method of the secologanin synthase expressed by the recombinant Agrobacterium GV3101 described above in catalyzing the reaction of loganin acid to produce swertiamarin in tobacco, specifically includes the following steps

[0031] After the recombinant Agrobacterium GV3101 bacterial solution containing secologanin synthase is injected into tobacco, it is dark cultured in a 26℃ incubator for 24h, light cultured for 24h, then the substrate solution is injected again, and light cultured for 24h again;

[0032] The substrate solution, the substrate loganin acid is diluted to 100μM using MS liquid medium to obtain a solution;

[0033] The amount of the recombinant Agrobacterium GV3101 liquid containing the seco-loganin synthase and the substrate solution is calculated according to the full tobacco leaf, and in the embodiment of the application, the amount of the recombinant Agrobacterium GV3101 liquid containing the seco-loganin synthase and the substrate solution is about 1ml per 10cm 2 The amount of the recombinant Agrobacterium GV3101 liquid containing the seco-loganin synthase and the substrate solution is calculated according to the full tobacco leaf, and in the embodiment of the application, the amount of the recombinant Agrobacterium GV3101 liquid containing the seco-loganin synthase and the substrate solution is about 1ml per 10cm

[0034] After the above light culture for 24h, the temperature is controlled at 4℃ for freeze-drying, and the tobacco powder is crushed to a particle size of 50-100μm, then the tobacco powder and 80v / v% methanol aqueous solution are mixed at a ratio of 10mg:1mL, and ultrasonic extraction (control parameter 200W, frequency 53kHz) is performed for 1h, 4℃, 13000rpm centrifugation for 30min, and the supernatant is separated by high performance liquid chromatography to obtain gentiopicroside.

[0035] The beneficial technical effects of the application

[0036] The seco-loganin synthase of the application is a base sequence for coding seco-loganin synthase obtained by excavation and cloning from Gentiana crassicaulis Duthie ex Burk., and can be expressed by the recombinant yeast WAT11 containing the recombinant plasmid pESC-GcSL coding the sequence, so that the seco-loganin synthase can be quantitatively produced to realize in vitro catalytic synthesis of seco-loganecic iridoid compounds such as swertiamarin, gentiopicroside and seco-loganic acid.

[0037] The seco-loganin synthase of the application is a base sequence for coding seco-loganin synthase obtained by excavation and cloning from Gentiana crassicaulis Duthie ex Burk., and can be expressed by the recombinant Agrobacterium GV3101 containing the recombinant plasmid pHB-GcSL coding the sequence and realize catalytic generation of gentiopicroside from loganic acid in tobacco, thereby providing a theoretical guidance for in vivo synthesis of seco-loganecic iridoid compounds in heterologous plants, and providing a possibility for solving the problem of lack of such compounds in existing rare species. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 The agarose gel electrophoresis diagram of the solution containing DNA obtained in step (3) of Example 1;

[0039] Figure 2 The agarose gel electrophoresis diagram of the pHB plasmid and the enzyme digestion product (linearized pHB plasmid) of step (3) of Example 2;

[0040] Figure 3, agarose gel electrophoresis of recombinant plasmid pHB-GcSLS of step (5) of Example 2;

[0041] Figure 4 , agarose gel electrophoresis of recombinant Agrobacterium GV3101 containing recombinant plasmid pHB-GcSLS of step (6) of Example 2;

[0042] Figure 5, gentaloside base peak chromatogram of the control group, loganin acid experimental group and standard group in tobacco using Example 1;

[0043] Figure 6, gentaloside primary mass spectrum of the loganin acid experimental group in tobacco using Example 1;

[0044] Figure 7, agarose gel electrophoresis of pESC plasmid and linear plasmid (linearized pESC plasmid) after enzyme digestion of step (3) of Example 3;

[0045] Figure 8 , agarose gel electrophoresis of recombinant plasmid pESC-GcSLS of step (5) of Example 3;

[0046] Figure 9, agarose gel electrophoresis of recombinant yeast WAT11 obtained by transforming competent yeast WAT11 with recombinant plasmid pESC-GcSLS of step (6) of Example 3;

[0047] Figure 10, peak area change of loganin acid of the experimental group and control group using Example 2;

[0048] Figure 11 , base peak chromatogram of jionoside of the loganin acid reaction group using Example 2;

[0049] Figure 12, primary mass spectrum of jionoside of the loganin acid reaction group using Example 2;

[0050] Figure 13 , base peak chromatogram of gentaloside of the loganin acid reaction group using Example 2;

[0051] Figure 14, primary mass spectrum of gentaloside of the loganin acid reaction group using Example 2;

[0052] Figure 15, base peak chromatogram of the presumed seco-loganin acid of the loganin acid reaction group using Example 2;

[0053] Figure 16 , primary mass spectrum of the presumed seco-loganin acid of the loganin acid reaction group using Example 2. DETAILED DESCRIPTION

[0054] The present application will be described in detail below by specific examples or application examples in conjunction with the accompanying drawings, but the present application is not limited thereto.

[0055] The raw materials, reagents, kits, etc. used in the embodiments of the present application are commercially available, except for the special description in the following table:

[0056]

[0057]

[0058] The various biological material information used in the embodiments of the present application is as follows:

[0059]

[0060] Example 1

[0061] A base sequence encoding fumarilatensiflorin synthase is obtained by comprising the following steps:

[0062] (1) Extraction of total RNA

[0063] Total RNA is extracted from crude stem Gentiana crassicaulis (from Shangri-La, Yunnan, China); the steps of RNA extraction are referred to the instruction manual of Trizol Up Plus RNA Kit, and the extracted RNA is immediately stored in a -80℃ ultra-low temperature refrigerator after detection;

[0064] (2) Synthesis of cDNA

[0065] RNA is subjected to reverse transcription to synthesize cDNA, and the specific steps are referred to the instruction manual of MightyScript first strand cDNA synthesis kit; the obtained cDNA product is stored in a -20℃ refrigerator;

[0066] (3) PCR amplification of cDNA

[0067] The upstream primer F sequence as shown in SEQ ID NO. 03 and the downstream primer R sequence as shown in SEQ ID NO. 04 are designed according to the head and tail sequences of GcSLS CDS, and the amplification is performed with the root site, i.e. cDNA as a template; the amplification system includes template cDNA and buffer, etc.; the specific components and contents of the amplification reaction are shown in Table 1:

[0068] Table 1: Components and contents of the PCR amplification reaction system of cDNA

[0069]

[0070] The amplification reaction conditions are as follows: 94℃ 5min; 36× (94℃ 30s, 55℃ 30s, 72℃ 1min), 72℃ 5min;

[0071] The primer sequence number and specific primer sequence used for amplification are shown in Table 2 below.

[0072] Table 2, primer sequence number and primer sequence used for amplification

[0073]

[0074] After the above amplification, a solution containing DNA is obtained;

[0075] (4) Gel electrophoresis and purification

[0076] The above obtained solution containing DNA is subjected to agarose gel electrophoresis, and the results are shown in Figure 1 As can be seen from Figure 1 , the target fragment size of the DNA is about 1500 bp;

[0077] The gel is cut to obtain the DNA target fragment; then the target fragment is purified using the Zena FastPure Gel DNA Extraction Mini Kit gel recovery kit to obtain the purified DNA fragment (containing the GcSLS gene);

[0078] (5) Cloning and sequencing

[0079] The above purified DNA fragment is connected to the TOPO vector (Biosune) using a vector construction method (the vector construction method is a common vector construction method in the prior art), and then E. coli TOP10 is transformed, 220 rpm, 37°C incubator culture for 1-2 h, centrifugation of the bacterial solution at 4000 rpm, remove the supernatant and reserve 200 μL, then resuspend and spread on LB solid culture medium containing Amp resistance, and incubate at 37°C for 12-16 h;

[0080] Pick a single colony and add LB liquid medium containing Amp / Kan (single antibiotic, Amp working concentration 50 μg / mL, Kan working concentration 100 μg / mL) resistance, 37°C, 220 rpm incubator culture for 12 h, to obtain the bacterial solution;

[0081] The above obtained bacterial solution is subjected to PCR identification using Taq enzyme (Novozyme) and vector universal primers M13 F / R (M13R: CAG GAA ACA GCT ATG ACC; M13F: TGT AAA ACG ACG GCC AGT), and the transformed results are selected to send to Shanghai Shengong Biological Company for sequencing.

[0082] The sequencing result shows that the gene sequence coding the cleistanthin synthase is successfully obtained in the transformed E. coli TOP10 strain, and the gene sequence is shown as SEQ ID NO. 1, and the amino acid sequence corresponding to SEQ ID NO. 1 is shown as SEQ ID NO. 2.

[0083] The obtained GcSLS strain is preserved at -20℃.

[0084] The sequence of SEQ ID NO. 1 sequenced above is as follows:

[0085]

[0086] The sequence of the sequenced SEQ ID NO. 2 is as follows:

[0087] MEVDLIKKAL VASCLALVLG WVWRILDWAW FTPKRIEKRL REQGFKGNPY KLLVGDVNEN AEMLKEAMSK PMPFNNDVFP RVMPHIHHTI QKYGKKSFTW MGRIPRVNIL EPELVKEMLF NHGKFQKNFELHNPLVMLLL SGIGSLEGDK WAKHRKIISP AFTLEKLKTM LPSFAVCYND LLSKWEKTAA KDGSIEVDIFPTFDVLTSDV ISKVAFGSTY EEGNKVFLLL KEMMDLTIDS MRSVYIPGWC YVPTKKNNRL KACNKVITDMMRNIINKRMK AITAGEPGED DLLGVLLDSN VQEIRKYGNK KNVGMTIDEV IDECKLFYFA GQETTGVLLTWSSILLSKHP EWQERAREEV LQTFGKNKPD FDRLNHLKYV NMILYETLRL YPPVVDLTKV CHKDTKLGPYTIPGGTQVIA LSLMLHRDKT IWGEDALEFN PGRFAEGVAN ATKNQTAFLS FSAGPRVCLG QNFALLQAKLGLTMLLQRFT WDLSPSYTHA PFTILTMQPQ FGSHVIYKKLE

[0088] Example 2

[0089] A method for constructing a recombinant Agrobacterium GV3101 containing a recombinant plasmid pHB-GcSLS, comprising the following steps:

[0090] (1) Extraction of pHB vector

[0091] 10 μL of pHB vector preserved by E. coli was taken in a sterile table, and was added into 5 mL of LB culture medium containing Kan (kanamycin) resistance. The bacteria were shaken at 220 rpm and 37°C overnight (12-16 h). When the OD600 of the bacterial solution was 0.6-0.8 (the turbidity of the bacterial solution was observed), the bacterial solution with OD600 of 0.6-0.8 was subjected to plasmid extraction according to the instructions of ATG Pure Plasmid Mini Kit D101. The obtained pHB plasmid was stored at -20°C for standby use.

[0092] (2) The purified DNA fragment (containing the GcSLS gene) obtained in step (4) of Example 1 is used to obtain the GcSLS gene fragment containing the homologous arm using homologous arm recombination technology.

[0093] The homologous arm primer pair pHB-GcSLS F / R (terminator removed) used for the above homologous arm recombination includes the forward primer pHB-GcSLS F and the reverse primer pHB-GcSLS R.

[0094] The nucleotide sequence of pHB-GcSLS F is shown in SEQ ID NO:5, and the length of the homologous arm sequence from the 5' end to the 3' end is 20 bp;

[0095] The nucleotide sequence of pHB-GcSLS R is shown in SEQ ID NO:6. The length of the homologous arm sequence from the 5' end to the 3' end is 20 bp, as detailed in Table 3 below:

[0096] Table 3. Primer numbers and sequences of homologous arm primer pairs used for homologous recombination for pHB-GcSLS F / R.

[0097]

[0098] Using the activated and preserved GcSLS strain obtained in Practice 1 as a DNA template, the GcSLS gene fragment containing homologous arms was amplified by PCR (pre-denaturation (95℃, 5min), cyclic amplification (36 cycles in total, each cycle including denaturation (95℃, 30s), annealing (60℃, 30s), extension (72℃, 10s)) and final extension (72℃, 5min)) to obtain the amplified product of the GcSLS gene containing homologous arms;

[0099] The amplification product of the obtained GcSLS gene containing homologous arms was recovered and purified (see the instructions for the Novizan FastPureGel DNA Extraction Mini Kit) and stored at -20℃.

[0100] (3) pHB vector digestion

[0101] According to the pHB-GcSLS restriction site, the pHB plasmid obtained in step (1) was double-digested with restriction endonucleases BamHI and PstI according to the instructions of the Bose endonuclease. The digestion process was 37℃ for 2.5h (digestion) and 85℃ for 20min (enzyme inactivation, termination of reaction). After digestion, the plasmid was recovered and purified to obtain the linear plasmid (digestion product), i.e., the linearized pHB plasmid, which was stored at -20℃ for later use.

[0102] Validation of linearized plasmids:

[0103] Take 1 μL of the original pHB plasmid, the above-mentioned enzyme digestion product, mix with glycerol gel loading buffer, and perform electrophoresis. The difference in electrophoretic positions between the two groups of samples indicates whether the pHB plasmid has been cut (generally, the original plasmid sample has a faster electrophoretic speed). Perform PCR product electrophoresis (110 V, 400 mA, 30 min). The results are as follows: Figure 2 As shown, from Figure 2 As can be seen, there is a significant difference in the position of the bands between the original pHB plasmid and the enzyme digestion product, proving that the double digestion of the circular pHB plasmid was completed and the linearized pHB plasmid was successfully obtained.

[0104] The linearized pHB plasmid after enzyme digestion was recovered, purified, and stored at -20℃ for later use.

[0105] (4) Connection reaction

[0106] The ligation reaction was carried out according to the instructions of Novizan One Step Cloning Kit. The vector digestion product, i.e., the linearized pHB plasmid, the amplification product of the GcSLS gene containing homologous arms, homologous recombinase, ddH2O, etc. were added in proportion and mixed evenly. The temperature was controlled at 50℃ for ligation for 1 hour to obtain the ligation solution containing the recombinant plasmid pHB-GcSLS.

[0107] (5) Top 10 competent cells transformed by recombinant plasmid pHB-GcSLS

[0108] Add 10 μL of ligation solution containing recombinant plasmid pHB-GcSLS to 50 μL of competent Escherichia coli TOP10 (Weidi Biotechnology), mix well, incubate on ice for 30 min, then transfer to a 42℃ environment for 90 s, and then incubate on ice for 2 min. Finally, transfer to 5 mL of LB liquid medium and incubate at 220 rpm and 37℃. Shaking table After culturing for 1-2 h, the bacterial culture was centrifuged at 4000 rpm. The supernatant was removed, and 200 μL was retained and resuspended in a centrifuge tube. The resuspended culture was spread onto a pre-prepared LB agar plate containing 10 μg / mL AMP (ampicillin) resistance. The plate was incubated upside down at 37℃ for 16 h. A single colony was picked and inoculated into 5 mL of LB liquid medium and incubated for 16 h to obtain the culture medium.

[0109] Using gene primers and vector primers (i.e., pHB-GcSLS F, RBC48A), PCR amplification was performed using the culture medium obtained above as a template (if a single band is amplified, it is positive, indicating that the bacteria contain the target recombinant plasmid).

[0110] If the PCR amplification is positive, the bacterial culture is sent to Sangon Biotech (Shanghai) for sequencing and identification to confirm the successful positive clone; the culture medium of the positive clone is the culture medium of recombinant Escherichia coli TOP10 containing the recombinant plasmid pHB-GcSLS.

[0111] The culture medium that has been successfully confirmed to be positive is then expanded for further culture, following these steps:

[0112] Take 100 μL of positive bacterial culture and incubate it in 40 ml of LB medium with the corresponding antibiotic at 37°C and 220 rpm for 12-16 h to obtain the expanded culture medium;

[0113] The recombinant plasmid was extracted from the above-mentioned expanded culture medium according to the ATG Pure Plasmid Mini Kit D101 instructions to obtain the recombinant plasmid pHB-GcSLS;

[0114] The agarose gel electrophoresis image of the above recombinant plasmid pHB-GcSLS is shown below. Figure 3 As shown, from Figure 3 The image shows a single band of about 1500bp, indicating that the plasmid recombination was successful.

[0115] (6) The recombinant plasmid pHB-GcSLS was transformed into Agrobacterium competent cells GV3101 to obtain recombinant Agrobacterium GV3101 containing the recombinant plasmid pHB-GcSLS. The specific steps are as follows:

[0116] ① After thawing 100 μL of GV3101 competent cells in an ice bath, add 2.5 μL of the pHB-GcSLS recombinant plasmid obtained in step (5), and use the empty pHB plasmid as a blank control. Subsequent experimental operations are synchronized and the cells are kept in an ice bath for 30 min.

[0117] ② Quick freeze in liquid nitrogen for 5 min, heat shock in a 37℃ water bath for 5 min, and renature in an ice bath for 5 min; add 700 μL of YEB liquid medium and incubate at 28℃ and 220 rpm for 3-5 h with shaking.

[0118] ③ Spread the bacterial culture onto YEB solid medium containing Kan (50 mg·L⁻¹) and Rif (20 mg·L⁻¹), incubate at 28℃ upside down for 48-60 h, and screen for positive clones. The positive clones are recombinant Agrobacterium GV3101 containing the recombinant plasmid pHB-GcSLS; preserve the culture at -20℃.

[0119] The bacterial culture was amplified by PCR using the gene primer pHB-GcSLS F and the vector primer RBC48A (RBC48A is a downstream identification sequence on the vector, sequence number SEQ ID NO.11, sequence 5'-GCATTGAACTTGACGAACGTTGTCGA-3'). Sequencing of the strain showed that the sequence was correct, confirming that the recombinant plasmid pHB-GcSLS was successfully transformed into Agrobacterium GV3101.

[0120] Agarose gel electrophoresis image of recombinant Agrobacterium GV3101 containing recombinant plasmid pHB-GcSLS is shown below. Figure 4 As shown, from Figure 4 A bright band can be seen at 1500bp, indicating that the recombinant plasmid pHB-GcSLS was successfully transformed into Agrobacterium GV3101, and recombinant Agrobacterium GV3101 was obtained.

[0121] Application Example 1

[0122] The application of loganin synthase expressed by recombinant Agrobacterium GV3101 containing the recombinant plasmid pHB-GcSLS in the catalytic conversion of loganic acid to gentiopicrin in tobacco is described in the following steps:

[0123] (1) Take 10 μL of recombinant Agrobacterium GV3101 (OD) 600 Add the bacterial suspension (approximately 0.6-0.8) to 500 μL of YEB liquid medium containing double antibiotics Kan (50 μg / mL) and Rif (20 μg / mL), and incubate overnight at 28°C and 200 rpm in a constant temperature shaker to obtain activated bacterial suspension;

[0124] Preparation of the above YEB medium: Weigh 1 g each of tryptone, beef extract powder, and D(+)-sucrose, 0.2 g of yeast extract powder, and 0.1 g of magnesium sulfate heptahydrate. Dissolve in 200 mL of ultrapure water (add 3 g of agar powder to solid medium). Add 1 mol / L NaOH to adjust the pH to about 7.4 (about 18 drops). Cover the bottle mouth with a breathable sealing film and autoclave at 121℃ for 15 min. After cooling, dispense into sterile 50 mL centrifuge tubes in a clean bench and store at -20℃ for later use.

[0125] (2) Take 10 μL of activated bacterial solution and add it to 500 μL of YEB liquid medium containing double antibiotics Kan (50 μg / mL) and Rif (20 μg / mL). Incubate overnight at 28°C and 200 rpm in a constant temperature shaker to obtain the expanded activated bacterial solution.

[0126] (3) Take 5 mL of the activated bacterial culture and centrifuge at 4000 rpm for 10 min at room temperature. Discard the supernatant and resuspend the bacteria in MS liquid medium (Bio-Style) until the OD value reaches 0.5.600 The concentration was approximately 0.6. Then, stabilizer MES (added in an amount that makes the concentration of MES (morpholine ethyl sulfoxide) 1M) and inducer AS (added in an amount that makes the concentration of AS (acetylsuccinone) 0.1M) were added. After standing for 3 hours, a bacterial culture containing schizolognusin synthase was obtained.

[0127] (4) Inject the above bacterial solution containing cleistoside synthase into tobacco leaves:

[0128] Select healthy tobacco leaves from 4 weeks old (the tobacco leaves are Benedictine leaves, planted in a 26℃ constant temperature incubator, and the watering frequency should be such that the soil is kept moist). Use a 1mL sterile syringe needle to puncture the back of the tobacco leaf to form a micropore. Remove the needle and draw up the bacterial solution containing schizologna glycoside synthase obtained in step (3). Hold the small hole on the back of the leaf and gently inject the bacterial solution containing schizologna glycoside synthase. After the bacterial solution containing schizologna glycoside synthase has completely penetrated, wipe off the excess bacterial solution, mark the injected leaf, and incubate in the dark in a 26℃ incubator for 24 hours, and then incubate in the light for 24 hours.

[0129] The amount of bacterial solution containing clethodim synthase mentioned above should be enough to completely cover the tobacco leaves. In this example, it is calculated per 10cm. 2 Inject approximately 1 ml of recombinant Agrobacterium GV3101 bacterial suspension containing schizologonin synthase into the surface of tobacco leaves.

[0130] (5) Dilute the substrate (loganic acid) to 100 μM using MS liquid medium to obtain a substrate solution. Immediately after the above step (4) light culture for 24 h, inject the substrate solution into the tobacco leaves and then light culture for 24 h.

[0131] The amount of the above-mentioned substrate solution should be enough to completely cover the tobacco leaves. In this embodiment, it is calculated per 10cm. 2 Inject approximately 1 ml of substrate solution onto the surface of tobacco leaves;

[0132] (6) Cut off the tobacco leaves injected with the bacterial solution containing schizolognus synthase and the substrate, put them in a freeze dryer and freeze-dry them at 4℃ for 36-48h. Then, grind them into powder at 4℃ (to a particle size of 50-100μm). Weigh 10mg of the sample into a 2mL centrifuge tube, add 1mL of 80% methanol aqueous solution, extract by sonication (200W, frequency 53kHz) for 1h, centrifuge at 13000rpm for 30min at 4℃ to obtain the supernatant.

[0133] The supernatant obtained above is the experimental group (loganic acid experimental group: injection of bacterial culture containing cleaved loganin synthase and substrate loganic acid);

[0134] The control group was treated by injecting blank bacterial suspension (i.e., bacterial suspension corresponding to the blank control plasmid) instead of bacterial suspension containing cleistoside synthase, and the rest was the same as above;

[0135] The standard group, namely gentiopicrin, was set up with tobacco leaves injected only with MS medium as the chemical background, and the other conditions were the same as those described above.

[0136] The supernatants of the experimental group, control group, and standards were analyzed using UPLC-Q-TOF / MS (Accurate-Mass Q-TOF liquid chromatography-mass spectrometry system, model 6530). Agilent MassHunter Qualitative Analysis B.06.00 software was used to identify the spectra and extract peak area data.

[0137] The sample loading volume for the analytical process is 10 μL;

[0138] Mass spectrometry acquisition process control parameters: negative ion scanning mode selected, electrospray ionization source (ESI), nebulizer pressure (GS1) 55 Psi, auxiliary pressure (GS2) 55 Psi, curtain pressure (CUR) 35 Psi; ion source temperature (TEM) 550°C, spray voltage (IS) 4 kV; first-stage scan: declustering voltage (DP) 125 V, mass spectrometry scan range: m / z 100 ~ 1500; second-stage scan: MS / MS spectra acquired using IDA mode, collision-induced dissociation (CID) energy 30 V.

[0139] To identify the relevant secoiridin (gentiopicrin) compounds in tobacco leaves, the response values ​​(BPC chromatograms) of the experimental group, control group, and standard were extracted and analyzed by UPLC-Q-TOF / MS at the same time point during the process. The results are shown in the figure below. Figure 5 As shown in Figure 6, the primary mass spectrum of gentiopicroside of loganic acid in the experimental group is shown in Figure 6.

[0140] From the table above Figure 5 , Figure 6 As can be seen from the figure, the target product was detected in the experimental group. By comparing with the control and standard, it was preliminarily determined that gentiopicrin was generated in the loganic acid substrate group.

[0141] Example 3

[0142] A method for constructing recombinant yeast strain WAT11 containing recombinant plasmid pESC-GcSLS

[0143] (1) The purified DNA fragment (containing the GcSLS gene) obtained in step (4) of Example 1 is recombined using homologous arm technology to obtain the GcSLS gene containing homologous arms;

[0144] The homologous arm primer pair pESC-GcSLS F / R (with terminator removed) used for the above homologous arm recombination includes the forward primer pESC-GcSLS F and the reverse primer pESC-GcSLS R.

[0145] The nucleotide sequence of pESC-GcSLS F is shown in SEQ ID NO:7, with a length of 20bp from the 5' end to the 3' end homologous arm sequence. The nucleotide sequence of pESC-GcSLS R is shown in SEQ ID NO:8, with a length of 20bp from the 5' end to the 3' end homologous arm sequence. The details are shown in Table 4 below.

[0146] Table 4. Primer numbers and sequences of homologous arm primer pairs used for homologous recombination pESC-GcSLS F / R. .

[0147] Using the activated and preserved GcSLS strain obtained in Practice 1 as a DNA template, the GcSLS gene fragment containing the homologous arm was amplified by PCR to obtain the amplified product of the GcSLS gene containing the homologous arm.

[0148] The amplification product of the obtained GcSLS gene containing homologous arms was recovered and purified (see the instructions for the Novizan FastPureGel DNA Extraction Mini Kit) and stored at -20℃.

[0149] (3) pESC vector digestion

[0150] According to the instructions of Baishengyue, the pESC vector was double-digested with restriction endonucleases EcoRI and NotI. The digestion procedure was 37℃ for 2.5h (digestion) and 85℃ for 20min (enzyme inactivation, termination of reaction). After digestion, the pESC vector was recovered and purified to obtain linear plasmid (digestion product), i.e., linearized pESC plasmid, which was stored at -20℃ for later use.

[0151] Validation of linearized plasmids:

[0152] Take 1 μL of the original pESC plasmid, the above-mentioned enzyme digestion product, mix with glycerol gel loading buffer, and perform electrophoresis. The difference in electrophoretic positions between the two groups of samples indicates whether the pESC plasmid has been cut (generally, the original plasmid sample will have a faster electrophoretic speed). The glycerol gel electrophoresis results (110 V, 400 mA, 30 min) are as follows: Figure 7 As shown, from Figure 7As can be seen, there is a significant difference in the position of the bands between the original pESC plasmid and the enzyme digestion product, indicating that the double digestion of the pESC circular plasmid with restriction endonucleases EcoRI and NotI was successfully completed, and the linearized pESC plasmid was obtained.

[0153] The linearized pESC plasmid after enzyme digestion was recovered, purified, and stored at -20℃ for later use.

[0154] (4) Connection reaction

[0155] According to the instructions of Novizan One Step Cloning Kit, the ligation reaction was carried out. The vector digestion product, i.e., the linearized pESC plasmid, the amplification product of the GcSLS gene with homologous arms obtained in step (2), homologous recombinase, ddH2O, etc. were added in proportion and mixed evenly. The temperature was controlled at 50℃ for ligation for 1 hour to obtain the ligation solution containing the recombinant plasmid pESC-GcSLS.

[0156] (5) Top 10 competent cells transformed by recombinant plasmid pESC-GcSLS

[0157] The steps (5) of Example 2 are the same, except that the ligation solution containing recombinant plasmid pHB-GcSLS is replaced with the ligation solution containing recombinant plasmid pESC-GcSLS obtained in step (4) above. The other steps (5) of Example 2 are the same, and the culture medium is obtained.

[0158] Using gene primer pESC-GcSLS F and vector primer RBC48A (the RBC48A sequence is shown in SEQ ID NO.11 above), PCR amplification was performed using the culture medium obtained above as a template (if a single band is amplified, it is positive, indicating that the bacteria contain the target recombinant plasmid).

[0159] If the PCR amplification is positive, the bacterial culture is sent to Sangon Biotech (Shanghai) for sequencing and identification to confirm the successful positive clone; the culture medium of the positive clone is the culture medium of recombinant Escherichia coli TOP10 containing the recombinant plasmid pESC-GcSLS.

[0160] The culture medium that has been successfully confirmed to be positive is then expanded for further culture, following these steps:

[0161] Take 100 μL of positive bacterial culture and incubate it in 40 ml of LB medium with the corresponding antibiotic at 37°C and 220 rpm for 12-16 h to obtain the expanded culture medium;

[0162] The recombinant plasmid was extracted from the above-mentioned expanded culture medium according to the ATG Pure Plasmid Mini Kit D101 instructions to obtain the recombinant plasmid pESC-GcSLS;

[0163] The agarose gel electrophoresis image of the above recombinant plasmid pESC-GcSLS is shown below. Figure 8 As shown, from Figure 8 As can be seen, there is a single band at around 1500bp, which indicates that the plasmid recombination was successful.

[0164] (6) Transform competent yeast WAT11 with recombinant plasmid pESC-GcSLS to obtain recombinant yeast WAT11 containing recombinant plasmid pESC-GcSLS. The specific steps are as follows:

[0165] ① Preparation of competent yeast WAT11

[0166] a. Preparation of WAT11 solution for competent yeast cells:

[0167] Take yeast WAT11 culture (measure OD) 600 Add 10 μL of WAT11 culture (0.6-0.8) to 5 mL of YPD medium and incubate overnight at 28°C and 220 rpm. The next day, add 2 mL of WAT11 culture to 20 mL of YPD medium and incubate at 28°C and 220 rpm for 6 h to further activate the culture and make the OD600 0.6-1.0, thus obtaining the competent yeast WAT11 solution to be prepared.

[0168] Preparation of the above-mentioned YPD medium: Take 2 g of yeast nitrogen source YNB, 4 g of peptone, and 4 g of D-glucose, add 200 mL of ultrapure water to a 250 mL Erlenmeyer flask, autoclave, cool, dispense into a clean bench, and store at -20℃ for later use;

[0169] b. Centrifuge the WAT11 solution of the yeast cells to be prepared at 3600 rpm and 4℃ for 5 min to collect the yeast cells and discard the supernatant.

[0170] c. Add 1 mL of 0.1 M LiAC aqueous solution to resuspend the cells and transfer them to a 2 mL centrifuge tube;

[0171] d. Collect yeast by centrifugation at 1200×g and 4℃ for 2 min, remove supernatant, and resuspend in 200μL of 0.1M LiAC solution to obtain competent yeast WAT11 solution;

[0172] ② Yeast conversion (all operations except centrifugation are performed in a sterile environment; all consumables and containers must be sterile)

[0173] Add 120 μL of PEG3500 (50% w / v), 18 μL of LiAC (1.0 M), 5 μL of salmon sperm DNA (which needs to be boiled for 10 min before use to unwind the double strands), 10 μL of ligation buffer containing recombinant plasmid pESC-GcSLS, 27 μL of ddH2O, and 25 μL of competent yeast cell WAT11 solution to a 1.5 mL EP tube and mix gently.

[0174] The above conversion system was placed in a 30℃ water bath for 30 min, then transferred to a 42℃ water bath for heat shock for 15 min, and immediately placed on ice for 5 min.

[0175] Centrifuge at 1200×g, 4℃ for 2 min, remove supernatant, wash once with 500μL ddH2O, centrifuge to remove liquid, add 500μL ddH2O to resuspend, take 200μL and spread on SD-his plate, incubate at 28℃ for 3 days.

[0176] The above single colonies were picked and cultured in SD-his medium at 200 rpm and 28℃ for 36-48 h. Positive clones were then screened. The positive clones were the recombinant yeast WAT11 culture medium that successfully expressed the recombinant plasmid pESC-GcSLS. The culture medium was then preserved at -20℃.

[0177] The bacterial culture was amplified by gene primer pESC-GcSLS F and vector primer RBC48A (RBC48A is a downstream identification sequence GCATTGAACTTGACGAACGTTGTCGA on the vector). The bacterial strain was sent for sequencing and the sequence was confirmed to be correct. The recombinant plasmid pESC-GcSLS was successfully transformed into yeast WAT11.

[0178] Before the above-mentioned bacterial test, the bacterial solution was flash-frozen in liquid nitrogen for 1 minute and then thawed.

[0179] Agarose gel electrophoresis image of yeast WAT11 transformed with recombinant plasmid pESC-GcSLS is shown below. Figure 9 As shown, from Figure 9 The image shows a single band of about 1500bp, indicating that the recombinant plasmid pESC-GcSLS was successfully transformed into yeast WAT11, resulting in recombinant yeast WAT11.

[0180] (6) Induced expression

[0181] Pick a single colony of the positive clone obtained in step (5) and place it in a 250 mL Erlenmeyer flask containing 10 mL of SD-his liquid medium. Incubate at 28 °C for 24 h at 200 rpm.

[0182] Preparation of SD-his liquid culture medium: Take 1.675 g of yeast nitrogen source YNB (containing ammonium sulfate, without amino acids), 4 g of D-glucose, 1.6 g of histidine (his) deficiency (add 4 g of agar powder for solids), add 200 mL of ultrapure water, and autoclave at high temperature (115℃, 15 min).

[0183] Then, centrifuge at 2000×g, 4℃ for 5 min, remove the supernatant, collect the bacterial cells, add 1 mL of 20w / w% galactose YPGE medium to resuspend the yeast cells WAT11, transfer to a 2 mL centrifuge tube, and repeat this step once; after resuspending, add 25 mL of 20w / w% galactose YPGE medium to make the OD600 0.4~0.6;

[0184] Then, the expression was induced and cultured at 200 rpm and 28℃ for 16 h to obtain the expression solution;

[0185] (7) Extraction of yeast microsomal proteins

[0186] ① The expression solution obtained in step (6) was centrifuged at 2000×g and 4℃ for 5min to collect yeast WAT11 cells. The supernatant was removed, and yeast WAT11 was resuspended in 10% volume of TEK Buffer and placed at room temperature for 5min.

[0187] ② Collect yeast WAT11 cells by centrifugation under the same conditions as above, and resuspend the yeast WAT11 cells in 40 mL of pre-cooled TESB Buffer;

[0188] ③Use an ultra-high pressure continuous flow cell disruptor (EmulsiFlex-B15, Ovistin (Shanghai) Nanotechnology Co., Ltd.) to disrupt yeast WAT11 cells at 4℃ and 1200 bar, repeat 3 times, and immediately place on ice;

[0189] ④ Centrifuge at 12000×g, 4℃ for 30min to allow the ruptured yeast WAT11 cells to settle at the bottom of the tube;

[0190] ⑤ Pour the supernatant into a pre-cooled 50mL Erlenmeyer flask, add 10mL of PEG4000-NaCl aqueous solution (PEG4000:NaCl:deionized water = 250 g:22 g:500 mL), shake gently, and incubate on ice for 15min;

[0191] ⑥ Centrifuge under the same conditions as ④, discard the supernatant, and the brown precipitate at the bottom of the centrifuge tube is yeast microsomal protein containing cleologin synthase (GcSLS) produced by recombinant yeast WAT11 expression. Then add 2 mL of TEG Buffer solution to dissolve the precipitate to obtain a yeast microsomal protein solution containing cleologin synthase.

[0192] The TEG Buffer solution used above is prepared as follows: Dissolve 12.12g Tris-base (Sinopharm Group) and 0.58g EDTA in 1600mL deionized water, adjust the pH to 7.4, and bring the volume to 2L to obtain the TE solution; add 100mL LTE solution to 100mL glycerol to obtain the TEG Buffer solution.

[0193] Application Example 2

[0194] The loganin synthase produced by recombinant yeast WAT11 expression obtained in Example 3 was used for in vitro biocatalytic loganic acid reaction. The composition and amount of each raw material used in the specific catalytic reaction are as follows, based on a 200 μL catalytic reaction system. The raw materials and amounts used are shown in Table 5 below (for the blank control group, the yeast microsomal protein solution was replaced with the same volume of TEG Buffer solution):

[0195] Table 5. 200 μL in vitro enzyme catalytic reaction system

[0196]

[0197] The yeast microsomal protein solution was replaced with the same volume of TEG Buffer solution as a blank control group. A mixture containing 0.099 mg / mL loganic acid, 0.155 mg / mL swertiamarin, 0.0504 mg / mL swertiamarin, 0.500 mg / mL gentiopicroside, and 0.041 mg / mL disaccharide gentiopicroside was prepared in methanol as a compound standard control group.

[0198] The steps of a catalytic reaction:

[0199] In the above catalytic reaction system, the materials were added in descending order of volume. After the addition was completed, the temperature of the reaction system was controlled at 28℃ and the rotation speed was controlled at 220 rpm for 20 h to obtain the catalytic reaction solutions of the corresponding experimental group and blank control group.

[0200] Take 200 μL of the above-obtained reaction solution and add 3 times the volume of glacial acetic acid (600 μL) to terminate the reaction. Blow with nitrogen for 3.5 h to evaporate the liquid to dryness. Add 300 μL of 70% methanol aqueous solution to reconstitute the solution. Shake to fully dissolve the sample. Centrifuge at 12000 rpm for 10 min and take the supernatant as the test solution.

[0201] The test solution was analyzed using UPLC-Q-TOF / MS (6530 Accurate-Mass Q-TOF liquid chromatography-mass spectrometry), and the results are as follows:

[0202] 1. When using loganic acid as a substrate:

[0203] After 20 hours of reaction, the retention times and mass spectrometry parameters of all reaction products in the loganic acid substrate reaction system are shown in Table 6 below:

[0204] Table 6. Retention times and mass spectrometry parameters of reaction products in the loganic acid group

[0205]

[0206] The peak areas of the chromatographic peaks obtained by UPLC-Q-TOF / MS detection were manually integrated and calculated. The results are as follows: Figure 10 As shown, from Figure 10 As can be seen, the content of loganic acid decreased, and the consumption of loganic acid was approximately 6.82%.

[0207] When using UPLC-Q-TOF / MS for detection, the BPC chromatograms (base peak chromatograms) of the experimental group (microsomal protein solution + loganic acid), the compound standard control group, and the blank control group (TEG buffer solution + loganic acid) extracted at the same time interval are shown below. Figure 11 The first-order mass spectrum of the experimental group is as follows: Figure 12 As shown, from Figure 12 The first-order mass spectrum information shows that the mass-to-charge ratio of swertiamarin is 403.1251, and the deviation of the product from the swertiamarin in the standard control group is 8.93 ppm.

[0208] Figure 11 , 12 The combination confirmed that when loganic acid was used as a substrate, it contained cleaved loganin synthase expressed by recombinant yeast WAT11, and successfully achieved the in vitro biocatalytic production of swertiamarin from loganic acid.

[0209] The BPC (baseline peak) chromatograms of the experimental group (microsomal protein solution + loganic acid) and the blank control group (TEG buffer solution + loganic acid) extracted at the same time period are shown below. Figure 13 The first-order mass spectrum of the experimental group is shown in Figure 14. Figure 14 The mass spectrum information shows that the mass-to-charge ratio of gentiopicrin is 401.1048, and the deviation of the product from the gentiopicrin in the standard control group is 7.23 ppm.

[0210] Figure 13 , 14 The combination confirmed that when loganic acid was used as a substrate, it contained cleaved loganin synthase produced by recombinant yeast WAT11, and successfully achieved the in vitro biocatalytic production of gentiopicroside from loganic acid.

[0211] The BPC (base peak) chromatograms, i.e., the base peak chromatograms, of the experimental group (microsomal protein solution + loganic acid) and the blank control group (TEG buffer solution + loganic acid) are shown below. This indicates the predicted base peak chromatogram of the cleaved loganic acid. Figure 15 As shown;

[0212] The first-order mass spectrum of the experimental group is shown in Figure 16. Based on the information displayed by the first-order mass spectrum and combined with the literature, Xiong Bo, Sang Jidongzhi, Ni Lianghong, et al. Analysis of chemical components of Tibetan medicine Gentiana macrophylla based on UPLC-ESI-Q-TOF-MS / MS technology [J]. Northwest Pharmaceutical Journal, 2023, 38(04):1-8, the estimated mass-to-charge ratio of secoiral loganic acid is 373.1128. Since there is no secoiral loganic acid reference standard, its deviation from the theoretical value is 3.22.

[0213] pass Figure 15 , 16 Based on the reference (Xiong Bo, Sang Jidongzhi, Ni Lianghong, Xia Yun. Analysis of chemical constituents of Tibetan medicine Gentiana macrophylla based on UPLC-ESI-Q-TOF-MS / MS technology [J]. Northwest Pharmaceutical Journal, 2023, 38(04): 1-8.), three fragments with high abundance in the secondary mass spectrometry information were listed, and the chemical structure of the fragments was inferred. It was inferred that when loganic acid was used as a substrate, the cleistoside synthase produced by recombinant yeast WAT11 successfully achieved the in vitro biocatalytic production of cleistoside from loganic acid.

[0214] In summary, recombinant bacteria containing recombinant plasmids encoding the gene encoding schizologin synthase, which was cloned and isolated from Gentiana macrophylla, such as recombinant Agrobacterium GV3101 and recombinant yeast WAT11, can successfully express schizologin synthase. Moreover, the expressed schizologin synthase can achieve biocatalytic reaction of loganic acid to produce swertiamarin, gentiopicrin, or schizologin.

[0215] The above are all preferred embodiments of this application, and are not intended to limit the scope of protection of this application. Any equivalent modifications made in accordance with this application should be covered within the scope of protection of this application.

Claims

1. A gene encoding cleaved loganin synthase, cloned and isolated from Gentiana macrophylla, characterized in that, The gene sequence is shown in SEQ ID NO.

01.

2. A cleocyclic loganin synthase, characterized in that, The amino acid sequence of the cleaved loganin synthase is shown in SEQ ID NO.2, and it is encoded by the gene sequence shown in SEQ ID NO:

01.

3. A primer pair for cloning and isolating a gene encoding schizologonin synthase from Gentiana macrophylla, characterized in that, The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

4.

4. A recombinant plasmid, characterized in that... It contains the gene encoding cleavage-ring strychnoside synthase, which was cloned and isolated from Gentiana macrophylla as described in claim 1.

5. The recombinant plasmid as described in claim 4, characterized in that... The recombinant plasmids are pHB-GcSLS, pESC-GcSLS, or pET-GcSLS.

6. A homologous arm primer pair for preparing the recombinant plasmid as described in claim 5, characterized in that: When the recombinant plasmid is pHB-GcSLS, the nucleotide sequence of the forward primer pHB-GcSLS F in the homologous arm primer pair is shown in SEQ ID NO:05, and the length of the homologous arm sequence from the 5' end to the 3' end is 20 bp; the nucleotide sequence of the reverse primer pHB-GcSLS R is shown in SEQ ID NO:06, and the length of the homologous arm sequence from the 5' end to the 3' end is 20 bp; When the recombinant plasmid is pESC-GcSLS, the nucleotide sequence of the forward primer pESC-GcSLS F in the homologous arm primer pair is shown in SEQ ID NO:07, with the length of the homologous arm sequence from the 5' end to the 3' end being 20 bp, and the nucleotide sequence of the reverse primer pESC-GcSLSR is shown in SEQ ID NO:08, with the length of the homologous arm sequence from the 5' end to the 3' end being 20 bp; When the recombinant plasmid is pET-GcSLS, the nucleotide sequence of the forward primer pET-GcSLS F in the homologous arm primer pair is shown in SEQ ID NO:09, with a length of 15 bp from the 5' end to the 3' end homologous arm sequence. The nucleotide sequence of the reverse primer pET-GcSLSR is shown in SEQ ID NO:10, with a length of 17 bp from the 5' end to the 3' end homologous arm sequence.

7. A recombinant bacterium, characterized in that, The recombinant bacteria contain the recombinant plasmid as described in claim 4.

8. The recombinant bacteria as described in claim 7, characterized in that, When the recombinant plasmid is pHB-GcSLS, the recombinant bacteria are recombinant Escherichia coli TOP10 or recombinant Agrobacterium GV3101; when the recombinant plasmid is pESC-GcSLS, the recombinant bacteria are recombinant yeast WAT11; when the recombinant plasmid is pET-GcSLS, the recombinant bacteria are recombinant Escherichia coli BL21.

9. The recombinant bacteria as described in claim 7 is used to express and produce schizolognusin synthase.

10. The application of the schizologan synthase as described in claim 2 in catalyzing the reaction of loganic acid to generate schizologous cyclohexene terpenoids; The recombinant yeast WAT11 was used to produce and express schizologin synthase, which catalyzes the reaction of loganic acid to generate swertiamarin, gentiopicrin, or schizologin. The recombinant Agrobacterium GV3101 was used to produce and express schizologin synthase, which catalyzes the reaction of loganic acid in tobacco to generate gentiopicrin.

Images