Trypanosomes multiplex fluorescent quantitative PCR (polymerase chain reaction) nucleic acid detection kit and matched artificial chromosome engineering bacterium quality control product
By developing a multiplex fluorescent PCR nucleic acid detection kit for Trypanosomiasis and quality control materials for engineered bacteria with artificial chromosomes, the problems of low detection throughput and insufficient standardization in port monitoring of Trypanosomiasis have been solved. This has enabled efficient and accurate dual fluorescent PCR nucleic acid detection, which is suitable for the clinical diagnosis of Trypanosomiasis and the safety monitoring of blood products.
Patent Information
- Application Number
- CN202510885553.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2026-01-09
AI Technical Summary
Existing technologies are insufficient for rapid, large-scale screening of trypanosomiasis, especially in port monitoring. The low throughput and lack of standardization make it difficult to meet practical needs. Furthermore, the variability of natural pathogen culture and the instability of synthetic fragments result in poor accuracy and reliability of the detection.
A multiplex fluorescent PCR nucleic acid detection kit for Trypanosoma and a matching quality control sample of engineered bacteria with artificial chromosome were developed. The kit uses a specific primer and probe set and an internal standard RNase-P gene detection set, combined with PCR premix and quality control sample. A recombinant artificial chromosome is constructed through homologous recombination technology to ensure the specificity, sensitivity and amplification efficiency of the detection. Digital PCR is used to accurately label the nucleic acid copy number.
This method achieves high throughput and high efficiency in dual fluorescence PCR nucleic acid detection of trypanosomes, avoiding missed detections. The engineered bacteria quality control sample simulates the nucleic acid extraction characteristics of the sample and has good stability. The recombinant artificial chromosome exists stably in the engineered bacteria, ensuring the accuracy and reliability of the detection and meeting the needs of large-scale applications.
Smart Images

Figure CN121294699A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of virology, biotechnology and molecular biology. More specifically, it relates to a trypanosome multiplex fluorescent PCR nucleic acid detection kit and a matching quality control product of engineered bacteria with artificial chromosomes. Background Technology
[0002] Trypanosomas are an important group of zoonotic parasitic protozoa belonging to the class Flagellates and family Trichodinidae. The main pathogenic species include *Trypanosoma cruzi* (TCru) from the Americas and *Trypanosoma brucei* (TBru) from Africa. The former is the pathogen causing Chagas disease, while the latter is the pathogen causing African trypanosomiasis (commonly known as sleeping sickness). Both diseases are neglected tropical diseases of great concern to the World Health Organization (WHO), posing a serious threat to human health and socio-economic development.
[0003] The genome of *Trypanosoma cruzi* is approximately 64 Mb (million base pairs), with a nuclear genome containing about 41 chromosomes. It also features a complex family of variable surface glycoproteins (VSGs), pseudogenes, and numerous repetitive sequences. The genome of *Trypanosoma brevicornu* is approximately 26 Mb, containing 11 pairs of chromosomes. Its most notable feature is the high variability of its surface variant antigens (VSGs), which allows it to evade immune recognition. These complex genomic features pose challenges to nucleic acid detection, requiring the design of primers and probes targeting highly conserved sequences to ensure the specificity and stability of the detection.
[0004] The risk of bloodborne transmission of trypanosomiasis infection has been identified as a key area for prevention and control by the World Health Organization (WHO) and the International Agency for Blood Safety. *Trypanosoma cruzi* can be transmitted through blood transfusions, leading to latent infection of Chagas disease, while *Trypanosoma brucellosis* has a latent infection rate of 0.1%-10% among blood donors in endemic areas. To ensure blood safety, the WHO requires trypanosomiasis-specific nucleic acid screening of blood samples from endemic areas.
[0005] The risk of cross-border transmission of trypanosomiasis continues to rise, making customs port surveillance a crucial line of defense. According to the World Health Organization (WHO), imported cases of African trypanosomiasis are increasing annually in non-endemic areas of Europe, while infections with *Trypanosoma cruzi* in the Americas, due to their long asymptomatic incubation period (up to 20-30 years), easily spread to non-endemic areas through international travel or migration. The International Health Regulations require member states to conduct pathogen screening at ports of entry for travelers from endemic areas and for high-risk goods (such as biological products). However, existing technologies, due to low throughput and insufficient standardization, are insufficient to meet the practical needs of rapid, high-volume screening at ports of entry.
[0006] Therefore, developing a trypanosome multiplex fluorescent PCR nucleic acid detection kit and a matching quality control kit using engineered bacteria with artificial chromosomes has significant technical value and application prospects. The engineered bacteria with artificial chromosomes retain cellular structure mimicking samples, are resistant to nuclease degradation, and have controllable copy numbers. The recombinant artificial chromosome exists stably in the engineered bacteria at a low copy number, with each engineered bacterium carrying only 1-2 copies of the artificial chromosome. This results in a small detection unit, good batch-to-batch consistency, and overcomes the variability of natural pathogen culture and the instability of synthesized fragments. Compared to the hundreds of copies of general plasmids, it offers better accuracy and reliability, and can meet the needs of large-scale production and multi-scenario applications. Summary of the Invention
[0007] The present invention aims to provide a trypanosome multiplex fluorescent PCR nucleic acid detection kit and a matching quality control product of engineered bacteria with artificial chromosomes.
[0008] Therefore, the present invention adopts the following technical solution:
[0009] This invention provides a multiplex fluorescent PCR nucleic acid detection kit for Trypanosoma cruzi and a matching quality control kit for engineered bacteria with artificial chromosomes. The kit contains specific primer and probe sets for Trypanosoma cruzi (TCru) (upstream primer: SEQ ID NO:10 `CATGCATCTCCCCCGTACAT`, probe: SEQ ID NO:11 `FAM-CGAACCCCACCTCC-MGB`, downstream primer: SEQ ID NO:12 `CTATATTACACCAACCCCAA`) and specific primer and probe sets for Trypanosoma Bruchweg (TBru) (upstream primer: SEQ ID NO:22 `CGTGCAAAAATACACATACACAAATCC`, probe: SEQ ID NO:23 `ROX-CGAAGTACCTCGGACCT-MGB`, downstream primer: SEQ ID NO:24 `TGTGTGTATTACACCAACCCCT`), as well as an internal standard RNase-P gene detection kit (upstream primer: SEQ ID NO:34 `ATGGCGGTGTTTGCAGATTTG`, probe: SEQ ID NO:10 `CATGCATCTCCCCCGTACAT`, probe: SEQ ID NO:11 `FAM-CGAACCCCACCTCC-MGB`, downstream primer: SEQ ID NO:12 `CTATATTACACCAACCCCAA`) and SEQ ID NO:12 `CTATATTACACCAACCCCAA`). IDNO:35`CY5-TTCTGACCTGAAGGCTCTGCG-BHQ2`, downstream primer: SEQ ID NO:36`GCGGCTGTCTCCACAAGT`).
[0010] The primer and probe set has been rigorously screened to ensure high specificity (no cross-reactivity), high sensitivity (detection limit <500 copies / mL), and amplification efficiency meeting standards (90%-110%). The kit also includes PCR premix (containing hot-start DNA polymerase, UNG enzyme, dNTPs, MgCl2, and an optimized buffer system, supporting simultaneous detection of FAM / ROX / CY5 triple fluorescence channels) and accompanying quality control materials.
[0011] The supporting quality control materials were constructed using homologous recombination technology: Utilizing the shuttle plasmid vector pBac-N-EGFP (Beyotime, catalog number D2805) and DH10Bac competent cells (Beyotime, catalog number D0346) system from Beyotime Biotechnology, artificial chromosomes were constructed through Tn7 transposon-mediated homologous recombination. The original application of this system was to transfer recombinant artificial chromosomes into insect cells and package them to produce recombinant baculoviruses. However, this technology only involves generating recombinant artificial chromosomes carrying the target gene through shuttle plasmid-mediated homologous recombination, representing another application of this system. It should be noted that the construction of recombinant artificial chromosomes in this invention is not limited to using the shuttle plasmid vector pBac-N-EGFP and DH10Bac competent cells; other shuttle plasmids and artificial chromosome systems can also achieve this technical objective. The specific steps for constructing the recombinant artificial chromosome are as follows: First, the shuttle plasmid pBac-N-EGFP vector was digested with EcoRI / HindIII. Then, the target gene fragments of the *Trypanosoma cruzi* minirepeat homologous sequence (SEQ ID NO: 1, 590 bp) and *Trypanosoma brevicornu* minirepeat homologous sequence (SEQ ID NO: 2, 584 bp) were amplified by PCR. The fragments were then ligated and transformed using In-Fusion HD enzyme for identification, and the recombinant shuttle plasmid was constructed. The resulting recombinant shuttle plasmid was transformed into DH10Bac competent cells. Positive clones carrying the target gene were obtained through blue-white screening on a medium containing kanamycin / tetracycline / gentamicin / X-Gal / IPTG. The engineered bacterial strain was then identified by PCR amplification and sequencing.
[0012] The quality control preparation process includes: heat inactivation after culturing engineered bacteria, and adjustment to five 10-fold gradient concentrations using phosphate buffered saline, while maintaining the integrity of the cell structure. DNA was extracted from the engineered bacteria quality control samples using a nucleic acid extraction kit, and the nucleic acid copy number was accurately determined by digital PCR (using an OmegaBAC / PAC kit for DNA extraction).
[0013] When the kit and quality control products are used together, the detection process includes: nucleic acid extraction (whole blood / serum / plasma samples are processed using a DNA / RNA purification kit), PCR amplification (reaction system: 20 μL premix + 5 μL nucleic acid extraction buffer; cycling conditions: 50℃ 2 min → 95℃ 5 min → 40 cycles (95℃ 10 s → 60℃ 20 s)), and results are interpreted based on the Ct values of the FAM / ROX / CY5 channels and the amplification curve. The core function of the quality control products includes establishing standard curves for quantitative detection using fluorescent PCR and digital PCR (meeting R...). 2 >0.99, amplification efficiency E=0.9~1.1), and full-process quality control (performance verification of nucleic acid extraction kit, monitoring of PCR accuracy and precision).
[0014] The technical advantages of this invention are mainly reflected in the following aspects: 1) The Trypanosoma dual-fluorescence PCR nucleic acid detection kit detects Trypanosoma cruzi and Trypanosoma brevicornuate simultaneously through dual-target typing, avoiding missed detection and improving detection throughput and efficiency; 2) The engineered bacteria quality control product has a cellular structure, which can well simulate the nucleic acid extraction characteristics of the sample, and the target gene avoids nuclease degradation; 3) The recombinant artificial chromosome exists stably in the engineered bacteria at a low copy number, with each engineered bacteria carrying only 1-2 copies of the artificial chromosome, resulting in good batch-to-batch consistency and overcoming the variability of natural pathogen culture and the instability of synthetic fragments. Compared with the hundreds of copies of general plasmids, the smallest detection unit is small, with high accuracy and good reliability; 4) After heat inactivation and buffer dilution, it has the ability to resist nuclease degradation and has good storage stability; 5) The copy number of the artificial chromosome is accurately labeled by digital PCR, ensuring the controllability and traceability of the concentration gradient (≥6 10-fold gradients); 6) The synergistic design of the kit and the quality control product realizes standardized quality control throughout the entire process. The quality control product is used to establish a real-time fluorescence quantitative PCR standard curve, covering the entire process monitoring from nucleic acid extraction to PCR amplification. 7) It can verify the performance of nucleic acid extraction kits (such as extraction efficiency and inhibitor tolerance) and be used for accuracy and precision quality control of fluorescent PCR and digital PCR. It can also provide standardized and reproducible testing tools for the clinical diagnosis of trypanosomiasis (such as Chagas disease and African sleeping sickness) and the safety monitoring of blood products, promoting inter-laboratory result recognition. Attached Figure Description
[0015] Figure 1 The figure shows the experimental results of cross-reactivity and competitive interference of the trypanosoma dual detection kit in Example 6 of the present invention.
[0016] Figure 2 The results show the linearity and amplification efficiency of Trypanosoma cruzi in the Trypanosoma dual detection kit of Example 7 of this invention.
[0017] Figure 3 The results show the linearity and amplification efficiency of Trypanosoma brucei in the Trypanosoma dual detection kit of Example 7 of this invention. Figure 4 The image shows the pBac-TCru-mr-M plasmid vector constructed in Example 8 of this invention, with only elements relevant to this application labeled.
[0018] Figure 5 The image shows the pBac-TBru-mr-M plasmid vector constructed in Example 8 of this invention, with only elements relevant to this application labeled.
[0019] Figure 6 The results of trypanosome quality control and plasmid nuclease treatment in Example 12 of this invention are shown.
[0020] Figure 7 This is the verification result of the extraction and monitoring capability of trypanosome quality control material and plasmid (E6 copies / mL) in Example 13 of the present invention.
[0021] Figure 8 This is the result of the stability verification of the trypanosome quality control sample and plasmid in Example 14 of the present invention. Detailed Implementation
[0022] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0023] definition
[0024] In this invention, the range of values represented by “value A ~ value B” or “value A - value B” refers to the range that includes the endpoint values A and B.
[0025] In this invention, the numerical range indicated by "above" or "below" refers to the numerical range that includes the stated number.
[0026] In this invention, the word "may" has both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the case where the event occurs and the case where the event does not occur.
[0027] In this invention, the terms "a", "an", or "the" may refer to "one", "one or more", "at least one", or "one or more".
[0028] In this invention, the terms "comprising," "having," "including," or "containing" can mean included or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising," "having," "including," or "containing" can also mean closed-ended, excluding additional, uncited elements or method steps.
[0029] In this invention, the term "about" can mean that a value includes the standard deviation of the error of the apparatus or method used to determine that value. The numerical ranges and parameters used to define the present invention are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains a standard deviation due to the aforementioned testing apparatus or method. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this invention are modified with "about". Here, "about" generally means that the actual value is within ±10%, ±5%, ±1%, or ±0.5% of a particular value or range.
[0030] In this invention, "target gene" refers to the gene targeted by nucleic acid detection. For example, when nucleic acid detection is performed using PCR, the target gene includes the gene fragment to be amplified by PCR.
[0031] In this invention, a "vector" is a replicon, such as a plasmid, bacteriophage, virus, artificial chromosome, or granule, to which another DNA segment (i.e., an "insertion") may be attached to the replicon to induce replication of the attached segment in the cell. Further, the vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; (2) a structural or coding sequence transcribed into mRNA and translated into protein; and (3) a transcriptional subunit containing appropriate transcription and translation initiation and termination sequences.
[0032] In this invention, the shuttle plasmid vector pBac-N-EGFP (from Beyotime Biotechnology, catalog number D2805) is originally used to transfer recombinant artificial chromosomes into insect cells to package and produce recombinant baculoviruses. However, this application only involves generating recombinant artificial chromosomes carrying the target gene through homologous recombination mediated by the shuttle plasmid, representing another application of this system. It should be noted that the construction of recombinant artificial chromosomes in this invention is not limited to using the shuttle plasmid vector pBac-N-EGFP and DH10Bac competent cells; other shuttle plasmids and artificial chromosome systems can also achieve this technical objective. This vector possesses an E. coli replication origin and selection marker, enabling it to survive and replicate in E. coli. Furthermore, "engineered bacteria carrying artificial chromosomes" refers to E. coli engineered bacteria carrying minirepeat identical sequences of Trypanosoma cruzi (TCru) and Trypanosoma buddleia (TBru).
[0033] In this invention, "consistent sequence," "optimized sequence," or "consistent optimized sequence" refers to a representative nucleotide sequence generated by performing site-specific statistical analysis on a set of functional or evolutionarily related nucleotide sequences using multiple sequence alignment (MSA) technology.
[0034] In this invention, a "standard curve conforming to the requirements of real-time quantitative PCR quantitative detection" refers to a linear relationship curve between the cycle threshold (Ct value) and the logarithm of the initial template concentration, established after amplification of a known concentration of standard (such as plasmid DNA or purified PCR product) by serially diluting it and performing real-time quantitative PCR. This standard curve must meet the requirements of the specification "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods: qPCR and dPCR" (GB / T42077-2022), i.e., a linear correlation coefficient (R²) of [missing information]. 2 The amplification efficiency (E) was greater than 0.99 and within the range of 0.9 to 1.1, to verify the accuracy, sensitivity and quantitative reliability of the detection system.
[0035] Unless otherwise defined, other technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0036] The consensus sequence of the Trypanosoma cruzi (T. Cru) minirepeat gene in this application: GGGATTATGGTGGGTATGATAGAATGGTAGAATATAGTTAGTTGATATGATTATAATATGTGTACAGAACTGTGATGAATGTAGTGGAGTTACTTAATGAAAGTGTATCTGAAGTTTGTGAATTGTATTATTAAAGTTTGTTATAATTGTTTGAATAAAGGTGTTGTGGTGGCATGTGGGTTTGTTGTCGACCAGTGGATACATTATGAGGGTGGAAATTTCGAAAATGTTGGTTTTGGGAGGGGCGTTCAAATTTGGGCCCGAAAAATCATGCATCTCCCCCGTACATTATTTGGCCGAAAATGGGGGTTGTTTACGGGAGGTGGGGTTCGATTGGGGTTGGTGTAATATAGGCACTATGTGTGAGTTGGAGGGGTGTATAGTATAATAGTTTATGATTGAGATAGAGTTATATATGTGATAGTGACGTGTTTGAGTGGATAAAGATAATATTCTTGAGATTGTTACTGATTAAGTTTAGTGTATATATGATCTATTGTGTAATTCTTTAATTATATATTTAGTTGTTTGGATTGGTGTAGGTTGTGGTAGTTAGGTGTTGCCTGCAATAAAAGGGGGTTTGGGAATTC (SEQ ID NO:1).
[0037] The consensus sequence of the minirepeat gene of Trypanosoma brucei (T. Bru):
[0038] AAACCCAAAATCTTATGGGCGTGCAAAAATACACATACACAAATCCCGTGCTATTTTGGGCCATTTTTTAGGTCCGAGGTACTTCGAAAGGGGTTGGTGTAATACACACATGGTTTTTCCTCGAGATTTCAGGGTTTTGGGGTGATATCTAGTGTAATTAATATTGTGTTTTTATAGTCTACTTAAGGAATAAAATATAGTAATAGATAAATATATAAGTTAGATATATAGCAATTATAATTAAACTGAAGAGGTTATAATACCTCGAAACTCGCGGTGATGATTTTATATTTATTTCTTATATTACTATTTATTAATTTATTCTCATTCTCGGGATTACCTAGTGGGAAAGAAATGAGATAATAGATATGTATTGTAGTATTATAATGATATATATAGATATAAGATCAACAAAACTGCCATTTTCTATAGTGAGTGATGATATATTATAATTAAATGATATTATTATTAAAATCTATTTATTATTTTATTTATTTATGGAGGATGAAATTAATGGGATTATTCGGTGGTAGAGTGGGATTAATGTGATAAATACTGCTTCATATCTGCGTCTAGAAAGGTAA(SEQ ID NO:2).
[0039] Internal standard RNase-P gene target sequence:
[0040] ATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGC(SEQ ID NO:3).
[0041] Nucleotide sequence of primer TCru-mr-M-F:
[0042] TCCAGGGTCCTAGATCTGAATTCGGGATTATGGTGGGTATGATAGAA(SEQ ID NO:4).
[0043] Nucleotide sequence of primer TCru-mr-M-R:
[0044] CTCTAGTACTTCTCGACAAGCTTGAATTCCCAAACCCCCTTT (SEQ ID NO: 5).
[0045] Nucleotide sequence of primer TBru-mr-MF:
[0046] TCCAGGGTCCTAGATCTGAATTCAAACCCAAAATCTTATGGGCG (SEQ ID NO: 6).
[0047] Nucleotide sequence of primer TBru-mr-MR:
[0048] CTCTAGTACTTCTCGACAAGCTTTTACCTTTCTAGACGCAGATATGA (SEQ ID NO: 7).
[0049] pUC / M13-F primer sequence: CCCAGTCACGACGTTGTAAAACG (SEQ ID NO:8).
[0050] pUC / M13-R primer sequence: AGCGGATAACAATTTCACACAGG (SEQ ID NO:9).
[0051] Upstream primer sequence for fluorescent PCR of Trypanosoma cruzi (TCru): CATGCATCTCCCCCGTACAT (SEQ ID NO:10).
[0052] Trypanosoma cruzi (TCru) fluorescent PCR probe sequence: CGAACCCCACCTCC (SEQ ID NO:11).
[0053] The downstream primer sequence for fluorescent PCR of Trypanosoma cruzi (TCru) is: CTATATACACCAACCCCAA (SEQ ID NO:12).
[0054] upstream primer sequence for Trypanosoma brucelli (TBru) fluorescent PCR:
[0055] CGTGCAAAAATACACATACACAAATCC (SEQ ID NO: 22).
[0056] Trypanosoma Brückie (TBru) fluorescent PCR probe sequence: CGAAGTACCTCGGACCT (SEQ ID NO:23).
[0057] Downstream primer sequence for fluorescent PCR of Trypanosoma Brückie (TBru): TGTGTGTATTACACCAACCCCT (SEQ ID NO:24).
[0058] The upstream primer sequence for the internal standard RNase-P gene fluorescent PCR is: ATGGCGGTGTTTGCAGATTTG (SEQ ID NO:34).
[0059] Internal standard RNase-P gene fluorescent PCR probe sequence: TTCTGACCTGAAGGCTCTGCG (SEQ ID NO:35).
[0060] The downstream primer sequence for the internal standard RNase-P gene fluorescent PCR is: GCGGCTGTCTCCACAAGT (SEQ ID NO:36).
[0061] The method for preparing artificial chromosomes of engineered bacteria is as follows:
[0062] 1. Sequence acquisition and vector digestion and recovery
[0063] - Synthesized minirepeat identical sequences (SEQ ID NO:1 / 2) of Trypanosoma cruzi (TCru) and Trypanosoma buderi (TBru), with lengths of 590 bp and 584 bp, respectively.
[0064] - The fragment was amplified using specific primers (SEQ ID NO: 3-6) and Q5 enzyme (NEB, catalog number M0493L).
[0065] - The pBac-N-EGFP vector was digested with EcoRI / HindIII. The reaction mixture consisted of 5 μL of 10×M buffer, 1 μL of each restriction enzyme, 1.5 μg of plasmid, and ddH2O to a final volume of 50 μL. The mixture was then incubated at 37°C for 3 h.
[0066] - Gel recovery and purification of amplified fragments and linear vectors.
[0067] 2. Seamlessly connect and construct recombinant plasmids
[0068] - The TCru-mr-M / TBru-mr-M fragments were ligated to the pBac linear vector. The system consisted of 2 μL of 5×In-FusionHDEnzymePremix, 2 μL of vector, 2 μL of fragment, and 4 μL of ddH2O. The reaction was carried out at 50 °C for 15 min.
[0069] - Obtain recombinant plasmids pBac-TCru-mr-M and pBac-TBru-mr-M.
[0070] 3. Plasmid transformation and positive clone screening
[0071] - The ligation product was transformed into DH5α competent cells (Takara, catalog number 9057), plated on ampicillin-resistant LB plates, and cultured overnight at 32-37°C.
[0072] - Plasmids were extracted using the alkaline lysis method, purified by column chromatography, and positive clones were identified by PCR and verified by sequencing.
[0073] 4. Construction of engineered bacteria for artificial chromosomes
[0074] - The recombinant plasmid was transferred into DH10Bac competent cells (Beyotime, D0346) containing the bMON14272 vector and helper plasmid, and an artificial chromosome was formed through mini-Tn7 transposition.
[0075] - White clones were selected using blue-white screening (LB medium containing kanamycin / tetracycline / gentamicin / X-Gal / IPTG).
[0076] - Positive colonies were inoculated into liquid LB medium (containing the same antibiotic) and cultured at 37°C to obtain engineered bacteria.
[0077] -The DNA of the engineered bacteria was extracted using a nucleic acid extraction kit (Omega, catalog number D2156), verified by PCR using pUC / M13 primers (SEQ ID NO:8 / 9), and sequenced. The qualified strains were then preserved.
[0078] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified, specific conditions in the examples are performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all materials and instruments used are conventional products that can be purchased.
[0079] Example 1: Trypanosome Sequence Optimization
[0080] 1.1 Selection design of mr sequences for Trypanosoma cruzi (TCru) and Trypanosoma brucellum (TBru): First, bioinformatics methods were used to obtain minirepeat sequences of Trypanosoma cruzi and Trypanosoma brucellum from the authoritative database NCBI. Multiple sequence alignment tools MAFFT and ClustalOmega software were used to perform multiple alignments on the selected sequences to remove obvious insertion and deletion regions, ensuring the accuracy and consistency of the alignment. Attention was paid to avoiding crossover with host or other non-target pathogen sequences in characteristic conserved regions.
[0081] 1.2 Synthesis of Minirepeat Optimized Conserved Sequences: Minirepeat sequences of Trypanosoma cruzi and Trypanosoma brevicornu were aligned to obtain the final optimized conserved minirepeat sequences for Trypanosoma cruzi and Trypanosoma brevicornu, abbreviated as TCru-mr-M and TBru-mr-M, respectively. Genome assembly was performed according to the start and stop sites of the minirepeat conserved sequences, resulting in sequences of 590 bp and 580 bp in length (as shown in Table 1, SEQ ID NO:1 and SEQ ID NO:2). These sequences were sent to GenScript Biotech Co., Ltd. for synthesis, yielding conventional pUC plasmids containing the target fragments of the Trypanosoma minirepeat optimized conserved sequences (named pUC57-TCru-mr-M and pUC57-TBru-mr-M). Simultaneously, the human RNase-P housekeeping gene target sequence was synthesized as an internal control sequence, resulting in the target sequences shown in Table 1.
[0082] Table 1. Optimized conserved sequences and internal standard sequences of Trypanosoma cruzi and Trypanosoma brevicornu. (minirepeat)
[0083]
[0084] Example 2: Design of primer and probe sets for dual nucleic acid detection of Trypanosoma japonicum
[0085] Mini-repeat sequences of *Trypanosoma cruzi* and *Trypanosoma brevicornu* were obtained from the NCBI database. Highly conserved and specific regions were selected as target sequences to ensure that primers and probes could specifically recognize *Trypanosoma cruzi* and *Trypanosoma brevicornu*. Preliminary primer and probe designs were performed on the target sequences using professional primer design software (Oligo 7.0). The software automatically generates a large number of candidate primer and probe sequences based on the input sequences. The initially generated candidate sequences were then screened according to design principles. Specific screening criteria are as follows:
[0086] PCR product size: Select primer pairs that can amplify products of 50-150 bp. This product size helps improve reaction sensitivity and amplification efficiency.
[0087] GC content: Screen primer and probe sequences with GC content between 30% and 80%. Appropriate GC content ensures the stability of primer and probe binding to the template.
[0088] Repeated sequences: Primers and probes containing more than four consecutive G repeats were removed. Consecutive G repeats may cause primers or probes to form secondary structures, affecting amplification efficiency.
[0089] TM value: Select sequences with a probe TM value of 68-70℃ and a primer TM value of 58-60℃. An appropriate range of TM values helps ensure specific binding of primers and probes in the PCR reaction.
[0090] Length requirements: Select probe sequences with a length of 13-30 bp and primer sequences with a length of approximately 20 bp. Appropriate lengths ensure the specificity and binding ability of the primers and probes.
[0091] Base distribution:
[0092] The probe should avoid six consecutive A's, and the 5' end should not start with a G. The number of G's in the first four sequences of the 3' end of the probe should not exceed three.
[0093] After the above screening process, primer and probe combinations for detecting Trypanosoma cruzi, Trypanosoma brevicornu, and the internal standard RNase-P gene were obtained (see Tables 2.1, 2.2, and 2.3).
[0094] Table 2.1 Primer and probe combinations for Trypanosoma cruzi nucleic acid detection
[0095]
[0096] Table 2.2 Primer and probe combinations for Trypanosoma brevicornu nucleic acid detection
[0097]
[0098] Table 2.3 Primers and probes for internal standard RNase-P gene nucleic acid detection
[0099] sequence name Sequence (5′-3′) RNase-PF ATGGCGGTGTTTGCAGATTTG(SEQ ID NO:34) RNase-P-PB CY5-TTCTGACCTGAAGGCTCTGCG-BHQ2(SEQ ID NO:35) RNase-PF GCGGCTGTCTCCACAAGT(SEQ ID NO:36)
[0100] Example 3: Screening of primer and probe sets for dual nucleic acid detection of Trypanosoma japonicum
[0101] To screen specific primer-probe combinations for Trypanosoma cruzi and Trypanosoma brevicornu, a highly sensitive, cross-reactive dual real-time fluorescent PCR detection system was established. Four primer-probe combinations were designed for real-time fluorescent PCR performance screening. The optimal combination was determined by evaluating amplification efficiency (acceptable range 90%-110%), Ct value, whether the amplification curve was S-shaped, fluorescence signal increment (greater than 1000), whether the blank control showed a line, cross-reactivity (testing Trypanosoma cruzi, Trypanosoma brevicornu, and human genomes), competitive interference (testing Trypanosoma cruzi, Trypanosoma brevicornu, and internal standard), and sensitivity (limit of detection lower than 500 copies / ml).
[0102] Trypanosoma cruzi primer-probe combination 1 met all performance indicators. Combinations 2 and 4 were excluded due to unacceptable fluorescence signal increment values. Although combination 3 met the performance indicators such as amplification efficiency and fluorescence signal increment values, it was excluded due to competitive interference from Trypanosoma bournei. The results are shown in Table 3.1. Therefore, Trypanosoma cruzi primer-probe combination 1 was selected as the primer-probe combination for the trypanosoma dual nucleic acid detection system, and its sequence will be directly used in the construction of the detection kit in the claims.
[0103] Table 3.1 Results of primer and probe screening for Trypanosoma cruzi
[0104]
[0105] Trypanosoma brevicornu primer-probe combination 1 met all performance indicators. Combination 2 was excluded because the S-shaped amplification curve was not typical enough. Although combination 3 met the performance indicators such as amplification efficiency, fluorescence signal increment, and S-shaped amplification curve, it was excluded due to competitive interference from Trypanosoma brevicornu. Combination 4 was excluded because the fluorescence signal increment was unqualified. The results are shown in Table 3.2. Therefore, Trypanosoma brevicornu primer-probe combination 1 was selected as the primer-probe combination for the trypanosoma dual nucleic acid detection system, and its sequence will be directly used in the construction of the detection kit in the claims.
[0106] Table 3.2 Results of primer and probe screening for Trypanosoma brevicornu
[0107]
[0108] Example 4: Kit for Dual Nucleic Acid Detection of Trypanosoma
[0109] This embodiment provides a kit for dual nucleic acid detection of Trypanosoma cruzi and Trypanosoma brevicornu. The kit consists of a PCR premix (containing hot-start DNA polymerase, UNG, PCR buffer, MgCl2, dNTPs, and the primer / probe set screened in Example 3), a positive control, and a negative control. The PCR reaction solution consists of 2xFastAmpliPremix-UNGIV (ProbeqPCR) (12.5 μL), TCru-mr-F1 (10 μM, 0.5 μL), and TCru-mr-R1 (…). 10μM, 0.5μL), TCru-mr-PB1 (10μM, 0.25μL), TBru-mr-F1 (10μM, 0.5μL), TBru-mr-R1 (10μM, 0.5μL), TBru-mr-PB1 (10μ M, 0.25μL), RNaseP-F (10μM, 0.5μL), RNaseP-R (10μM, 0.5μL) and RNaseP-PB (10μM, 0.25μL) and DNase / RNase-freeWater.
[0110] The positive control consists of plasmids containing Trypanosoma cruzi, Trypanosoma brevicornu, and an internal standard detection target plasmid. The specific preparation method is as follows: take a plasmid stock solution with an initial concentration of 1 ng / μL, and dilute it 10-fold in four steps to obtain the positive control working solution.
[0111] The negative control was DNase / RNase-free Water.
[0112] Example 5: A method for detecting trypanosome dual nucleic acid
[0113] This embodiment provides a method for dual nucleic acid detection of Trypanosoma cruzi and Trypanosoma brevicornu. The method uses the kit from Example 4 and includes the following steps:
[0114] Step 1: Extract the nucleic acid from the sample to be tested (such as whole blood sample, serum or plasma sample) using a viral DNA / RNA purification kit to obtain the nucleic acid extract;
[0115] Step 2: Mix 5 μL of nucleic acid extract, 5 μL of negative control, and 5 μL of positive control with 20 μL of PCR premix, and perform fluorescent PCR using a fluorescent PCR instrument (reaction system and conditions are shown in Tables 5.1 and 5.2). Select the FAM, ROX, and CY5 channels for real-time fluorescence signal acquisition. Based on the acquired real-time fluorescence signals, refer to the positive and negative controls to determine whether trypanosomiasis infection exists in the test sample (when analyzing the results, the baseline fluorescence signal is taken as 3-10 or 6-15 cycles, and the threshold is set so that the threshold line just exceeds the highest point of the normal negative control amplification curve). The normal results of the positive and negative controls are shown in Table 5.3, and the criteria for judging whether trypanosomiasis infection exists in the test sample are shown in Table 5.4.
[0116] Table 5.1 PCR reaction system
[0117] Components Added amount PCR premix 20μL sample 5μL
[0118] Table 5.2 PCR reaction conditions
[0119]
[0120] Table 5.3 Normal results for positive and negative controls
[0121]
[0122] Table 5.4 Criteria for Judging Trypanosoma Dual Nucleic Acid Detection
[0123]
[0124] Example 6: Cross-reactivity validation of the trypanosome dual detection kit
[0125] This experiment aimed to verify the specificity of the kit for *Trypanosoma cruzi* (TCru) and *Trypanosoma buderi* (TBru) targets, ensuring no cross-reactivity between the dual-channel (FAM / ROX) assay. Experimental materials included: plasmids pUC57-TCru-mr-M (SEQ ID NO:1) containing the TCruminirepeat sequence, pUC57-TBru-mr-M (SEQ ID NO:2) containing the TBruminirepeat sequence, the dual detection kit constructed in Example 4 (containing primer and probe sets SEQ ID NO:10-12 and 22-24), a negative control (DNase / RNase-freeWater), and the internal control RNase-P gene (SEQ ID NO:34-36). Target plasmids (concentration 1×10⁻⁶) were directly used. 6 Samples were taken in duplicate (copies / μL) and tested according to the Q-PCR system (Table 5.1) and conditions (Table 5.2) of Example 5: the FAM channel used the TCru probe (SEQ ID NO:11), the ROX channel used the TBru probe (SEQ ID NO:23), and the CY5 channel used the internal standard probe (SEQ ID NO:35). Each sample was repeated 3 times. The results are shown in Table 6 and... Figure 1 As shown, pUC57-TCru-mr-M was specifically detected in the FAM channel, with no signal in the ROX channel; pUC57-TBru-mr-M was specifically detected in the ROX channel, with no signal in the FAM channel; the negative control was not detected in either channel; the internal standard channel was effective in all samples (Ct≤35). The conclusion indicates that the trypanosomiasis dual reagent kit of the present invention has been verified to have no cross-reactivity and meets the clinical specificity criteria (based on the screening criteria of Example 3 and the judgment threshold Ct≤35 of Example 5).
[0126] Table 6. Validation results of cross-reactivity and competitive interference of the trypanosomiasis dual detection kit.
[0127]
[0128] Example 7: Amplification efficiency and linearity of the trypanosome dual detection kit
[0129] The engineered bacterial quality control sample was serially diluted 10-fold at an initial concentration of 3.5E+08 copies / mL five times to obtain a series of serially diluted products. After nucleic acid extraction, the products were detected by q-PCR using the Trypanosoma dual detection kit of this invention (qPCR reaction conditions were the same as in Example 5), with two replicates for each concentration. The results are shown in Table 7. Figure 2 and Figure 3 As shown, according to the "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods (qPCR and dPCR)" (GB / T42077-2022), the linear correlation coefficient and amplification efficiency of the engineered bacteria quality control samples both met the standards (R0).2 >0.99, amplification efficiency E in the range of 90%-110%. This shows that the Trypanosoma dual detection kit of the present invention has good linearity and amplification efficiency.
[0130] Table 7. Amplification efficiency and linearity results of the trypanosome dual detection kit.
[0131]
[0132] Example 8: Construction of trypanosome plasmid vectors pBac-TCru-mr-M and pBac-TBru-mr-M
[0133] 8.1 PCR amplification, purification, and recovery of optimized sequences of Trypanosoma TCru-mr-M and TBru-mr-M
[0134] Table 8.1 Nucleotide sequences of amplification primers for the designed sequences
[0135]
[0136] Primers TCru-mr-MF / R (SEQ ID NO:3 and SEQ ID NO:4) and TBru-mr-MF / R (SEQ ID NO:5 and SEQ ID NO:6) were designed for plasmid vector construction, as shown in Table 8.1. PCR amplification was performed using the primers in Table 8.1 to synthesize fragments with lengths of 590 bp and 584 bp, as shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The PCR reaction system is shown in Table 8.2 below.
[0137] Table 8.2 PCR reaction system
[0138]
[0139] The PCR reaction procedure is shown in Table 8.3 below.
[0140] Table 8.3 PCR reaction procedure
[0141]
[0142] After the reaction was completed, the amplification product was subjected to agarose gel electrophoresis, and the target fragment was purified and recovered using a Takara gel recovery kit.
[0143] 8.2 Preparation of the linear vector pBac-N-EGFP for plasmids
[0144] The plasmid pBac-N-EGFP was double-digested with the restriction endonucleases HindIII and EcoRI. The digestion reaction system is shown in Table 8.4 below.
[0145] Table 8.4 Enzyme digestion reaction system
[0146] Components Added amount pBac1-N-EGFP plasmid 1.5μg EcoRI restriction endonuclease 1.0μL HindIII restriction endonuclease 1.0μL 10×M buffer 5.0μL <![CDATA[ddH2O]]> Add to 50μL
[0147] The enzyme digestion reaction procedure is shown in Table 8.5 below.
[0148] Table 8.5 Enzyme digestion reaction procedure
[0149] temperature time 37℃ 3h
[0150] The linear vector pBac-N-EGFP was purified and recovered using a Takara gel recovery kit and used for fragment ligation.
[0151] 8.3 Ligation of linear vectors with target fragments
[0152] Using Takara's homologous recombination kit HDCloningPlus seamlessly ligates the target fragment TCru-mr-M (SEQ ID NO:1) or TBru-mr-M (SEQ ID NO:2) into the linear vector pBac-N-EGFP. The 10 μL reaction mixture is shown in Table 8.6 below, and ligation is performed at 50°C for 15 minutes.
[0153] Table 8.6 Connection Reaction System
[0154] Components Added amount 5×In-FusionHDEnzymePremix 2μL Target fragment TCru-mr-M or TBru-mr-M 50-100ng linear vector pBac-N-EGFP 50-100ng
[0155] 8.4 Transformation
[0156] The ligation product was added to Takara competent E. coli DH5α competent cells and mixed gently. After incubating on ice for 10-30 minutes, the cells were placed in a 42°C water bath for 30-60 seconds, then immediately removed and placed on ice for 2-5 minutes. 700 μL of SOC medium (pre-incubated at 37°C) was added, and the cells were incubated at 37°C with shaking for 1 hour (180 rpm). An appropriate amount was then spread onto LB solid medium (ampicillin, Amp, final concentration 100 μg / mL), and the plates were incubated upside down at 37°C overnight.
[0157] 8.5 Identification of positive plasmids
[0158] Four monoclonal bacteria were selected for culture PCR. The primers are shown in Table 8.7 below:
[0159] Table 8.7 Primer Sequences
[0160] Primer name Primer sequences (5′-3′) TCru-mr-MF TCCAGGGTCCTAGATCTGAATTCTAATGATCCTTCCGCAGGTTCAC(SEQ ID NO:4) TCru-mr-MR CTCTAGTACTTCTCGACAAGCTTAACCTGGTTGATCTTGCCAGT(SEQ ID NO:5) TBru-mr-MF TCCAGGGTCCTAGATCTGAATTCAAACCCAAAATCTTATGGGCG (SEQ ID NO: 6) TBru-mr-MR CTCTAGTACTTCTCGACAAGCTTTTACCTTTCTAGACGCAGATATGA(SEQ ID NO:7)
[0161] The PCR reaction system is shown in Table 8.8 below:
[0162] Table 8.8 PCR Reaction System
[0163]
[0164] The PCR reaction procedure is shown in Table 8.9 below:
[0165] Table 8.9 PCR Reaction Procedure
[0166]
[0167] After the reaction, a small amount of amplification product was taken for agarose gel electrophoresis. The results showed that all four single clones produced the corresponding target bands. Sequencing analysis identified the positive clones whose sequences matched TCru-mr-M (SEQ ID NO:1) or TBru-mr-M (SEQ ID NO:2), and these were named pBac-TCru-mr-M and pBac-TBru-mr-M plasmid vectors, respectively. The chromatograms are shown below. Figure 4 , Figure 5 As shown.
[0168] Example 9: Construction and PCR Verification of Engineered Bacteria Carrying Artificial Chromosomes
[0169] 9.1 Construction of engineered bacteria carrying artificial chromosomes:
[0170] Add 100 ng of pBac-TCru-mr-M or pBac-TBru-mr-M plasmid to competent DH10Bac cells and incubate on ice for 30 min. Heat shock in a 42℃ water bath for 50-100 s, then immediately place on ice for 2-5 min. Add 700 μL of LB medium and incubate at 37℃ with a shaker at 200 rpm for 2-4 h. Spread 200 μL of the cultured bacterial solution evenly onto LB fixation medium containing 50 μg / mL Kan, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plates and incubate at 37℃ for 24-72 h.
[0171] Select positive white monoclonal colonies and place them into 3-5 mL of LB liquid medium containing 50 μg / mL Kan, 7 μg / mL tetracycline, and 10 μg / mL gentamicin. Incubate at 37°C and 200 rpm for 20-30 h. Extract artificial chromosome DNA from the engineered bacteria using the OmegaBAC / PAC large basic plasmid extraction kit.
[0172] 9.2 PCR verification of engineered bacteria using artificial chromosomes:
[0173] Using 1 μg of engineered bacterial artificial chromosome DNA as a template, PCR verification and sequencing were performed using pUC / M13-F (CCCAGTCACGACGTTGTAAAACG) (SEQ ID NO:8) and pUC / M13-R (AGCGGATAACAATTTCACACAGG) (SEQ ID NO:9) as primers. After confirming the PCR identification and sequencing alignment were correct, the next step of the experiment was performed. The PCR verification system was as follows: 25 μL of 2×T5 buffer, 23 μL of ddH2O, 1 μL each of 10 μmol / L pUC / M13 upstream primer, and 1 μg of artificial chromosome DNA.
[0174] The PCR amplification reaction conditions are shown in Table 9.1 below:
[0175] Table 9.1 PCR reaction conditions
[0176]
[0177] The PCR verification results of the artificial chromosome DNA of the engineered bacteria were correct, containing the target gene and part of the vector linker region sequence. The PCR product was sequenced and identified, and the sequence was consistent with TCru-mr-M (SEQ ID NO:1) or TBru-mr-M (SEQ ID NO:2), indicating that the engineered bacteria carrying the artificial chromosome was successfully constructed.
[0178] Example 10: Preservation and Use of Engineered Bacterial Strains Carrying Artificial Chromosomes
[0179] 10.1 Preservation of engineered bacterial strains carrying artificial chromosomes:
[0180] First, prepare the bacterial culture preservation solution: aliquot and sterilize glycerol and LB liquid medium to prepare LB medium with a final concentration of 50 μg / mL Kansin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin, and use it to dilute the glycerol (ratio 1:1); take 500 μL of the bacterial culture for preservation, add 500 μL of diluted glycerol, mix well, place in a 1.5 mL EP tube, and label with the strain number, strain name, preservation date, operator, and other information; then store the glycerol-containing bacteria backup in a -80℃ freezer.
[0181] 10.2 Instructions for using engineered bacteria carrying artificial chromosomes:
[0182] Remove the glycerol bacteria and rewarm them at room temperature or 2–8°C until thawed. Spread a small amount of the bacterial suspension onto a plate and incubate in LB broth containing 50 μg / mL Kan, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plate and incubate at 37°C for 24–48 hours. Pick positive white monoclonal colonies and transfer them to 3–5 mL of LB liquid broth containing 50 μg / mL Kan, 7 μg / mL tetracycline, and 10 μg / mL gentamicin. Incubate at 37°C and 200 rpm for 20–30 hours. The bacterial suspension is used to extract artificial chromosome DNA for subsequent quality control testing.
[0183] Example 11: Preparation and Production of Raw Materials and Finished Products for Engineered Microorganism Quality Control Products
[0184] 11.1 Heat inactivation of engineered bacterial cultures carrying artificial chromosomes
[0185] Place the centrifuge tubes containing the engineered bacterial culture into a 60°C water bath. Ensure a tight seal to prevent leakage during heating. After heating for 1 hour, remove the inactivated culture as raw material for quality control of the engineered bacteria.
[0186] 11.2 Extraction and preparation of bacterial artificial chromosome DNA
[0187] The engineered bacterial control samples were serially diluted with phosphate-buffered saline to obtain sufficient concentrations of engineered bacteria. Nucleic acid was extracted from the engineered bacterial control samples at different concentrations using the MagaBioplus Viral DNA / RNA Purification Kit (Hangzhou Bori Technology Co., Ltd., catalog number BSC86S1E). Following the kit instructions, purified nucleic acid solutions were finally obtained.
[0188] 11.3 Digital PCR (ddPCR) Assay
[0189] Using the extracted nucleic acid as a template, prepare a reaction system containing the nucleic acid template, ddPCR reaction premix, primers, and probes, referring to the finished kit, ensuring accurate proportions of each component. Transfer the prepared reaction system to a digital PCR instrument for testing (ddPCR reaction system and conditions are shown in Tables 11.1 and 11.2) to directly obtain the absolute concentration of the target nucleic acid in the sample, thereby calculating the nucleic acid concentration in the engineered bacterial quality control sample.
[0190] Table 11.1 ddPCR reaction system
[0191] Components Added amount PCR reaction solution 19μL enzyme mixture 1μL sample 5μL
[0192] Table 11.2 ddPCR reaction conditions
[0193]
[0194] 11.4 Preparation of engineered microbial quality control products
[0195] The raw materials of Trypanosoma cruzi and Trypanosoma brevicornu at known concentrations were mixed and diluted 1:1 according to the set values to obtain the final Trypanosoma engineered bacteria quality control products of different concentrations.
[0196] Example 12: Verification of nuclease tolerance in engineered bacterial quality control samples
[0197] The engineered bacterial control samples prepared in Example 11 and the conventional plasmids pUC57-TCru-mr-M and pUC57-TBru-mr-M from Example 1 (hereinafter referred to as plasmids) (both E8 copies / mL) were digested with Thermo#EN0521 DNase I at 37°C for 30 min (working concentration: 0.1 U per ng of nucleic acid), followed by inactivation at 70°C for 10 min. A control group without any treatment was also included. Each group was tested in duplicate. The samples were then cumulatively diluted 100-fold and subjected to Q-PCR detection using the trypanosomiasis dual detection kit of this invention (QPCR reaction conditions were the same as in Example 5). Each sample was tested twice. The results are as follows: Figure 6 As shown in Table 12.3, there was no difference in the Q-PCR results of the engineered bacteria quality control samples before and after DNaseI digestion, while the results of the plasmids before and after DNaseI digestion were very different. This indicates that the engineered trypanosome quality control samples prepared in this invention have superior nuclease tolerance, which is much higher than that of conventional plasmids.
[0198] Table 12.1 Data on the nuclease treatment results of Trypanosoma brevicornu plasmids and Trypanosoma quality control samples
[0199]
[0200] Table 12.2 Data on the results of nuclease treatment of Trypanosoma cruzi plasmids and Trypanosoma quality control samples.
[0201]
[0202] Example 13: Verification of the ability of engineered bacteria quality control samples to monitor nucleic acid extraction
[0203] Using the Trypanosoma dual detection kit of the present invention, nucleic acid extraction and non-extraction comparison tests were performed on the quality control samples of engineered Trypanosoma bacteria at concentrations of 5.00E+06 copies / mL and 5.00E+03 copies / mL, and the pUC57-TCru-mr-M and pUC57-TBru-mr-M plasmids, respectively (qPCR reaction conditions are the same as in Example 5). The results are shown in Table 13. Figure 7As shown, the quality control product of engineered trypanosomes must undergo nucleic acid extraction to be detected; without nucleic acid extraction, it cannot be detected normally. However, the plasmid can be detected regardless of whether nucleic acid extraction has been performed, and the Ct value is the same. This indicates that the quality control product of engineered trypanosomes prepared in this invention can effectively monitor the nucleic acid extraction process, which is not possible with conventional plasmids.
[0204] Table 13.1 Data table of verification results for the extraction and monitoring capabilities of Trypanosoma brevicornu plasmids and Trypanosoma quality control samples.
[0205]
[0206] Table 13.2 Data table of verification results for the extraction and monitoring capabilities of Trypanosoma cruzi plasmids and Trypanosoma quality control samples.
[0207]
[0208] Example 14: Stability test of engineered microbial quality control samples
[0209] Referring to standard JJF1343-2022 "Assignment and Homogeneity and Stability Assessment of Standard Reference Materials", stability was assessed by storing the sample at three different temperatures: 4℃, 25℃, and 37℃ at two time points (0 days and 3 days). Two units were sampled from each temperature at each time point, and qPCR was used for detection (qPCR reaction conditions were the same as in Example 6). Each unit was tested twice. The test results are shown in Table 14 and... Figure 8 As shown, the test results of the engineered trypanosome quality control samples showed no significant differences after storage at different temperatures; however, the Ct of the plasmid decreased after storage at 4℃, and gradually increased after storage at 25℃ and 37℃. This indicates that the engineered trypanosome quality control samples prepared in this invention have outstanding and excellent stability, while conventional plasmids have poor stability.
[0210] Table 14 Statistical results of Ct values for the storage stability of engineered bacterial quality control samples and plasmids at 4℃, 25℃, and 37℃.
[0211]
Claims
1. A primer for multiplex fluorescent PCR nucleic acid detection of Trypanosoma japonicum, characterized in that: The primers used for multiplex fluorescent PCR nucleic acid detection of Trypanosoma are Trypanosoma cruzi and / or Trypanosoma brevicornu primers; When the primers used for the multiplex fluorescent PCR nucleic acid detection of Trypanosoma cruzi are Trypanosoma cruzi primers, the Trypanosoma cruzi primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:10 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:12; The probe sequence used for amplifying the Trypanosoma cruzi primer is SEQ ID NO:11; When the primers used for the multiplex fluorescent PCR nucleic acid detection of Trypanosoma brevicornu primers are Trypanosoma brevicornu primers, the Trypanosoma brevicornu primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:22 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:24; The probe sequence used for amplifying the Trypanosoma brevicornu primer is SEQ ID NO:
23.
2. The primers for trypanosome multiplex fluorescent PCR nucleic acid detection as described in claim 1, characterized in that: The 5' end of the probe used for the amplification fragment of the Trypanosoma cruzi primer and the 5' end of the probe used for the amplification fragment of the Trypanosoma brevicornu primer both contain fluorescent labels.
3. A trypanosome multiplex fluorescent PCR nucleic acid detection kit, characterized in that: The Trypanosoma multiplex fluorescent PCR nucleic acid detection kit includes the Trypanosoma cruzi primers, the probes used for the amplification fragments of the Trypanosoma cruzi primers, the Trypanosoma brevicornu primers, and the probes used for the amplification fragments of the Trypanosoma brevicornu primers as described in claim 1.
4. The trypanosome multiplex fluorescent PCR nucleic acid detection kit according to claim 3, characterized in that: The aforementioned Trypanosoma multiplex fluorescent PCR nucleic acid detection kit can simultaneously detect the nucleic acids of Trypanosoma cruzi and Trypanosoma brevicornu in one tube using specific primers and probes.
5. The application of the Trypanosoma multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the qualitative and quantitative detection of Trypanosoma cruzi nucleic acid.
6. The application of the Trypanosoma multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the qualitative and quantitative detection of Trypanosoma brevicornu nucleic acid.
7. An engineered Escherichia coli strain carrying a recombinant artificial chromosome, characterized in that, The engineered Escherichia coli strain was prepared by integrating the homologous sequences of the Trypanosoma cruzi and Trypanosoma brevicornu into the artificial chromosome of Escherichia coli using homologous recombination technology, thus completely preserving the cell structure of the engineered strain. The homologous sequence of the Trypanosoma cruzi is shown in SEQ ID NO:1, and the homologous sequence of the Trypanosoma brevicornu is shown in SEQ ID NO:
2.
8. A quality control product for multiplex nucleic acid detection of trypanosomes, characterized in that, The quality control sample is prepared from the engineered Escherichia coli of claim 7 through the following steps: (a) Cultivate engineered bacteria and heat-inactivate them; (b) Dilute with phosphate buffer to different concentration gradients; (c) Extract the DNA from the above-mentioned engineered bacteria quality control samples, and accurately determine the nucleic acid copy number by digital PCR and qPCR.
9. The application of the quality control material of claim 8 for non-disease diagnostic purposes, characterized in that, The application is any one of the following: (a) Quality control of accuracy and precision of fluorescent PCR and digital PCR for trypanosome nucleic acid detection; (b) Establishment of multi-gradient standard curves for quantitative detection of trypanosome nucleic acid using fluorescent PCR and digital PCR; (c) Performance validation of the trypanosome nucleic acid detection and nucleic acid extraction kit; (d) Standardized testing for clinical diagnosis of trypanosomiasis and safety monitoring of blood products.
Citation Information
Patent Citations
Oligonucleotides and use thereof
CN107922943A
Primer used for real-time fluorescence PCR detection of trypanosome nucleic acid and kit
CN110295244A