Protease-deficient large-volume engineering bacterium as well as construction method and application thereof
By modifying prokaryotic microorganisms into recombinant engineered bacteria that are deficient in endogenous proteolytic enzymes and have a larger volume, the problem of heterologous protein degradation caused by endogenous proteolytic enzymes in bacterial cells has been solved, achieving efficient and low-cost recombinant protein production.
Patent Information
- Application Number
- CN202511603583.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-01-09
AI Technical Summary
In traditional recombinant protein production technology, bacterial endogenous proteolytic enzymes cause the degradation of heterologous proteins, limiting expression levels. Furthermore, the small cell space increases the difficulty of biomass recovery, resulting in high process costs.
By using gene knockout/knockdown technology and morphological engineering, prokaryotic microorganisms were modified into recombinant engineered bacteria that were deficient in endogenous proteolytic enzymes and had a larger size. CRISPR-BE and CRISPR-AID base editors were used to introduce stop codons into the prokaryotic microbial genome, insert SsrA degradation tags and overexpress cell division-related genes, and optimize the expression system.
It significantly improved the expression level of recombinant proteins and cell volume, increased bacterial volume by more than 5 times, increased single-cell protein content by more than 30%, reduced production costs, and simplified the biomass recycling process.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial strain modification. More specifically, this invention relates to a method for microbial production of recombinant proteins or other intracellular products. Background Technology
[0002] With global population growth and rapid economic development, human demand for protein resources is increasing daily. Traditional protein sources (such as soybeans and fishmeal) face problems such as limited resources, high production costs, and significant environmental impact, making it difficult to meet the growing demand. Therefore, developing novel and sustainable protein production pathways has become a current research hotspot. Recombinant protein production technology, as an efficient and controllable protein production method, is gradually becoming an important direction for protein resource development due to its advantages such as short production cycle, low cost, and scalability.
[0003] Recombinant proteins are produced by introducing the gene for a recombinant protein into a host cell using genetic engineering techniques, and then utilizing the host cell's expression system. Compared to traditional protein production methods, recombinant protein production technology offers advantages such as high expression efficiency, low production cost, and ease of scaling up, and has been widely applied in pharmaceuticals, food, and feed industries. Particularly in the field of feed protein, recombinant proteins have enormous application potential, effectively alleviating the global shortage of feed protein and promoting the sustainable development of animal husbandry.
[0004] The production technology of recombinant proteins mainly relies on genetic engineering and fermentation engineering. In recent years, with the rapid development of molecular biology and synthetic biology, the production efficiency and product quality of recombinant proteins have been significantly improved. Domestic and international scholars have made important progress in expression system optimization, fermentation process improvement, and protein purification technology.
[0005] In terms of fermentation technology, the application of novel fermentation technologies such as high-density fermentation and continuous fermentation has significantly improved the production efficiency of recombinant proteins. Furthermore, using industrial and agricultural waste (such as straw and wastewater) as fermentation substrates not only reduces production costs but also achieves resource recycling, aligning with the concept of sustainable development. The application of novel separation technologies (such as affinity chromatography and ion exchange chromatography) has significantly improved the purity and functionality of recombinant proteins. In addition, by combining proteomics and metabolomics technologies, researchers can better understand the regulatory mechanisms of protein synthesis, thereby further optimizing the production process.
[0006] In terms of expression systems, bacteria, compared to microorganisms such as fungi and yeasts, exhibit faster growth rates and higher protein yields, making them promising candidates for application. Escherichia coli, Bacillus subtilis, and lactic acid bacteria are commonly used bacterial hosts, possessing advantages such as clear genetic backgrounds, rapid growth, and high expression efficiency. However, bacterial cells contain endogenous proteolytic enzymes, which can be triggered by unstable or heavily expressed heterologous proteins (especially those with exposed hydrophobic residues), limiting the expression level of heterologous proteins. Furthermore, their limited space significantly increases the difficulty of biomass recovery, often necessitating multi-stage separation processes (such as flocculation enrichment and high-speed centrifugation), thereby increasing the economic cost of the process. Summary of the Invention
[0007] To address the aforementioned problems, the inventors conducted in-depth research and utilized gene knockout / knockdown technology and morphological engineering to modify the prokaryotic microbial chassis into larger Proteobacteria lacking endogenous proteolytic enzymes by regulating endogenous proteolytic enzymes and morphology-related genes. This modified Proteobacteria were then used for the production of recombinant proteins, thus completing this invention.
[0008] Therefore, this invention provides a method for constructing recombinant prokaryotic microorganisms, the method comprising knocking down or eliminating intracellular proteases, wherein the intracellular proteases are selected from ATP-dependent serine protease genes. lon、 Serine endopeptidase gene htrA Or a combination thereof.
[0009] In one specific embodiment, the method utilizes gene editing technology (e.g., CRISPR-BE base editor, using deaminase) in the genome of prokaryotic microorganisms. lon and htrA By introducing stop codons (TAA, TAG, TGA) into one or more gene expression cassettes, recombinant engineered bacteria deficient in endogenous proteolytic enzymes can be obtained.
[0010] In one specific embodiment, the method utilizes gene editing technology (e.g., CRISPR-AID base editor) to knock down proteolytic enzymes (including but not limited to...) lon and htrA ).
[0011] In one specific embodiment, the method further includes inserting an SsrA degradation tag into the skeletal protein gene of the prokaryotic microorganism genome. mreBCD and cell division loop synthesis genes ftsABEIQWXYZ Before one or more stop codons, and / or overexpressing cell division repressor protein genes in the prokaryotic microorganisms. sulA and cell division loop localization genes minCDE One or more of them.
[0012] In one specific embodiment, the SsrA degradation tag is an endogenous or exogenous wild-type SsrA degradation tag or a mutant thereof from the prokaryotic microorganism, preferably selected from the SsrA degradation tags with amino acid sequences as shown in any one of SEQ ID Nos: 1-26, more preferably from SsrA degradation tags derived from Halomonas, and most preferably SsrA16 or SsrA21. The SsrA degradation tags shown in SEQ ID Nos: 1-26 in this invention correspond to the SsrA degradation tags shown in SEQ ID Nos: 1-26 in CN120700080A. This prior application discloses that the SsrA1 to SsrA21 of this invention can be inserted at the C-terminus of the protein to be degraded, thereby inducing the protein to degrade spontaneously.
[0013]
[0014] In one specific embodiment, the SsrA degradation tag is inserted mreB and / or ftsZ The stop codon of a gene is preferably the one immediately adjacent to the stop codon.
[0015] In one specific embodiment, overexpression is performed in the prokaryotic microorganism. sulA Genes and / or minCD Gene.
[0016] In one specific embodiment, the prokaryotic microorganism was further knocked out of its endogenous state. sspB The gene (Stringentstarvation protein B gene, adapter protein gene) or not knocked out sspB Gene.
[0017] In one specific embodiment, the method includes: (1) In prokaryotic microorganisms, gene editing technologies such as CRISPR / BE base editing are used to complete the C-to-T base change through deaminases, thereby altering the prokaryotic microbial genome. lon and HtrA (1) Introduce stop codons (TAA, TAG, TGA) into one or more gene expression cassettes to obtain endogenous proteolytic enzyme-deficient recombinant engineered bacteria; (2) Insert the SsrA degradation tag into the genome of the protease-deficient recombinant engineered bacteria. mreBCD (microbial skeletal protein encoding genes) and ftsABEIQWXYZ Before one or more stop codons in (cell division ring synthesis genes), and / or by overexpression of cell division repressor genes in said prokaryotic microorganisms. sulA and minCDE (2) Obtain one or more of the genes to obtain recombinant engineered bacteria; (3) Overexpress the recombinant protein in the recombinant engineered bacteria obtained in step (1) or (2); (4) Recover and / or purify the recombinant protein obtained in step (3) or a single-cell protein containing it.
[0018] In one specific embodiment, the prokaryotic microorganism is selected from the genus *Halomonas* (…). Halomonas ), Pseudomonas spp. Pseudomonas ), Escherichia coli ( Escherishia coli ), Corynebacterium glutamicum ( Corynebacterium glutamicum ), Roche's et al. Ralstonia eutropha or Cupriviadus necator Aeromonas spp. Aeromonas ), Bacillus spp. Bacilllus ), sodium-dependent Vibrio ( Vibrio natriegens ) and Alcaligenes megaterium ( Alcaligenes latus The preferred strain is *Haloxylon ammodendron*, and even more preferably, the *Haloxylon ammodendron* is... Halomonas bluephagenesis , Halomonas aydingkolgenesis、Halomonas campaniensis , Halomonas lutescens , Halomonas hydrothermalis , Halomonas sp. KM1、 Halomonas elongata and Halomonas smyrnensis Even better Halomonas bluephagenesis TD1.0 Halomonas bluephagenesis TD01 (CGMCC No. 4353) Halomonas aydingkolgenesis M1 (CGMCC No. 19880) and Halomonas campaniensis LS21 (CGMCC No. 6593).
[0019] In one specific embodiment, the prokaryotic microorganism is *Haliopsis* (Haloxylon ammodendron). Halomonas Preferred Halomonas bluephagenesis More preferably Halomonas bluephagenesis TD1.0, and the ATP-dependent serine protease gene was knocked down or eliminated. lon and htrA One or two. Halomonas bluephagenesis In TD1.0, lon include lon-1 (SEQ ID NO: 39) and lon-2 (SEQ ID NO: 40), therefore the method includes being knocked down or eliminated. lon-1 (SEQ ID NO: 39) lon-2 (SEQ ID NO: 40) and htrA One, two, or three of (SEQ ID NO: 41), more preferably knocked down or eliminated. lon-1 and lon-2 Both or lon-1 , lon-2 and htrA The three.
[0020] In one specific embodiment, the prokaryotic microorganism is a sodium-dependent Vibrio (NaHCO3). Vibrio natriegens ), and was knocked down or eliminated. lon (SEQ ID NO: 45).
[0021] In one specific embodiment, the prokaryotic microorganism is *Rhodotorula gravidarum* (…). Ralstonia eutropha ), and was knocked down or eliminated. lon (SEQ ID NO: 47).
[0022] In one specific embodiment, the prokaryotic microorganism has its endogenous PHA synthase gene knocked down or eliminated. phaC .
[0023] In one specific embodiment, the method further includes inserting an SsrA degradation tag SsrA16 or SsrA21 into the *Halomonas*. mreB Gene or ftsZ Before the stop codon of a gene.
[0024] In one specific embodiment, the sodium-dependent Vibrio also overexpresses sulA Gene.
[0025] In one specific embodiment, the *Rochete* fungus is also overexpressed. minCD Gene.
[0026] In one specific implementation, compared to not performing the modification in step (2) (i.e., not inserting the SsrA degradation tag), mreBCD and ftsABEIQWXYZ One or more stop codons in the gene precede it, and / or the cell division repressor gene is not overexpressed in the prokaryotic microbe. sulA and minCDE The corresponding prokaryotic microorganisms (one or more of the genes), wherein the recombinant engineered bacterial cell volume is increased by more than 3 times, preferably more than 5 times.
[0027] Another aspect of the present invention provides a recombinant prokaryotic microorganism constructed by the method described above.
[0028] Another aspect of the present invention provides a method for producing recombinant proteins or single-cell proteins, the method comprising: 1) Overexpressing the recombinant protein in a recombinant prokaryotic microorganism constructed by the method described above in this invention; and 2) Recover and / or purify the recombinant protein obtained in step 1) or the single-cell protein containing it.
[0029] In one specific embodiment, the overexpression is performed under promoter control, wherein the promoter is an inductive promoter or a constitutive promoter, preferably selected from the Mmp1 promoter. luc promoter, lux promoter, lac promoter, trp promoter, tac promoter, araBAD promoter, fadBA promoter, cin promoter, cym promoter, sal promoter, van promoter, tet promoter, ttg promoter, phlf promoter, phaP The promoter, hypoxia-inducible promoter, bacterial quorum sensing-inducible promoter, temperature-sensitive promoter, pH-sensitive promoter, J23119 promoter, or combinations thereof, preferably the constitutive promoter is selected from the wild-type porin gene P. porin The promoter or a mutant thereof, wherein the mutant is selected from P porin1 P porin3 P porin42 P porin51 P porin58 P porin68 P porin140 P porin141 P porin183 P porin192 P porin194 P porin203 P porin221 P porin226 P porin259 and P porin278 These P porin The promoter and its mutants are disclosed, for example, in CN117143793B.
[0030] In one specific implementation, the overexpression is performed on a plasmid or genome.
[0031] In one specific embodiment, the endogenous plasmid has been knocked out in the recombinant prokaryotic microorganism.
[0032] In one specific embodiment, the recombinant prokaryotic microorganism is a recombinant Halomonas bacterium, and / or the expression plasmid is a pSEVA series plasmid (preferably pSEVA321 or pSEVA341), and / or the expression plasmid is a toxin-antitoxin system plasmid, more preferably the toxin-antitoxin system plasmid is pHbPBC (Ren K, Zhao YQ, Chen GQ, et al. Construction of a Stable Expression System Based on the Endogenous hbpB / hbpCToxin-Antitoxin System of Halomonas bluephagenesis). ACS Synth. Biol 2023, 13 (1): 61-67).
[0033] In one specific implementation, the single-cell protein of the recombinant prokaryotic microorganism accounts for more than 80% of the cell dry weight.
[0034] In one specific implementation, the recombinant prokaryotic microorganism has a single-cell protein content increased by more than 5-30% and / or a recombinant protein yield increased by more than 50% compared to the corresponding prokaryotic microorganism that has not undergone the modifications in steps (1) to (3).
[0035] In one specific embodiment, the recombinant protein is selected from: 1) Industrial enzymes, such as amylase, lipase, and glucosidase; 2) Functional proteins: feed proteins, agricultural insecticide proteins, cytokines, therapeutic drug proteins, marker proteins; signaling pathway-related proteins, such as kinases and phosphatases; 3) Biomaterial proteins, such as collagen and silk fibroin; and 4) Food proteins, such as lactoferrin (LTF), α-lactalbumin (α-LA), monellin, and transglutaminase (MTG).
[0036] In a preferred embodiment, the prokaryotic microorganism is *Haliotis diversicolor* (preferably). Halomonas bluephagenesis TD1.0), inserting SsrA21 into the *Haloxymonas*. mreB Gene or ftsZ The target recombinant protein is overexpressed before (preferably immediately adjacent to) the stop codon of the gene, either via plasmid or on the genome. Preferably, the overexpression is performed using an inducible or constitutive promoter (Pporin promoter or a mutant thereof). Exemplary target recombinant proteins include LTF, α-LA, or Monellin.
[0037] In a preferred embodiment, the prokaryotic microorganism is *Haliotis diversicolor* (preferably). Halomonas bluephagenesis TD1.0), was knocked down or removed. lon-1 (SEQ ID NO: 39) lon-2 (SEQ ID NO:40) and htrA One, two, or three of (SEQ ID NO: 41), more preferably knocked down or eliminated. lon-1 and lon-2 Both or lon-1 , lon-2 and htrA All three; and / or inserting the coding sequence of SsrA21 (SEQ ID NO: 21) into the genome. mreB Before the stop codon of the gene; and / or knock down or remove the PHA synthase gene. phaC ; and / or express recombinant proteins, such as LTF, α-LA, or Monellin, on a plasmid (preferably pSEVA321) or genome via a constitutive or inducible promoter (preferably Mmp1). In a more preferred embodiment, in addition to the above direct editing mreB Alternatively, endogenous [factors] can be eliminated first. sspB Genes (e.g., halometa) Halomonas bluephagenesis of sspB The gene nucleotide sequence is as shown in SEQ ID NO:49), and then the SspB protein (e.g., from Halomonas) is simultaneously overexpressed on a plasmid (e.g., via an inducible promoter). Halomonas bluephagenesis The SspB protein amino acid sequence (such as SEQ ID NO:50) and the target recombinant protein can achieve late-stage alterations in cell morphology, thereby reducing the impact of deformation on growth. In a more preferred embodiment, in the above... mreB Gene-edited Halomonas Halomonas bluephagenesis Overexpression with PhaP1 promoter in strains minCD Genes can be used to further extend the size of bacteria, resulting in bacteria with even larger volumes.
[0038] In a preferred embodiment, the prokaryotic microorganism is a sodium-dependent Vibrio (NaHCO3). Vibrio natriegens ), were knocked down or eliminated lon (SEQ ID NO: 45) and htrA One or two of them; and / or overexpression via a constitutive promoter (preferably J23119). sulA Gene; and / or via constitutive or inducible promoters (preferably P) phap1Recombinant proteins, such as LTF, α-LA, Monellin, or PhaP proteins, are expressed on plasmids (preferably pHbPBC) or on the genome. PHA surface-binding protein PhaP is an amphiphilic protein that attaches to the surface of PHA particles.
[0039] In a preferred embodiment, the prokaryotic microorganism is *Rhodotorula gravidarum* (or *Rhodotorula gravidarum*). Ralstonia eutropha Also called Cupriviadus necator ), were knocked down or eliminated lon (SEQ ID NO: 47); and / or via a constitutive promoter (preferably P) tac Overexpression minCD Gene; and / or via constitutive or inducible promoters (preferably P) phap1 Recombinant proteins, such as transglutaminase (MTG) and lipase, are expressed on plasmids (preferably pHbPBC) or on the genome.
[0040] The characteristics of the prokaryotic microorganism, SsrA degradation tag, promoter used for overexpression, and recombinant protein described in the above-mentioned method for producing recombinant proteins also apply to the recombinant engineered bacteria.
[0041] The main subject of this study—Halomonas. H. bluephagenesis TD 1.0, a "rising star" in PHA research, is a non-model strain. Research on its biosynthetic metabolism is still insufficient, and its protease system is entirely lacking. Whether knocking out its proteolytic enzymes would affect its normal growth and whether it could efficiently produce recombinant proteins is unpredictable. The inventors, through bioinformatics methods, have identified *Haloxylon ammodendron* and other... lon and htrA By using genetic information, gene editing was conducted to obtain proteolytic enzyme-deficient recombinant strains that exhibit uninhibited growth and high production (1-2 times that of the wild type) of recombinant proteins. Furthermore, unexpectedly, these strains exhibit long filaments, 1.5-2 times longer than the wild type, and show superior growth performance at low temperatures of 16-25℃, making them ideal for the large-scale expression of recombinant proteins. For example, Example 1 and Appendix... Figure 4 In the middle, protease-deficient strains Halomonas bluephagenesis The dry weight (CDW) of WWZ60 cells after protein expression induction at 16℃ was higher than that of wild-type cells.
[0042] Furthermore, studies have shown that MreB and other skeletal proteins are essential proteins for bacteria, and that directly knocking out the protein encoding MreB in *E. coli* can help. mreBGenes can significantly affect bacterial growth, leading to a substantial reduction in bacterial dry weight (Jiang, X.-R., et al., Engineering the bacterial shapes for enhanced inclusion bodies accumulation. Metabolic Engineering, 2015. 29:227-237). In this invention, the SsrA degradation tag is inserted into the genome of prokaryotic microorganisms... mreBCD and ftsABEIQWXYZ Before one or more stop codons in the gene, and / or overexpressed in the prokaryotic microbe. sulA and minCDE One or more genes were used to obtain recombinant engineered bacteria, and the target recombinant protein was overexpressed in these bacteria. The target recombinant protein or single-cell protein containing it was then recovered and / or purified. Recombinant engineered bacteria constructed using the above method in species such as *Haloxylon ammodendron* can increase bacterial volume (by more than 5 times, up to 9 times) while ensuring that bacterial dry weight is not affected or is not significantly affected. They can be used for high-yield production of recombinant proteins (1.5-2 times that of the wild type), and the single-cell protein content is more than 30% higher than that of the wild type. Furthermore, the morphology of the recombinant engineered bacteria of the present invention changes from rod-shaped to spherical, making strain isolation easier. In addition, the proportion of single-cell protein to cell dry weight in the engineered bacteria of the present invention can reach more than 80%, facilitating cell autolysis and downstream processing of the recombinant protein. Attached Figure Description
[0044] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, wherein: Figure 1 Morphological changes of Halomonas control bacteria and protease-deficient recombinant bacteria.
[0045] Figure 2 Length statistics of Halomonas control bacteria and protease-deficient recombinant bacteria.
[0046] Figure 3 Growth curves of Halomonas control bacteria and protease-deficient recombinant bacteria.
[0047] Figure 4 Mass spectrometry results of dry weight, LTF percentage of total protein, and LTF protein expression of Halomonas control bacteria and protease-deficient recombinant bacteria in 60 LB medium.
[0048] Figure 5SDS-page and Western blot results of LTF protein expression in control and protease-deficient recombinant strains of Halomonas in 60 LB medium.
[0049] Figure 6 Western blot results of α-LA protein expression in control strains of *Saccharomyces cerevisiae* and protease-deficient recombinant strains in 60 LB medium, as well as the proportion of α-LA in total protein and cell dry weight.
[0050] Figure 7 Optimization of fermentation conditions for Halomonas control strain and protease-deficient large-particle recombinant strain.
[0051] Figure 8 Transmission electron microscopy results of PHA and protein production by control strains of *Hydromonas hydrophila* and protease-deficient recombinant strains in 60 mm medium.
[0052] Figure 9 Growth curves of Halomonas control bacteria and protease-deficient recombinant bacteria in different culture media.
[0053] Figure 10 Expression of monellin protein in recombinant bacteria WWZ60 and WWZ61 in 60MM medium.
[0054] Figure 11 Expression of LTF protein in recombinant bacteria TD1.0, WWZ61, WWZ601 and WWZ602 in 60MM medium.
[0055] Figure 12 Expression of LTF protein in recombinant bacteria WWZ61 and WWZ602 in 60MM medium.
[0056] Figure 13 The production of recombinant proteins and single-cell proteins was carried out using protease-deficient recombinant strains in a 7-liter fermenter.
[0057] Figure 14 The production of recombinant proteins and single-cell proteins was carried out using protease-deficient recombinant strains in a 45-liter fermenter.
[0058] Figure 15 Microscopic results of sodium-dependent Vibrio protease-deficient recombinant bacteria and morphologically engineered recombinant bacteria in 30 mm medium.
[0059] Figure 16 PhaP production of sodium-dependent Vibrio protease-deficient recombinant strains and morphologically engineered recombinant strains in 30 mm medium.
[0060] Figure 17 Microscopic results of protease-deficient recombinant bacteria and morphologically engineered recombinant bacteria of Rochefortella on 10 mm medium.
[0061] Figure 18 MTG and Lipase production in protease-deficient recombinant strains and morphologically engineered recombinant strains of Rochechoi on 10 mm medium.
[0062] Figure 19 Electron microscopy results of recombinant bacteria that underwent morphological changes in the late stage of 60 mm medium.
[0063] Figure 20 Electron microscopy results of recombinant bacteria that combine two morphology-related genes (mreB and minCD).
[0064] Sequence List Description (Example sequences and sequences used in examples) SEQ ID NO: 1 – Halomonas SsrA1 SEQ ID NO: 2 – Halomonas SsrA2 SEQ ID NO: 3 – Halomonas SsrA3 SEQ ID NO: 4 – Halomonas SsrA4 SEQ ID NO: 5 – Halomonas SsrA5 SEQ ID NO: 6 – Halomonas SsrA6 SEQ ID NO: 7 – Halomonas SsrA7 SEQ ID NO: 8 – Halomonas SsrA8 SEQ ID NO: 9 – Halomonas SsrA9 SEQ ID NO: 10 – Halomonas SsrA10 SEQ ID NO: 11 – Halomonas SsrA11 SEQ ID NO: 12 – Halomonas SsrA12 SEQ ID NO: 13 – Halomonas SsrA13 SEQ ID NO: 14 – Halomonas SsrA14 SEQ ID NO: 15 – Halomonas SsrA15 SEQ ID NO: 16 – Halomonas SsrA16 SEQ ID NO: 17 – Halomonas SsrA17 SEQ ID NO: 18 – Halomonas SsrA18 SEQ ID NO: 19 – Halomonas SsrA19 SEQ ID NO: 20 – Halomonas SsrA20 SEQ ID NO: 21 – Halomonas SsrA21 SEQ ID NO: 22 – Wild-type SsrA tag protein in Escherichia coli SEQ ID NO: 23 – Wild-type SsrA tag protein in *Pseudomonas putida* SEQ ID NO: 24 – Wild-type SsrA tag protein in *Pseudomonas entomopathogens* SEQ ID NO: 25 – SsrA tag protein of wild-type *Rhodotrophozoa roximatei* or *Hookobacterium clavatum*. SEQ ID NO: 26 – Wild-type SsrA tag protein in Bacillus megaterium SEQ ID NO: 27 – Nucleotide coding sequence of lactoferrin SEQ ID NO: 28 – Amino acid sequence of lactoferrin SEQ ID NO: 29 – Nucleotide coding sequence of α-lactalbumin SEQ ID NO: 30 – Amino acid sequence of α-lactalbumin SEQ ID NO: 31 – Nucleotide coding sequence of Monellin SEQ ID NO: 32 – Amino acid sequence of Monellin SEQ ID NO: 33 – Nucleotide coding sequence of PHA particle-binding protein (PhaP) SEQ ID NO: 34 – Amino acid sequence of PHA particle-binding protein (PhaP) SEQ ID NO: 35 – Nucleotide coding sequence of transglutaminase (MTG) SEQ ID NO: 36 – Amino acid sequence of transglutaminase (MTG) SEQ ID NO: 37 – Nucleotide coding sequence of lipase SEQ ID NO: 38 – Amino acid sequence of lipase SEQ ID NO: 39 – Halomonas lon-1 The nucleotide coding sequence of a gene SEQ ID NO: 40 – Halomonas lon-2 The nucleotide coding sequence of a gene SEQ ID NO: 41 – Halomonas htrA The nucleotide coding sequence of a gene SEQ ID NO: 42 – for knockout lon-1 sgRNA module sequences involved in the gene SEQ ID NO: 43 – for knockout lon-2 sgRNA module sequences involved in the gene SEQ ID NO: 44 – for knockout htrA sgRNA module sequences involved in the gene SEQ ID NO: 45 – Sodium-dependent Vibrio lon-1 The nucleotide coding sequence of a gene SEQ ID NO: 46 – Used to knock out sodium-dependent Vibrio. lon-1 sgRNA module sequences involved in the gene SEQ ID NO: 47 – Rochefoucauld lon-1 The nucleotide coding sequence of a gene SEQ ID NO: 48 – Used to knock out Roche's fungi lon-1 sgRNA module sequences involved in the gene SEQ ID NO: 49 – sspB Gene nucleotide sequence SEQ ID NO: 50 – SspB protein amino acid sequence SEQ ID NO: 51 – J23119 promoter sequence SEQ ID NO: 52 – sulA nucleotide sequence SEQ ID NO: 53 – sulA amino acid sequence SEQ ID NO: 54 – P Mmp1 promoter sequence SEQ ID NO: 55 – P phaP1 promoter sequence SEQ ID NO: 56 – MinC nucleotide sequence SEQ ID NO: 57 – MinC amino acid sequence SEQ ID NO: 58 – MinD nucleotide sequence SEQ ID NO: 59 – MinD amino acid sequence SEQ ID NO: 60 – Corynebacterium glutamicum ATCC13032 lon amino acid sequence SEQ ID NO: 61 – For knocking out Corynebacterium glutamicum lon sgRNA module sequences involved in the gene Regarding the coding sequences of SsrA16 and SsrA21 in this article, minCD nucleotide coding sequence and coding amino acid sequence, P phaP1 promoter sequence, P Mmp1 promoter, Halomonas bluephagenesis of mreBCD Gene sequence, ftsABEIQWXYZ Gene sequence, sulA and minCDE For sequence information, please refer to the applicant's previously filed patent CN120700080A. Detailed Implementation
[0066] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0067] Unless otherwise stated, the terms used herein have their general technical meanings as understood by those skilled in the art. For definitions and terms in this art, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).
[0068] In this invention, the singular articles “a” and “the” cover a plurality of indicators unless the context clearly indicates otherwise. All references cited herein are incorporated herein by reference in their entirety.
[0069] The term "comprising" or "including" as used in this invention is an open-ended description, encompassing all specified components or steps described, as well as other specified components or steps that do not substantially affect the meaning; when used to describe the sequence of a protein or nucleic acid, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still possess the activity described in this invention.
[0070] The term "and / or" as used in this invention encompasses all combinations of items connected by the term, and should be considered as if each combination had been individually listed herein. For example, "A and / or B" includes "A", "A and B", and "B". As another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".
[0071] In this invention, the term "halophilic bacteria" ( Halophiles "Halophytes" refers to a type of archaea that live in high-salinity environments. In a preferred embodiment of the present invention, the halophilic bacteria include, but are not limited to, the genus *Halomonas*. Halomonas Preferably, the *Halomonas* genus includes, but is not limited to, those mentioned above. Halomonas bluephagenesis , Halomonas aydingkolgenesis, Halomonas campaniensis , Halomonas lutescens , Halomonas hydrothermalis , Halomonas sp. KM1、 Halomonas elongata and Halomonas smyrnensis Even better Halomonas bluephagenesis TD1.0 ( Halomonas bluephagenesis TD1.0 is in Halomonas bluephagenesis Inserted on the basis of TD01 lacI For strains obtained by gene (to facilitate IPTG-induced expression of the target gene), see Zhao, H. et al. (2017) Novel T7-1ike expression systems used for Halomonas. Metab Eng 39, 128-140), Halomonas bluephagenesis TD01 (CGMCC No. 4353) Halomonas aydingkolgenesis M1 (CGMCC No. 19880) Halomonas campaniensisLS21 (CGMCC No. 6593) (All of the above strains have been deposited at the China General Microbiological Culture Collection Center (CGMCC) under the Budapest Treaty and have been disclosed in previous patent applications. For example, CGMCC No. 4353 has been disclosed in CN102120973A, CGMCC No. 19880 has been disclosed in CN111593006A, and CGMCC No. 6593 has been disclosed in CN102925382A).
[0072] In this invention, the term "expression" can refer to "overexpression," which is defined as a gene expression level higher than the natural state, possibly achieved through increased transcription levels (producing more messenger mRNA) or improved translation efficiency (generating more functional proteins). In one specific embodiment, preferably, the expression or overexpression of the exogenous gene can be achieved by inserting the target gene into a non-translation site in the genome, or by plasmid overexpression. Preferably, gene insertion is performed using the CRISPR / Cas9 method. Preferably, plasmid overexpression is introduced into the chassis strain via electroporation or conjugation transformation. When the host is *Halomonas*, the plasmid vector can be a pSEVA series vector (Martinez-Garcia E...). et al. ,SEVA 2.0: an update of the Standard European Vector Architecture for de- / re-construction ofbacterial functionalities. Nucleic Acids Res 2015, 43 (Database issue): D1183-1189.) or toxin-antitoxin plasmid pHbPBC vector (Ren K, Zhao YQ, Chen GQ, et al. Construction of a Stable Expression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System of Halomonas bluephagenesis). ACS Synth. Biol 2023, 13 (1): 61-67.
[0073] In this invention, the term "toxin-antitoxin system" (i.e., toxin-antitoxin, TA system) refers to a system that maintains plasmid stability through post-segregational killing (PSK). In a preferred embodiment, the recombinant microorganism of this invention contains a suitable toxin-antitoxin system / plasmid, thereby enabling the plasmid to be stably maintained naturally (i.e., in the absence of selective pressures such as antibiotics). Eight types of TA systems are known. hok / sok The system has been widely used in industrial fermentation to stabilize plasmid pMJR1750 (Lin et al. Engineering Microbiology 3 (2023) 100069). WO1999025870 discloses the plasmid pMUT2 containing the TA system, which is stably maintained in Escherichia coli. Chinese Patent Application No. 2023112420281, entitled "A recombinant plasmid expressing toxins and antitoxins, its construction method and application," discloses a TA system derived from halophilic microorganisms and a recombinant plasmid including the TA system, and discloses that the recombinant plasmid containing the TA system can be naturally and stably maintained in halophilic microorganisms, etc. Typical TA systems include the following gene families: ccdAB , , , , , and (Gerdes K Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes (Nucleic Acids Res., 2005, 33(3): 966-976). In one embodiment, the toxin-antitoxin is a TA system suitable for prokaryotic microorganisms. In one embodiment, the microorganism is a Gram-negative or Gram-positive bacterium.
[0074] Addressing the shortcomings of existing technologies, this invention utilizes a CRISPR-BE base editor (Zhang Y et al., Simultaneous multiplex genome loci editing of Halomonas bluephagenesis using an engineered CRISPR-guided base editor, Synth. Syst. Biotechnol., 2024, 9:S86-S93) to perform C-to-T base changes via deaminases in prokaryotic microbial genomes. and One or more gene expression cassettes were introduced with stop codons (TAA, TAG, TGA) to obtain recombinant engineered bacteria deficient in endogenous proteolytic enzymes. Next, by regulating morphology-related genes, the prokaryotic microbial chassis was modified into larger Proteobacteria, increasing in volume by at least 5 times. Furthermore, by adjusting and optimizing the culture medium composition, stable and high-yield recombinant proteins, such as lactoferrin (LTF), α-lactalbumin (LA), and monellin, were achieved, resulting in recombinant prokaryotic microbial chassis with higher single-cell protein yields. In one specific embodiment of the invention, *Halomonas* (*Haloxylon ammodendron*) was used. As a novel platform for the production of recombinant proteins and single-cell proteins, it uses open, continuous, and sterile bioreactors to express different types of recombinant proteins on a large scale, thereby further increasing the protein content.
[0075] In a first aspect, the present invention provides a method for enhancing the expression level of heterologous proteins, wherein proteolytic enzymes (including but not limited to) are knocked down using a CRISPR-AID base editor (Zhang Y et al., Simultaneous multiplex genome loci editing of Halomonas bluephagenesis using an engineered CRISPR-guided base editor, Synth. Syst. Biotechnol., 2024, 9: S86-S93). This creates a more stable environment for the expression of foreign proteins in cells, which is conducive to the accumulation of foreign proteins that are difficult to express or are poorly expressed and are easily degraded by the host.
[0076] Preferably, the method for increasing the expression level of heterologous proteins includes... Two genes and The expression cassettes of three genes are introduced with codons that terminate prematurely due to deaminase, enabling highly efficient one-time editing of multiple genes without double-strand breaks, thereby altering the internal environment during heterologous protein expression in cells.
[0077] In one specific embodiment of the present invention, *Haloxylon ammodendron* TD1.0 is used as the starting strain, and the strain is... The gene expression cassette utilizes deaminase to complete the C-to-T base change, introducing a premature termination codon, which increases the expression level of heterologous proteins by more than 50%.
[0078] A second aspect of the present invention provides a method for altering the volume of protease-deficient bacteria using morphological engineering, characterized in that the bacteria modulate morphology-related genes, including but not limited to... These processes change the cell morphology from small rods to large spheres, thereby increasing the cell volume to accommodate more intracellular proteins.
[0079] Preferably, the morphological regulation method involves adding SsrA series degradation tags after morphology-related genes (preferably before stop codons) to achieve the gradual degradation of cytoskeletal proteins such as MreB and FtsZ at different time points, thereby altering cell morphology and increasing cell volume. In microbial cells, with the assistance of the aptamer protein SspB, the target protein tagged with SsrA is recognized by the ClpXP complex protein and rapidly degraded.
[0080] In one specific embodiment of the present invention, recombinant bacteria are used. WWZ60 is the starting strain, and the analysis was conducted through the strain's genome. Add an SsrA degradation tag after the gene (preferably before the stop codon): the SsrA21 tag (tag sequence see SEQ ID NO: 21, which will degrade *Halomonas*). TD cells increased in volume ninefold.
[0081] In a third aspect, the present invention provides a variety of morphologically engineered protease-deficient recombinant bacteria, characterized in that, compared with the unmorphologically modified strains, the recombinant bacteria have a single-cell protein content increased by more than 30% and an intracellular and extracellular protein yield increased by more than 50%.
[0082] The recombinant bacteria mentioned include, but are not limited to, *Haloxylon* spp. spp), Escherichia coli ( ), Pseudomonas spp. spp.), Corynebacterium glutamicum ( ) and Roche's et al. or Cupriviator necator ) and corresponding derivative bacteria.
[0083] In a fourth aspect, the present invention provides a protease-deficient large-particle recombinant bacterium for producing recombinant proteins, wherein the recombinant bacterium expresses recombinant proteins derived from itself or other species, and the recombinant protein yield is increased by 5-50% or more compared with unmorphologically modified strains.
[0084] The protein expression method can be plasmid expression, expression after genome integration, etc.
[0085] The protein expression can be regulated by a promoter, including inducible expression and constitutive expression.
[0086] The promoters include constitutive promoters and / or inducible promoters.
[0087] The constitutive promoters mentioned above include, but are not limited to, those mentioned above. porin Promoters or their variants (e.g., reference: Shen R, Yin J, Ye JW, Xiang RJ, Ning ZY, Huang WZ, Chen GQ. Promoter Engineering for EnhancedP(3HB-co-4HB) Production by Halomonas bluephagenesis. ACS Synth Biol. 2018 Aug 17;7(8):1897-1906. doi: 10.1021 / acssynbio.8b00102. Epub 2018 Jul 31.PMID: 30024739. (as described in the journal), Sp6 promoter or variants thereof. porin promoters or their variants, for example porin , porin58 mutant porin42 mutant porin68 mutant porin140 mutant porin278 mutant porin183 mutant porin221 mutant porin203、 mutant porin3 One or more of the following.
[0088] The inducible promoters include, but are not limited to, those mentioned above. frm promoters or their variants luc promoters or their variants lac promoters or their variants trp promoters or their variants tac Promoters or variants thereof, phage promoters or variants thereof araBAD promoters or their variants fadBA promoter or its variants 、mmp promoter,cin promoters or their variants cym promoters or their variants sal promoters or their variants van promoters or their variants tet promoters or their variants ttg promoters or their variants phlf promoter or its variants, or phaP One or more of the promoter or its variants.
[0089] In one specific embodiment of the invention, a protease-deficient Halomonas strain is used to express the recombinant protein lactoferrin (LTF). This recombinant bacterium contains a sequence encoding LTF, and the genome of this recombinant bacterium... mreB The gene's stop codon is preceded by the degradation tag SsrA21.
[0090] Preferably, the lactoferrin (LTF) sequence is derived from bovine (but not limited to bovine) protein. Preferably, the α-lactalbumin (α-LA) sequence is derived from bovine (but not limited to bovine) protein.
[0091] Preferably, the lactoferrin nucleotide coding sequence and / or amino acid sequence comprises SEQ ID NO: 27 and / or SEQ ID NO: 28 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% homology with SEQ ID NO: 27 / SEQ ID NO: 28. The α-lactalbumin amino acid sequence comprises SEQ ID NO: 29 and / or SEQ ID NO: 30 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% homology with SEQ ID NO: 29 / SEQ ID NO: 30.
[0092] Preferably, the Monellin gene is derived from West African plants. Dioscureophylium cumminssi (but not limited to West African plants) Dioscureophylium cumminssi ).
[0093] Preferably, the nucleotide coding sequence and / or amino acid sequence of the sweet protein (Monellin) contains SEQ ID NO: 31 and / or SEQ ID NO: 32 or has more than 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% homology with SEQ ID NO: 31 / SEQ ID NO: 32.
[0094] Preferably, the PHA particle-binding protein (PhaP) gene is derived from *Halomonas*. Halomonas bluephagenesis (but not limited to Halomonas).
[0095] Preferably, the nucleotide coding sequence and / or amino acid sequence of the PHA particle-binding protein (PhaP) includes SEQ ID NO: 33 and / or SEQ ID NO: 34 or has more than 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% homology with SEQ ID NO: 33 / SEQ ID NO: 34.
[0096] Preferably, the transglutaminase (MTG) gene is derived from Bacillus subtilis. Bacillus subtilis .
[0097] Preferably, the nucleotide coding sequence and / or amino acid sequence of the said transglutaminase (MTG) contains SEQ ID NO: 35 and / or SEQ ID NO: 36 or has more than 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% homology with SEQ ID NO: 35 / SEQ ID NO: 36.
[0098] Preferably, the lipase gene is derived from Bacillus licheniformis. Bacillus licheniformis (but not limited to Bacillus licheniformis) Bacillus licheniformis ).
[0099] Preferably, the nucleotide coding sequence and / or amino acid sequence of the lipase comprises SEQ ID NO: 37 and / or SEQ ID NO: 38 or has more than 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% homology with SEQ ID NO: 37 / SEQ ID NO: 38.
[0100] The genus *Haloxylon* includes Halomonas bluephagenesis or its derivatives Halomonas campaniensis or its derivatives or Halomonas aydingkolgenesis Or one or more of its derivatives.
[0101] In a fifth aspect, the present invention provides a method for constructing the above-mentioned protease-deficient large-cell recombinant bacteria that produces recombinant proteins, the method comprising introducing a sequence encoding a recombinant protein into a protease-deficient large-cell recombinant bacterium to obtain a protease-deficient large-cell recombinant bacterium expressing the recombinant protein.
[0102] The importation can be the importation of plasmids, the integration of expressed genes into the genome, etc.
[0103] The plasmid introduction can be performed through electroconversion, conjugation conversion, chemical conversion, etc.
[0104] Preferably, the expression plasmid includes the pSEVA series plasmids, preferably pSEVA341, pSEVA241, pSEVA321, etc. (Ren K, Zhao YQ, Chen GQ, et al. Construction of a Stable Expression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System of Halomonasbluephagenesis.) ACS Synth. Biol . 2023, 13(1): 61-67.).
[0105] The expressed gene genome integration can be achieved using methods such as suicide plasmids or CRISPR / Cas9.
[0106] In one specific embodiment of the present invention, the introduction of a sequence encoding a recombinant protein into Halomonas involves constructing a plasmid containing the sequence of the recombinant protein and introducing it into Halomonas by conjugation and transformation with Escherichia coli S17-1.
[0107] A sixth aspect of the present invention provides a method for producing recombinant proteins, the method comprising culturing the recombinant bacteria or the recombinant bacteria obtained by the above construction method in the above culture medium.
[0108] The culture temperature is any value between 15-50℃, preferably any value between 30-45℃, such as 20, 25, 30, 34, 35, 36, 37, 40, 45, 50℃, etc.
[0109] The induction temperature is any value between 10-40℃; preferably any value between 15-25℃, such as 10, 14, 15, 16, 17, 18, 19, 20, 21, 22, 25, 30, 35, 40℃, etc.
[0110] The cultivation time can be 5-1000 hours, preferably 24-48 hours or 20-60 hours, for example, 5, 10, 30, 35, 40, 45, 48, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 hours, etc. The cultivation time may be adjusted according to the actual cultivation method.
[0111] The induction method includes adding an inducing agent. Preferably, the inducing agent can be PHA (polyhydroxyalkanoate), for example, a corresponding promoter. phaP promoter or its variants), formaldehyde (e.g., corresponding frm (promoter or its variants), IPTG (isopropyl-β-D-thiogalactoside, for example, the corresponding lac Promoter or its variants or MMP promoter or its variants), AHL (homoserine lactone), oleic acid (e.g., corresponding fadBA (promoter or its variants), Ara (arabinose, for example, the corresponding...) araBAD (promoter or its variants), Cuma (cuminic acid, for example, the corresponding...) cym (promoter or its variants), Sal (sodium salicylate, for example, the corresponding sal (promoter or its variants), Van (vanillic acid, for example, the corresponding...) van (promoter or its variants), aTc (anhydrous tetracycline, e.g., corresponding to...) tet Promoter or its variants), Nar (naringenin, for example, the corresponding ttg (promoter or its variants), DAPG (2,4-diacetyl-resorcinol, for example, the corresponding phlf One or more of the promoters or their variants.
[0112] In one specific embodiment of the present invention, the method includes: 1) Construct a plasmid containing a sequence encoding a recombinant protein; the plasmid comprises a backbone vector (e.g., pSEVA321) and a promoter (e.g., P...). porin Promoters), RBS, and target genes (e.g., LTF); 2) The plasmid constructed in 1) was introduced into Escherichia coli S17-1; 3) Plasmids were introduced into Halomonas bacteria via conjugation transformation; 4) Use a urea concentration of 1-10 g / L (60 LB or 60 MM) medium, add 30-50 g / L of glucose as needed, and culture the recombinant bacteria at 16-37℃. Harvest the recombinant protein after 24-48 h of culture.
[0113] In one specific embodiment of the method of the present invention, preferably for Halomonas, the recombinant protein LTF is produced in a 60 mm medium with an additional addition of 30 g / L glucose and 1-10 g / L urea.
[0114] In one specific embodiment of the method of the present invention, preferably for Halomonas, the optimal culture medium conditions of 60 mm are selected, and 30 g / L glucose and 10 g / L urea are added to carry out recombinant LTF production, which can achieve the highest yield.
[0115] The method described can also produce PHA.
[0116] In a sixth aspect, the present invention provides a recombinant protein LTF produced by the above method.
[0117] In a seventh aspect, the present invention provides a recombinant protein α-LA produced by the above method.
[0118] In an eighth aspect, the present invention provides a recombinant protein, Monellin, produced by the above method.
[0119] In a ninth aspect, the present invention provides a recombinant protein PHA particle-binding protein (PhaP) produced by the above method.
[0120] In a tenth aspect, the present invention provides a recombinant protein transglutaminase (MTG) produced by the above method.
[0121] In an eleventh aspect, the present invention provides a recombinant protein lipase produced by the above method.
[0122] In a twelfth aspect of the present invention, a protease-deficient recombinant bacterium with high single-cell protein content as described above is provided.
[0123] The recombinant bacteria may not express or may express at least one recombinant protein.
[0124] The beneficial effects of this invention are: 1) A protease-deficient engineered strain with a volume expansion of more than 5 times was developed, which achieved autonomous flocculation and sedimentation, significantly reducing separation costs; the intracellular accumulation of the target recombinant protein was significantly increased compared with the wild-type strain, which can increase it by 10%-100%.
[0125] 2) Using one of the morphologically engineered bacteria constructed in this invention, the protease-deficient morphologically engineered bacteria, Halomonas, can achieve open, large-scale continuous fermentation to produce recombinant proteins LTF, α-LA, and Monellin without contamination by other bacteria; the LTF protein content can reach approximately 792 mg / L in a 7-liter fermenter, which is higher than that of Escherichia coli.
[0126] 3) By constructing protease-deficient engineered strains and morphologically engineered strains, it was found that the two techniques can work synergistically to improve the production of recombinant proteins.
[0127] 4) Under specific culture conditions, protease-deficient recombinant strains obtained through base editors can have a single-cell protein content of up to 88% of the cell dry weight, which is significantly higher than the single-cell protein level of conventional microorganisms.
[0128] 5) Recombinant strains obtained through protease and morphological engineering are easy to express various types of recombinant proteins, including but not limited to: nutritional proteins, industrial enzyme preparations MTG, amylase, glucosidase, and insecticidal proteins.
[0129] The invention is further illustrated in the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention. All chemicals used in the following reactions are commercially available products unless otherwise specified.
[0130] The strains used in the embodiments of this application are: The strains used in the examples Halomonas bluephagenesis TD1.0, Escherichia coli S17-1, and sodium-dependent Vibrio. Vibrio natriegens ATCC14048 、 The H16 true trophozoite and its plasmid are available to the public from Tsinghua University or can be purchased commercially.
[0131] The culture medium formulation used in the examples is as follows: 10LB medium: containing 10g / L NaCl, 10g / L peptone (purchased from OXOID, UK, catalog number LP0042), 5g / L yeast extract (purchased from OXOID, UK, catalog number LP0021), with the remainder being water, autoclaved.
[0132] 60LB medium: Except for the NaCl concentration of 60g / L, the other components are the same as those of 10LB.
[0133] 60MM medium: 1 g / L yeast extract (OXOID, catalog number LP0021), 60 g / L sodium chloride, 2% component I, 2% component II, 2% component III + component IV, the remainder is water, and the pH is adjusted with NaOH.
[0134] Component I contains: 25 g / L urea, 10 g / L magnesium sulfate, and the remainder is water.
[0135] Component II contains: 191.25 g / L disodium hydrogen phosphate, 75 g / L potassium dihydrogen phosphate, and the remainder is water.
[0136] Component III contains: 5 g / L ferric ammonium citrate, 2 g / L calcium chloride dihydrate, and the remainder is water.
[0137] Component IV contains: 0.03 g / L sodium molybdate dihydrate, 0.03 g / L manganese chloride tetrahydrate, 0.01 g / L copper sulfate pentahydrate, 0.02 g / L nickel chloride hexahydrate, 0.2 g / L cobalt chloride hexahydrate, 0.1 g / L zinc sulfate heptahydrate, 0.3 g / L boric acid, and the remainder is water.
[0138] 10MM medium: Except for the NaCl concentration of 10g / L, the other components are the same as those of 60MM.
[0139] 30MM medium: Except for the NaCl concentration of 30g / L, the other components are the same as those of 60MM.
[0140] M9 Inorganic Salt Culture Medium: Disodium hydrogen phosphate heptahydrate 12.8 g / L, potassium dihydrogen phosphate 3 g / L, ammonium chloride 1 g / L, sodium chloride 0.5 g / L, magnesium sulfate 0.24 g / L, trace element solution 1 mL / L.
[0141] Trace element solution (g / L 1M HCl): 2.78 g / L ferrous sulfate heptahydrate, 1.98 g / L manganese chloride tetrahydrate, 2.38 g / L cobalt chloride hexahydrate, 1.47 g / L calcium chloride dihydrate, 0.17 g / L copper chloride dihydrate, and 0.29 g / L zinc sulfate heptahydrate, dissolved in 1M HCl solution and stored in a refrigerator at 4℃ protected from light.
[0142] In actual culture, a certain concentration of antibiotics can be added to the culture medium to maintain the stability of the plasmid. Commonly used antibiotics include chloramphenicol stock solution (25 mg / ml).
[0143] If a solid culture medium is required, add 1.5% agar to the liquid culture medium described above, sterilize, cool to 60°C, add an appropriate amount of antibiotic as needed, mix well, and pour into plates.
[0144] The detection method used in the examples: Method for gas chromatography determination of polyhydroxyalkanoate (PHA) content: The furnace temperature was set to 80℃, the injector temperature to 200℃, the detector temperature to 220℃, and the column head pressure to 0.25 MPa. The programmed temperature rise conditions were: 80℃ for 1.5 minutes, then ramped up to 140℃ at a rate of 30℃ / min, followed by ramping up to 220℃ at a rate of 40℃ / min and holding at this temperature for 0.5 minutes. The sample injection volume was 1 μL, using a microsyringe manufactured by Agilent Technologies.
[0145] Gas chromatograph sample preparation: Take 40-60 mg of stem cells from the sample to be tested (centrifuge the bacterial culture at 10000 rpm at room temperature for 10 minutes, wash the resulting cell pellet once with water, and then freeze-dry to obtain stem cells; the homopolymer is produced in the cells), add 2 mL of chloroform and 2 mL of esterification solution (pure methanol containing 3% (v / v) concentrated sulfuric acid and 1 g / L benzoic acid as an internal standard) to the esterification tube, cap and seal, and heat at 100℃ for 4 hours. After cooling, add 1 mL of distilled water, shake thoroughly, and let stand until the chloroform phase and aqueous phase completely separate. Inject 1 μL of the lower chloroform phase into the gas chromatograph (HP Hewlett Packard 6890) for chromatographic analysis. Operate the gas chromatograph according to the HP Hewlett Packard 6890 gas chromatograph instruction manual.
[0146] Preparation of standard samples: Take 10-20 mg of standard sample into an esterification tube, add 2 mL of chloroform and 2 mL of esterification solution, seal the tube, and carry out esterification at 100℃.
[0147] Results analysis: Using the standard sample as a control, if the esterified sample of the cells to be tested (the sample to be tested) has a significant peak at the standard sample, the mass of each monomer can be calculated based on the peak area, and then the molar ratio can be calculated based on the mass fraction of each monomer; the proportion of polymer in the dry weight of the cells (wt%) can be calculated based on the amount of sample added.
[0148] The dry cell weight (DCW, g / L) is the ratio of the mass of the dried cells to the volume of the fermentation product.
[0149] The PHA content (wt%) is the mass ratio of PHA to the dried bacterial cells.
[0150] Protein concentration detection method 1 (BCA detection method): Prepare BSA standard systems with final concentrations of 2000, 1500, 1000, 750, 500, 250, 125, 25, and 0 mg / L; Prepare BCA working solution: Add 1 volume of BCA reagent B to 50 volumes of BCA reagent A (A:B = 50:1) and mix thoroughly. Add 25 μL of standard and sample to each well of a microplate. Add 200 μL of BCA working solution to each well and vortex for 30 seconds to mix thoroughly. Cover the microplate and incubate at 37°C for 30 minutes. Cool to room temperature and measure absorbance in the 540-595 nm wavelength range using a microplate reader, with 562 nm being the optimal wavelength. Plot a standard curve based on the absorbance of the BSA standard (subtract the OD value of the blank well in the standard to obtain the final reading) (X - protein concentration μg / mL; Y - final OD 562 nm). Calculate the protein concentration of the sample based on the standard curve and the sample dilution factor.
[0151] Protein concentration detection method 2 (Kjeldahl method): Protein concentration is estimated by measuring nitrogen content. First, the sample is digested with concentrated sulfuric acid at high temperature, converting organic nitrogen into inorganic ammonium salts. Next, it is distilled in an alkaline environment to release ammonia gas. Finally, the ammonia is absorbed with boric acid solution, and titration is performed using a standard acid solution. By calculating the amount of acid consumed, the nitrogen content of the sample can be accurately obtained. Multiplying this by a protein conversion factor yields the total protein content.
[0152] For further information on the experimental methods described above, please refer to Lan, LH, Zhao, H., Chen, JC, and Chen, G.-Q. (2016). Engineering Halomonas spp. as A Low Cost Production Host forProduction of Bio-surfactant Protein PhaP. Biotechnology journal 11 , 1595–1604; Fu XZ, Tan D, Aibaidula G, et al. Development of Halomonas TD01 as a host for open production of chemicals. Metab. Eng 2014, 23 : 78-91 and Yue HT, ChenXB, Ling C, et al. A seawater-based open and continuous process forpolyhydroxyalkanoates production by Halomonas campaniensis LS21. Biotechnol. Biofuels. 2014, 7:108.
[0153] Example 1 I. Reorganization Halomonas bluephagenesis Construction of WWZ55, WWZ58, WWZ71, WWZ60, and WWZ72 The inventors, using bioinformatics methods, identified potential bacteria in species such as Halomonas. lon and htrA Information such as genes.
[0154] by Halomonas bluephagenesisTD1.0 (abbreviated as TD1.0) was the starting strain. Following the method described in the literature (Qin Q, Ling C, Zhao Y, et al. CRISPR / Cas9 editing genome of extremophile Halomonas spp. Metab Eng. 2018;47:219-229), the dCas9 gene was combined with... lon-1 (SEQ ID NO:39) lon-2 (SEQ ID NO: 40) 、htrA A single-gene knockout module of the sgRNA (SEQ ID NO: 42-44) designed by gene (SEQ ID NO: 41) was introduced into the strain, and a premature termination codon was introduced to construct strains. Halomonas bluephagenesis WWZ55, WWZ58, and WWZ71. Following the same method, the dCas9 gene was respectively combined with... lon-1 (SEQ ID NO: 39) lon-2 (SEQ ID NO: 40) 、htrA (SEQ ID NO: 41)sgRNA dual-gene and triple-gene knockout modules were introduced into the strain, introducing premature termination codons. Successfully edited mutant strains were screened using colony PCR primers and confirmed by gene sequencing. The constructed strain was named... Halomonas bluephagenesis WWZ60 (Dual Gene) lon-1 / 2 co-knockout) or WWZ72 (three-gene co-knockout) (verification) Halomonas bluephagenesis The primer sequences for strains WWZ55, 58, and 60 are: aaatgtttgcctagccgctca; atggtgccaagggttgaagttc; verification Halomonas bluephagenesis The primer sequence for strain WWZ71 is: tccctccgcactttggct.
[0155] II. Expression of recombinant proteins Halomonas bluephagenesis Construction of strains WWZ55, WWZ58, WWZ71, WWZ60 and WWZ72 Using pSEVA321 plasmid (Ren K, Zhao YQ, Chen GQ, et al. Construction of a StableExpression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System of Halomonas bluephagenesis. ACS Synth. BiolUsing the expression vector p321-LTF (2023, 13(1): 61-67) and the inducible promoter Mmp1, recombinant plasmids p321-LTF (expressing the LTF gene) and p321-α-LA (expressing the α-LA gene) were constructed. The nucleotide sequence of the LTF gene is shown in SEQ ID NO: 27, and the nucleotide sequence of the α-LA gene is shown in SEQ ID NO: 29.
[0156] The construction process is as follows: The aforementioned gene fragments were synthesized using Beijing Liuhe BGI Genomics Co., Ltd. Subsequently, the target fragments were amplified and ligated using Q5 high-fidelity DNA polymerase to obtain the target plasmids p321-LTF and p321-α-LA.
[0157] The plasmids p321-LTF and p321-α-LA were transformed into Escherichia coli via chemical transformation. E. coli In S17-1, the recombinant bacteria are transformed through conjugation of Escherichia coli S17-1.
[0158] Pick Halomonas bluephagenesis Samples were prepared from the bacterial cultures of WWZ60, WWZ72, and the control strain TD1.0 after fermentation in MM60 growth medium at 30°C for 48 hours, and observed using a scanning electron microscope (SEM). The results are as follows: Figure 1 As shown, at the same magnification, Halomonas bluephagenesis Compared to the control strain TD1.0, strains WWZ60 and WWZ72 showed an elongated long axis of cells. Halomonas bluephagenesis WWZ72 is more pronounced than WWZ60. The long axis length of all intact cells in the entire field of view was measured using ImageJ software, and the results are as follows: Figure 2 As shown, it was found Halomonas bluephagenesis The average lengths of strains WWZ60 and WWZ72 were 3.71 mm and 3.82 mm, respectively, which were 1.6 times and 1.7 times the average length of the control strain TD1.0. Compared with the control strain TD1.0, which had an average length of 1-2 mm, these strains showed significant improvements. Halomonas bluephagenesis Multiple filamentous cells with a long axis length greater than 5 mm were observed in strains WWZ60 and WWZ72. Furthermore, even in… Halomonas bluephagenesis Filamentous cells with a long axis length of more than 9 mm were observed in strain WWZ72.
[0159] III. Cultivating Recombinant Strains Halomonas bluephagenesis Production of LTF and α-LA 1. Shaking flask experiment 1) Inoculation with primary seed culture: Pick bacterial cells from the plate and inoculate them into 60LB medium, and incubate at 37℃ and 200 rpm for 12 h; 2) Inoculation with secondary seed culture: Transfer the primary seed culture to fresh 60 LB medium at a ratio of 1% (v / v) and incubate at 37℃ and 200 rpm for 8-10 h. At this time, OD 600 =3~5; 3) Shake-flask fermentation: Transfer the secondary seed culture to 60LB or 60MM medium at a ratio of 5% (v / v), add glucose 30-50 g / L and urea 0-10 g / L as needed, incubate at 200 rpm and 37℃ for 4 hours, then incubate at 16... o C-induced expression for 36 h.
[0160] 2. Target protein identification and purification 1) Collect 10 mL of the bacterial culture obtained from the shake flask and centrifuge at 10,000 rpm for 10 minutes; 2) The obtained cell pellet was resuspended in 2 mL of lysis buffer and placed on ice for 30 minutes. Then, the cells were disrupted by sonication at 200 W, with a sonication on time of 2 s and a sonication off time of 3 s, for a total working time of 4 minutes. 3) Centrifuge the obtained bacterial lysate at 4°C, 12000 rpm, for 25 minutes to obtain the supernatant and precipitate. 4) Load the supernatant onto a Ni-NTA agarose column (Qiagen, Germany), and wash 2 or 3 times with 5 column volumes of wash buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 20 mM imidazole, pH 8.0). Then elute the target protein with elution buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 250 mM imidazole, pH 8.0). 5) Detect the target protein in the supernatant and precipitate using SDS-PAGE at 80V. After running for 2 hours, the protein gel can be stained with Coomassie Brilliant Blue. After staining for 1 hour, develop and observe the target band. 6) Verify the target protein using mass spectrometry sequencing; 7) Protein concentration was determined using the BCA assay. 3. Preliminary results 1) Wild type Halomonas bluephagenesis The TD1.0 vector expressing recombinant protein LTF served as the control group. Halomonas bluephagenesis WWZ55, 58, 60, 71, and 72 were the experimental groups. Figure 3The results showed that the growth of the five protease-deficient strains was basically unaffected compared to the wild type. Figure 4 The results showed that after culturing in 60 LB medium for 48 h, the recombinant lactoferrin accounted for 10% of the total protein in the wild-type strain, while in the protease-deficient strain WWZ60, this proportion increased to 18%, representing an 80% increase in expression level. Furthermore, the specific antibody (HRP-conjugated Rabbit anti-His-Tag mAb, purchased from ABclonal) was detected by Western blotting, and the results are shown below. Figure 5 This demonstrates that the expression level of proteins around 78 kDa is significantly increased in SDS-PAGE gel images.
[0161] Through protein proteometry detection methods, such as Figure 4 As shown, the results revealed that the wild-type strain expressed a 32% coverage of the target protein band peptide. In contrast, the dual endogenous protease-deficient strain... Halomonas bluephagenesis The peptide coverage of WWZ60 was 79.66%, while that of the endogenous protease-deficient strain WWZ72 was 81.64%. This suggests that when wild-type strains express LTF, its amino acid sequence is easily degraded by host endogenous proteases and expressed in a truncated form, while endogenous protease-deficient strains can express LTF proteins that are closer to the full length.
[0162] 2) Wild type Halomonas bluephagenesis The TD1.0 vector expressing α-LA recombinant protein served as the control group. Halomonas bluephagenesis WWZ58, 60, and 72 were the experimental groups. Figure 6 The results showed that after culturing in 60 LB medium for 48 h, Western blot analysis (using HRP-conjugated Rabbit anti-His-Tag mAb, purchased from ABclonal) and BCA analysis after nickel column purification showed that, compared with the wild-type strains, the expression levels of recombinant lactalbumin in WWZ58, 60, and 72 were increased by 73%, 75%, and 83%, respectively, with the highest yield reaching 121 mg / L. Furthermore, protease-deficient strains... Halomonas bluephagenesis The cell dry weight of WWZ58, 60, and 72 was not affected compared to the wild type.
[0163] Example 2
[0164] I. Protease-deficient and morphologically engineered recombinant strains Halomonas bluephagenesis Construction of WWZ601 and WWZ602 Recombinant strains with protease deficiency Halomonas bluephagenesisUsing WWZ60 (abbreviated as WWZ60) as the starting strain, the bacterial protein degradation tag SsrA21 was utilized to cause the degradation of the skeletal protein MreB, which is responsible for maintaining the rod-shaped morphology, during the later stages of growth. Specifically, the coding sequence of SsrA21 (SEQ ID NO: 21) was inserted into the genome. mreB The stop codon of the gene causes the MreB protein to carry a degradation tag during expression, resulting in its degradation in later stages of growth and causing changes in cell morphology. For specific construction methods, please refer to Example 1 of the applicant's previously filed patent CN120700080A. The onset and rate of degradation of the MreB protein are determined by the characteristics of the SsrA degradation tag. Mutants with the SsrA21 tag insertion were screened using colony PCR primers and confirmed by gene sequencing. The constructed strain was named... Halomonas bluephagenesis WWZ601.
[0165] Furthermore, this invention addresses the corresponding protease-deficient and morphologically engineered recombinant strains. Halomonas bluephagenesis WWZ601 has undergone fermentation optimization, such as... Figure 7 As shown, under different concentrations of urea added to 60 mm medium, by optimizing the culture conditions, large-particle recombinant bacteria with protease deficiency were obtained. Halomonas bluephagenesis The total protein concentration increased from 1.59 g / L to 4.67 g / L, and the proportion of the target protein increased from 13.16% to 16.19%.
[0166] Further editing using CRISPR-Cas9 methods Halomonas bluephagenesis Key genes for PHA synthesis in recombinant strains WWZ60 and WWZ601 phaC Primers were designed and screened using colony PCR. phaC The knockout mutant strains, confirmed by gene sequencing, were constructed and named as follows: Halomonas bluephagenesis WWZ61 and WWZ602 (the sgRNA sequence used to knock out phaC is TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGTtgaggatttgctgtcacggaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC; the specific sequence of the detection primer is: ggagtcgcctatgaaaatcaac). From Figure 8 As shown, compared to the wild-type strain TD1.0, the recombinant protease-deficient large-particle strain... Halomonas bluephagenesis Neither WWZ602 nor the recombinant protease-deficient strain WWZ61 accumulated white PHA particles, facilitating large-scale protein production and extraction in shake flasks.
[0167] The results were analyzed using an enzyme-linked immunosorbent assay (ELISA) reader. Halomonas bluephagenesis TD1.0 Halomonas bluephagenesis The growth curves of WWZ60, WWZ601, and WWZ602 are shown in the following figures. Figure 9 As shown, the growth states of TD1.0, WWZ60, WWZ601, and WWZ602 were similar in 60 LB and 60 MM solutions with different urea concentrations, indicating that the morphologically modified strains... Halomonas bluephagenesis WWZ601 and WWZ602 grew slightly slower. Furthermore, the strains grew better in 60 mm medium than in 60 LB medium; therefore, subsequent experiments were conducted in 60 mm medium.
[0168] II. Expression of recombinant proteins Halomonas bluephagenesis Construction of strains WWZ60, WWZ61, WWZ601, and WWZ602 Using pSEVA321 plasmid as an expression vector, plasmids p321-LTF and p321-monellin were constructed using the inducible promoter Mmp1. The nucleotide sequence of the LTF gene is shown in SEQ ID NO: 27, and the nucleotide sequence of the monellin gene is shown in SEQ ID NO: 31.
[0169] The construction process is as follows: The sequence was synthesized using Beijing Liuhe BGI Genomics Co., Ltd. Subsequently, the target fragments were amplified and ligated using Q5 high-fidelity DNA polymerase to obtain the target plasmids p321-LTF and p321-monellin.
[0170] The plasmids p321-LTF and p321-monellin were transformed into E. coli via chemical transformation. E. coli In S17-1, the recombinant bacteria are transformed through conjugation of Escherichia coli S17-1.
[0171] III. Cultivating Recombinant Strains Halomonas bluephagenesis Production of LTF and monellin 1. Shaking flask experiment 1) Inoculation with primary seed culture: Pick bacterial cells from the plate and inoculate them into 60LB medium, and incubate at 37℃ and 200 rpm for 12h; 2) Inoculation with secondary seed culture: Transfer the primary seed culture to fresh 60 LB medium at a ratio of 1% (v / v) and incubate at 37℃ and 200 rpm for 8-10 h. At this time, OD 600 =3~5; 3) Shake flask fermentation: Transfer the secondary seed culture to 60LB or 60MM medium at a ratio of 5% (v / v), add glucose 30-50g / L and urea 0-10g / L as needed, and culture at 200rpm and 30℃ for 36h.
[0172] 2. Target protein identification and purification 1) Collect 10 mL of the bacterial culture obtained from the shake flask and centrifuge at 10,000 rpm for 10 minutes; 2) The obtained cell pellet was resuspended in 2 mL of lysis buffer and placed on ice for 30 minutes. Then, the cells were disrupted by sonication at 200 W, with a sonication on time of 2 s and a sonication off time of 3 s, for a total working time of 4 minutes. 3) Centrifuge the obtained bacterial lysate at 4°C, 12000 rpm, for 25 minutes to obtain the supernatant and precipitate. 4) Load the supernatant onto a Ni-NTA agarose column (Qiagen, Germany), and wash 2 or 3 times with 5 column volumes of wash buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 20 mM imidazole, pH 8.0). Then elute the target protein with elution buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 250 mM imidazole, pH 8.0). 5) SDS-PAGE was used to detect the target protein in the supernatant and precipitate. The voltage was 80V and the gel was run for 2 hours. The protein gel was then stained with Coomassie Brilliant Blue. After staining for 1 hour, the target band was observed by development. 6) Verify the target protein using mass spectrometry sequencing; 7) Protein concentration was determined using the BCA assay.
[0173] 3. Preliminary results (1) with Halomonas bluephagenesis WWZ60 used the same vector to express recombinant monellin protein as the control group, while WWZ61 was the experimental group. Figure 10 The results showed that, in 60MM medium with different concentrations of urea, after purification by nickel column and BCA assay, the yield of recombinant sweet protein from WWZ61 was increased by approximately 24% compared to the wild-type strain, with the highest yield reaching 63 mg / L. This indicates that by knocking out… phaC It can indeed increase protein content and the proportion of target protein.
[0174] (2) with Halomonas bluephagenesis WWZ601 used the same vector to express recombinant LTF protein as the control group, while WWZ602 was the experimental group. Figure 11The results showed that after culturing in 60 mm medium for 48 h, and after purification by nickel column analysis using BCA assay, the expression level of recombinant lactoferrin in WWZ602 was increased by 22% compared to WWZ601. Compared to wild-type TD1.0, the expression level of recombinant lactoferrin in WWZ602 was increased by 100%, and the cell dry weight of protease-deficient strains WWZ601 and WWZ602 was at the same level, with WWZ602 being slightly lower. This further demonstrates that knockout... phaC It can indeed increase the proportion of the target protein, and protease deficiency and increased size have a synergistic effect on the expression of recombinant protein LTF.
[0175] (3) with Halomonas bluephagenesis The WWZ61 vector expressing the LTF recombinant protein served as the control group. Halomonas bluephagenesis WWZ602 is the experimental group. Figure 12 The results showed that after culturing in 60 mm medium for 48 hours, the difference was detected by SDS-PAGE compared to... Halomonas bluephagenesis The expression levels of recombinant lactalbumin in WWZ61 and WWZ602 were significantly increased, by 150%. These experiments demonstrate that morphological modification is beneficial for further increasing the yield of protease-deficient strains, but their growth will be affected. For scale-up fermentation, the use of unmodified strains is still recommended. However, morphologically engineered strains can increase the yield of the target protein and are a highly promising platform for protein production.
[0176] The above experiments demonstrate that morphological modification and phaC knockout are both beneficial for further increasing the yield of protease-deficient strains.
[0177] Example 3 Application of protease defects in a 7-liter fermenter Halomonas bluephagenesis The strain produces recombinant proteins and single-cell proteins. Recombinant bacteria Halomonas bluephagenesis WWZ61 and WWZ602 were inoculated into 20 mL of LB60 medium and cultured for 12-16 h. Then, they were transferred to new LB60 medium at a volume ratio of 1% and cultured for another 8-12 h. 300 mL of seed solution was prepared as inoculum for a 7L bioreactor (NBS Bioflo3000, USA).
[0178] A 2.7 L substrate medium was prepared, containing glucose (60 g), salt (107 g), magnesium sulfate (2 g), urea (15 g), potassium dihydrogen phosphate (14.6 g), and sodium sulfate (15 g). Feed I medium was prepared, containing 750 g / L glucose (280 ml) and urea (43.5 g). Feed II medium was prepared, containing 750 g / L glucose (400 ml) and urea (43.5 g). The pH of the medium was automatically adjusted using NaOH. During fermentation, oxygen concentration was regulated by stirring and aeration. The glucose content in the fermentation medium was monitored every hour using a glucometer to measure residual sugar, thereby controlling the feed rate.
[0179] like Figure 13 As shown, the culture medium used double the iron concentration, fermentation started at 37°C, and after 12 hours of growth, the temperature was lowered to 30°C. After 24 hours, the temperature was lowered to 20°C until fermentation ended. Compared to the unoptimized fermentation conditions, Halomonas bluephagenesis The dry weight (CDW) of WWZ61 cells increased by 215%, reaching a maximum of 101 g / L. Single-cell protein content, as determined by Kjeldahl nitrogen determination, reached 88% of the dry weight, and LTF yield reached a maximum of 796 mg / L, a 10-fold increase compared to 20 mL shake flasks. These results indicate that the protease-deficient strain WWZ61 can undergo high-density fermentation and non-aseptic fermentation, significantly reducing production time and costs.
[0180] Example 4 Application of protease defects in a 45-liter fermenter Halomonas bluephagenesis The strain produces recombinant proteins and single-cell proteins. Recombinant bacteria Halomonas bluephagenesis WWZ61 was inoculated into 20 mL of LB60 medium and cultured for 12-16 h. Then, it was transferred to fresh LB60 medium at a 1% volume ratio and cultured for another 8-12 h. This yielded 2 L of seed solution, which was used as inoculum for a 45 L bioreactor. Before fermentation, the substrate was dissolved in the fermenter and brought to a final volume of 16 L. The pH of the fermentation broth was then adjusted to 8.5 using a 30% NaOH solution. The temperature was stabilized at 37°C, awaiting inoculation. Both the fermentation substrate and any additional feed materials must be completely dissolved.
[0181] Prepare 18L of substrate culture medium containing glucose (360 g), salt (646 g), magnesium sulfate (12 g), urea (90 g), potassium dihydrogen phosphate (87.6 g), and sodium sulfate (90 g). When the fermentation substrate sugar is consumed to approximately 10 g / L, begin feeding the culture medium sequentially according to its number, until the OD (occurrence density) stops increasing. The feeding principle is to control the residual sugar at approximately 10 g / L. An initial feed rate of 210 ml / hr is recommended, with subsequent flow rates adjusted based on residual sugar levels. Growth status monitoring: Measure absorbance at 600 nm wavelength, dilute to 0.2-0.8, and measure every two hours. Residual sugar monitoring: Use blood glucose test strips, measuring every hour to guide the feeding process.
[0182] like Figure 14 As shown, Halomonas bluephagenesis The dry weight (CDW) of WWZ61 cells reached a maximum of 36 g / L, and the protein content of single cells, as determined by the Kjeldahl method, reached 83% of the dry weight, indicating that... Halomonas bluephagenesis After further scale-up, strain WWZ61 exhibited a stable ability to produce high levels of single-cell protein. The results showed that the proportions of several important amino acids were upregulated in the lactoferrin-expressing experimental group, indicating that strain WWZ61, expressing the nutritional protein lactoferrin, is an excellent strain for producing feed protein.
[0183] Example 5 Protease-deficient and morphologically engineered recombinant sodium-dependent Vibrio species Vibrio natriegens Construction and validation of recombinant protein production I. Construction of Sodium-Defective and Morphologically Engineered Recombinant Vibrio natriureticis wild type Vibrio natriegens (ATCC14048, hereinafter abbreviated as VN) is the starting strain, and the dCas9 gene is combined with... lon A single-gene knockout module of the sgRNA (SEQ ID NO: 46) designed by gene (SEQ ID NO: 45) was introduced into the strain, and a premature termination codon was introduced to construct the strain. Vibrio natriegens VN01.
[0184] Recombinant strains with protease deficiency Vibrio natriegens VN01 was the starting strain. The p15A-PB plasmid (Catalog #133886, purchased from Addgene) was used, with the constitutive promoter J23119 (sequence: TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC) overexpressed. sulA The gene (sequence shown in SEQ ID NO: 52, also see CN120700080A) was used to construct a plasmid named p15A-P. J23119 - sulA can cause cells to lengthen, creating more space for intracellular proteins. This strain was named... Vibrio natriegens VN02.
[0185] II. Expression of recombinant proteins Vibrio natriegens Construction of VN02 strain Using the toxin-resistant plasmid pHbPBC as the expression vector, and utilizing the constitutive promoter P phap1 (Sequence details can be found in CN120700080A) Expression phaP Genes were used to construct the plasmid pHbPBC-PhaP. phaP The gene nucleotide sequence is shown in SEQ ID NO:33.
[0186] The construction process is as follows: The sequence was synthesized using Beijing Liuhe BGI Genomics Co., Ltd. Subsequently, the target fragment was amplified and ligated using Q5 high-fidelity DNA polymerase to obtain the target plasmid pHbPBC-PhaP.
[0187] The plasmid pHbPBC-PhaP was transformed into Escherichia coli via chemical transformation. E. coli In S17-1, it is transformed into VN02 through conjugation of E. coli S17-1.
[0188] Pick Vibrio natriegens Samples were prepared from the bacterial cultures of VN01 and VN02 after fermentation at 37°C for 24 hours in production medium MM30, and observed under a microscope. The results are as follows: Figure 15 As shown, at the same magnification, strain VN02 exhibits an elongated cell long axis compared to strain VN01.
[0189] III. Cultivating Recombinant Strains Vibrio natriegens Production of PhaP 1. Shaking flask experiment 1) Inoculation with primary seed culture: Pick bacterial cells from the plate and inoculate them into 30LB medium, and incubate at 37℃ and 200 rpm for 12h; 2) Inoculation with secondary seed culture: Transfer the primary seed culture to fresh 30LB medium at a ratio of 1% (v / v) and incubate at 37℃ and 200 rpm for 8-10 h. At this time, OD 600 =3~5; 3) Shake flask fermentation: Transfer the secondary seed culture to 30LB or 30MM medium at a ratio of 5% (v / v), add glucose 30-50 g / L and urea 0-10 g / L as needed, and culture at 200 rpm and 37℃ for 24 h.
[0190] 2. Target protein identification and purification 1) Collect 10 mL of the bacterial culture obtained from the shake flask and centrifuge at 10,000 rpm for 10 minutes; 2) The obtained cell pellet was resuspended in 2 mL of lysis buffer and placed on ice for 30 minutes. Then, the cells were disrupted by sonication at 200W power, with a sonication on time of 2 seconds and a sonication off time of 3 seconds, for a total working time of 4 minutes. 3) Centrifuge the obtained bacterial lysate at 4°C, 12000 rpm, for 25 minutes to obtain the supernatant and precipitate. 4) Load the supernatant onto a Ni-NTA agarose column (Qiagen, Germany), and wash 2 or 3 times with 5 column volumes of wash buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 20 mM imidazole, pH 8.0). Then elute the target protein with elution buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 250 mM imidazole, pH 8.0). 5) Detect the target protein in the supernatant and precipitate using SDS-PAGE at 80V. After running for 2 hours, the protein gel can be stained with Coomassie Brilliant Blue. After staining for 1 hour, develop and observe the target band. 6) Verify the target protein using mass spectrometry sequencing; 7) Protein concentration was determined using the BCA assay. 3. Preliminary results (1) The wild-type strain of Vibrio natriegens VN expressed phaP recombinant protein using the same vector as the control group, and VN01 was the experimental group. Figure 16 The results showed that, in 60 mm medium, after purification by nickel column and BCA assay, the proportion of phaP protein in recombinant Vibrio natriegens VN01 was increased by about 27% compared to the wild-type Vibrio natriegens VN strain, indicating that the Lon protease deficiency in Vibrio natriegens can indeed increase the proportion of phaP protein in the total protein.
[0191] (2) Vibrio natriegens VN01 expressed phaP recombinant protein using the same vector was used as the control group, and VN02 was used as the experimental group. Figure 16 The results showed that, in 60 mm medium, after purification by nickel column and BCA assay, the proportion of recombinant phaP protein in Vibrio natriegens VN02 was increased by about 9% compared to Vibrionatriegens VN01 strain, indicating that morphological modification can indeed increase the proportion of phaP protein in the total protein.
[0192] Example 6 Protease-deficient and morphologically engineered recombinant Rochefoucauld Ralstonia eutropha (also called) Cupriviadus necator Construction and validation of recombinant protein production I. Protease-deficient and morphologically engineered recombinant Rochechoi fungi Ralstonia eutropha Construction wild type R. eutropha H16 (hereinafter abbreviated as RE) is the starting strain, and the dCas9 gene is combined with... lon A single-gene knockout module of sgRNA (SEQ ID NO: 48) designed by gene (SEQ ID NO: 47) was introduced into the strain, and a premature termination codon was introduced to construct strain RE01.
[0193] Using the protease-deficient recombinant strain RE01 as the starting strain and the pBBR1MCS-2 plasmid (Addgene) as the expression vector, the constitutive promoter P was utilized. tac Construct plasmid pBBR1-P tac - minCD The plasmid was transformed into E. coli via chemical transformation. E. coli In S17-1, *E. coli* S17-1 conjugation is used to transform *Rochete* into *E. rochete*. R. eutropha In the process, a recombinant strain was obtained, which was named RE02. The modified bacteria had a longer morphology, which could generate more space to accommodate intracellular proteins.
[0194] Subsequently, the morphological changes of the recombinant bacteria RE02 were detected by shaking flasks according to the method described in Example 5. The control strain was then used. R. eutropha The recombinant strain RE02 was inoculated into 20 mL of 10 LB medium. The culture was carried out on a shaker at 30°C and 200 rpm for 24 h. Afterward, it was transferred at a volume ratio of 1% to a fresh 20 mL of 10 LB medium and cultured for another 24 h. The morphology of the strain was then observed under an optical microscope. The results are as follows: Figure 17 As shown, the volume of recombinant bacteria RE02 was greater than that of the control bacteria. R. eutropha It increased by about 2 times, with the change in the long axis being particularly noticeable.
[0195] II. Construction of RE02 strain expressing recombinant protein pBBR1-P tac - minCD Plasmids are used as expression vectors, utilizing P phaC The promoter expresses MTG and lipase in morphologically engineered recombinant bacteria. mtg The nucleotide sequences of the lipase gene and lipase gene are shown in SEQ ID NO:35 and SEQ ID NO:37, respectively.
[0196] The construction process is as follows: The sequence was synthesized using Beijing Liuhe BGI Genomics Co., Ltd. Subsequently, the target fragment was amplified and ligated using Q5 high-fidelity DNA polymerase to obtain the target plasmid pBBR1-P. tac - minCD- P phaC -MTG and pBBR1-P tac - minCD- P phaC -Lipase.
[0197] The plasmids described above were transformed into E. coli via chemical transformation. E. coli In S17-1, RE02 is transformed into RE02 through conjugation with E. coli S17-1, yielding RE02-MTG and RE02-Lipase.
[0198] III. Cultivating recombinant strains to produce MTG and lipase 1. Recombinant bacteria RE02-MTG and RE02-Lipase were cultured according to the method described in Example 5 to produce MTG and lipase.
[0199] 1) Inoculation with primary seed culture: Pick bacterial cells from the plate and inoculate them into 10LB medium, and incubate at 30℃ and 200rpm for 24h; 2) Inoculation with secondary seed culture: Transfer the primary seed culture to fresh 10LB medium at a ratio of 1% (v / v) and incubate at 30℃ and 200rpm for 8-10 hours. At this time, OD... 600 =3~5; 3) Shake flask fermentation: Transfer the secondary seed culture to 10 mm medium at a ratio of 5% (v / v), add 20 g / L fructose and 0-10 g / L urea as needed, and culture at 200 rpm and 30 ℃ for 48 h.
[0200] 2. Target protein identification and purification 1) Collect 10 mL of the bacterial culture obtained from the shake flask and centrifuge at 10,000 rpm for 10 minutes; resuspend the obtained cell pellet with 2 mL of lysis buffer, let it stand on ice for 30 minutes, and then use an ultrasonic disruptor to disrupt the cells at 200 W, with an ultrasonic on time of 2 seconds and an ultrasonic off time of 3 seconds, for a total working time of 4 minutes; centrifuge the obtained bacterial lysis buffer at 4 °C, 12,000 rpm for 25 minutes to obtain the supernatant and precipitate. 2) Load the supernatant onto a Ni-NTA agarose column (Qiagen, Germany), and wash 2 or 3 times with 5 column volumes of wash buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 20 mM imidazole, pH 8.0). Then elute the target protein with elution buffer (20 mM Tris-Cl, 50 mM NaCl, 2 mM CaCl2 and 250 mM imidazole, pH 8.0). 3) SDS-PAGE was used to detect the target protein in the supernatant and precipitate. The voltage was 80V and the gel was run for 2 hours. The protein gel was then stained with Coomassie Brilliant Blue. After staining for 1 hour, the target band was observed by development. 4) Verify the target protein using mass spectrometry sequencing; 5) Protein concentration was determined using the BCA assay.
[0201] III. Preliminary Results 1) Wild type R. eutropha The same vector expressing recombinant protein MTG served as the control group, while the recombinant strain RE02-MTG served as the experimental group. Figure 18 The results showed that RE02 significantly improved MTG expression compared to both RE01 and wild-type RE.
[0202] 2) Wild type R. eutropha The same vector expressing recombinant protein lipase served as the control group, while the recombinant strain RE02-Lipase served as the experimental group. Figure 18 The results showed that RE02 was slightly improved compared to RE01 and wild-type RE, while RE01 showed little improvement compared to WT, which may be due to the limited positive effects of single protease knockout.
[0203] The above results indicate that morphological modification and protease-deficient modification are universally applicable.
[0204] Example 7
[0205] (1) Directly edit the above embodiments. mreB Alternatively, it can be done by first knocking out sspB Genes (e.g., halometa) Halomonas bluephagenesis of sspB The gene nucleotide sequence is shown in SEQ ID NO:49), and then the SspB protein (e.g., Halomonas) is simultaneously overexpressed in the plasmid. Halomonas bluephagenesis The amino acid sequence of the SspB protein (as shown in SEQ ID NO:50) and the target protein can achieve late-stage changes in cell morphology.
[0206] In this embodiment, the first step is to knock out Halomonas bluephagenesisThe SspB of WWZ61 (the sgRNA used for knockout is SEQ ID NO: 7 of CN120173844A) was used to name the strain WWZ62.
[0207] Using pHbPBC as the expression vector, SspB and LTF were overexpressed using the inducible promoter Mmp1, and the plasmid was constructed and named pHbPBC-P. Mmp1 - sspB+LTF The plasmid was transformed into E. coli via chemical transformation. E. coli In S17-1, the recombinant strain was obtained by conjugation of Escherichia coli S17-1 into WWZ62, and this strain was named WWZ63.
[0208] Subsequently, the morphological changes of the recombinant strain WWZ63 were detected by shaking flask according to the method described in Example 2. After culturing in 60 mm medium for 12 h, IPTG (200 mg / L) induction was performed, and the morphological differences between the control strain and the WWZ63 strain were observed and compared after 12 h of induction.
[0209] like Figure 19 As shown in (a). The statistical results obtained after analyzing the long and short axes of the bacteria using ImageJ are as follows. Figure 19 As shown in (b), this indicates that it is feasible to perform morphological changes in the later stages while simultaneously producing recombinant proteins, which can reduce the impact of deformation on growth.
[0210] (2) In addition, using pHbPBC as the expression vector, the minCD gene was overexpressed using the PhaP1 promoter, and a plasmid named pHBPBC-P was constructed. phaP1 - minCD The plasmid was transformed into E. coli via chemical transformation. E. coli In S17-1, E. coli was conjugated into WWZ601 to obtain a recombinant strain, named WWZ603. This strain elongates the bacteria, resulting in larger bacteria. Morphological changes in the recombinant strain WWZ603 were then detected by shaking flask analysis according to the method described in Example 2.
[0211] The results are as follows Figure 20 As shown in (a). The statistical results obtained by analyzing the long and short axes of bacteria using ImageJ are shown below. Figure 20 As shown in (b). The above results indicate that by combining and regulating morphology-related genes, cell volume can be further increased.
[0212] Example 8 Protease-deficient and morphologically engineered Corynebacterium glutamicum Corynebacterium glutamicum Construction and validation of recombinant protein production I. Protease-deficient and morphologically engineered recombinant Corynebacterium glutamicumCorynebacterium glutamicum Construction The inventors used bioinformatics methods to discover potential LON genes in Corynebacterium glutamicum, in order to... Corynebacterium glutamicum Using ATCC13032 as the starting strain, similar to the above, a single-gene knockout module of the dCas9 gene and sgRNA (SEQ ID NO:61) designed based on the lon (SEQ ID NO:60) gene was introduced into the strain, introducing a premature termination codon. Successfully edited mutant strains were screened using colony PCR primers, and strains were constructed accordingly. Corynebacterium glutamicum 01. Using protease-deficient recombinant strains Corynebacterium glutamicum Starting with strain 01 (abbreviated as CG01), this study utilized the bacterial protein degradation tag SsrA21 to degrade the skeletal protein MreB, responsible for maintaining the rod-like morphology, during late growth. Specifically, the coding sequence of SsrA21 (SEQ ID NO:21) was inserted before the stop codon of the mreB gene in the genome, causing the MreB protein to carry a degradation tag during expression, thus leading to its degradation during late growth and resulting in changes in cell morphology. Mutants with the SsrA21 tag insertion were screened using colony PCR primers and confirmed by gene sequencing. The constructed strain was named... Corynebacterium glutamicum 02 (abbreviated as CG02).
[0213] Cultivating recombinant strains to produce lactoferrin LTF Following the experimental method described in Example 2 above, wild-type Corynebacterium glutamicum ATCC13032 and protease-deficient recombinant strain Corynebacterium glutamicum CG01 were used as hosts to express recombinant lactoferrin (LTF) using the expression vector pEC-XK99E (see plasmids Eikmanns BJ, Kleinertz E, Liebl W, Sahm H. A family of Corynebacterium glutamicum / Escherichia coli shuttle vectors for cloning, controlled gene expression, and promoter probing. Gene. 1991 Jun;102(1):93-98. DOI: 10.1016 / 0378-1119(91)90545-m. PMID: 1864513). Construction of the LTF expression plasmid: The LTF gene was cloned downstream of the Ptac promoter in the pEC-XK99E vector to construct the recombinant expression plasmid pEC-Ptac-LTF. After culturing in 60 LB medium for 48 h, BCA assay after nickel column purification showed that the recombinant lactoferrin accounted for 10% of the total protein in the wild-type strain, while in the protease-deficient strain CG01, this proportion increased to 15%, representing a 50% increase in expression level. Corynebacterium glutamicum CG01 used the same vector to express recombinant LTF protein as a control group. Corynebacterium glutamicum CG02 was the experimental group. After purification using a nickel column in 60 mm medium, BCA was detected. Compared to... Corynebacterium glutamicum CG01 strain, Corynebacterium glutamicum The proportion of LTF protein in the total protein increased by about 10% in the CG02 recombinant protein, indicating that morphological modification can indeed increase the proportion of LTF protein in the total protein.
[0214] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0215] It should also be noted that the various specific technical features described in the above embodiments can be combined in any suitable manner without contradiction. To avoid unnecessary repetition, the present invention will not describe the various possible combinations separately. Furthermore, various different embodiments of the present invention can also be arbitrarily combined, as long as they do not violate the spirit of the present invention, and should also be regarded as the content disclosed by the present invention.
Claims
1. A method of constructing a recombinant prokaryotic microorganism, the method comprising knocking down or knocking out an intracellular protease, wherein the intracellular protease is selected from the group consisting of: an ATP-dependent serine protease gene lon、 a serine endopeptidase gene htrA or a combination thereof.
2. The method of claim 1, further comprising inserting a SsrA degradation tag into one or more of a termination codon of a scaffoldin gene of the genome of the prokaryotic microorganism, and / or overexpressing one or more of a cell division suppressor protein gene and a cell division ring localization gene in the prokaryotic microorganism. mreBCD and a cell division ring synthesis gene ftsABEIQWXYZ sulA and a cell division ring localization gene minCDE . 3. The method of claim 2, wherein: 1) the SsrA degradation tag is an endogenous or exogenous wild-type SsrA degradation tag of the prokaryotic microorganism or a mutant thereof, preferably selected from the group consisting of SsrA degradation tags of the amino acid sequence as set forth in any one of SEQ ID Nos: 1-26, and more preferably a SsrA degradation tag derived from a Halomonas, most preferably SsrA16 or SsrA21; 2) inserting the SsrA degradation tag into mreB and / or ftsZ in front of the stop codon of the gene, preferably immediately adjacent to the stop codon; 3) overexpression of sulA genes and / or minCD genes; and / or 4) said prokaryotic microorganism is also knocked out in an endogenous sspB gene.
4. The method according to any one of claims 1 to 3, wherein the prokaryotic microorganism is selected from the group consisting of Halomonas sp. ( Halomonas ), Pseudomonas sp. ( Pseudomonas ), Escherichia sp. ( Escherishia coli ), Corynebacterium sp. ( Corynebacterium glutamicum ), Alcanivorax sp. ( Ralstonia eutropha or Cupriviadus necator ), Aeromonas sp. ( Aeromonas ), Bacillus sp. ( Bacilllus ), Vibrio sp. ( Vibrio natriegens ) and Alcaligenes sp. ( Alcaligenes latus ), preferably Halomonas sp., still more preferably the Halomonas sp. is Halomonas bluephagenesis , Halomonas aydingkolgenesis、Halomonas campaniensis , Halomonas lutescens , Halomonas hydrothermalis , Halomonas Halomonas sp. KM1, Halomonas elongata and Halomonas smyrnensis , still more preferably Halomonas bluephagenesis Halomonas sp. TD1.0, Halomonas bluephagenesis Halomonas sp. TD01 (Bacterial Deposit No. CGMCC No. 4353), Halomonas aydingkolgenesis Halomonas sp. M1 (Bacterial Deposit No. CGMCC No. 19880) and Halomonas campaniensis Halomonas sp. LS21 (Bacterial Deposit No. CGMCC No. 6593). 5. The method of claim 4, wherein: 1) the prokaryotic microorganism is a Halomonas sp. Halomonas ), preferably Halomonas bluephagenesis , more preferably Halomonas bluephagenesis Halomonas sp. TD1.0, and has one or both of lon and htrA knocked down or knocked out, preferably both of lon-1 (SEQ ID NO: 39), lon-2 (SEQ ID NO: 40), htrA (SEQ ID NO: 41) knocked down or knocked out, more preferably both of lon-1 and lon-2 or lon-1 , lon-2 and htrA are knocked down or knocked out; 2) the prokaryotic microorganism is Vibrio natriophilus Vibrio natriegens ), and has been knocked down or knocked out lon (SEQ ID NO: 45); 3) the prokaryotic microorganism is Rothia luciferiformis (ATCC 49623) Ralstonia eutropha or Cupriviadus necator and has been knocked down or knocked out lon (SEQ ID NO: 47); and / or 4) the prokaryotic microorganism has a knocked down or knocked out endogenous PHA synthase gene phaC .
6. The method of claim 5, wherein: 1) also inserting the SsrA degradation tag SsrA16 or SsrA21 into the mreB gene or ftsZ the stop codon of the gene of the Halomonas sp. 2) said V. natriophilus further overexpressing sulA the gene; or 3) the Rothia trueae also overexpresses minCD the gene.
7. A recombinant prokaryotic microorganism constructed by the method of any one of claims 1 to 6.
8. A method for producing a recombinant protein or single-cell protein, the method comprising: 1) overexpressing the recombinant protein in a recombinant prokaryotic microorganism constructed by the method of any one of claims 1 to 6; and 2) recovering and / or purifying the recombinant protein or single-cell protein comprising the same obtained in step 1).
9. The method of any one of claims 1 to 8, wherein: luc 1) said overexpression is under the control of a promoter, said promoter being an inducible promoter or a constitutive promoter, preferably selected from the group consisting of Mmp1 promoter, lux promoter, lac promoter, promoter, trp promoter, tac promoter, araBAD promoter, fadBA promoter, cin promoter, cym promoter, sal promoter, van promoter, tet promoter, ttg promoter, phlf promoter, phaP promoter, a hypoxia-inducible promoter, a bacterial quorum-sensing inducible promoter, a temperature-sensitive promoter, a pH-sensitive promoter, a J23119 promoter or a combination thereof, preferably said constitutive promoter is selected from the group consisting of wild-type porin gene P porin promoter or a mutant thereof, wherein said mutant is selected from the group consisting of P porin1 , P porin3 , P porin42 , P porin51 , P porin58 , P porin68 , P porin140 , P porin141 , P porin183 , P porin192 , P porin194 , P porin203 , P porin221 , P porin226 , P porin259 , P porin278 ; 2) said overexpression is overexpression on a plasmid or on the genome; 3) said recombinant prokaryotic microorganism has been knocked out of an endogenous plasmid; and / or 4) said recombinant prokaryotic microorganism is a recombinant Halomonas sp., and / or said expression plasmid is a pSEVA series plasmid, and / or said expression plasmid is a toxin-antitoxin system plasmid, more preferably said toxin-antitoxin system plasmid is pHbPBC.
10. The method of claim 8 or 9, wherein said recombinant protein is selected from: 1) industrial enzymes, such as amylases, lipases, glucosidases; 2) functional proteins: feed proteins, agricultural pesticidal proteins, cytokines, therapeutic pharmaceutical proteins, marker proteins; signal pathway related proteins, such as kinases, phosphatases; 3) biomaterial proteins, such as collagen, silk proteins; and 4) food proteins, such as lactoferrin (LTF), alpha-lactalbumin (a-LA) and monellin (Monellin).
Citation Information
Patent Citations
Halomonas strain and application thereof
CN102120973A
Method for producing hydrocarbons for making fuel by using sea water as medium and special strain
CN102925382A
Self-flocculation halomonas aydingkolgenesis M1 and application thereof
CN111593006A
A method for producing a 5-carbon compound or a polymer thereof
CN117143793B
Recombinant halomonas capable of inducing protein self-degradation as well as construction method and application of recombinant halomonas
CN120173844A