An indel molecular marker related to total purine content of soybean seeds and application thereof

Abstract

The application discloses an InDel molecular marker related to total purine content of soybean grains and application thereof, and belongs to the technical field of molecular marker development. The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2, wherein the InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 1 corresponds to high purine soybean, and the InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 2 corresponds to low purine soybean. The application fills the blank of the current lack of molecular biology means for detecting the total purine content of soybean grains, can realize efficient identification of the total purine content of soybean grains, and provides an important reference for breeding and molecular marker assisted breeding of low purine soybean.

Description

Technical Field

[0001] This application belongs to the field of molecular marker development technology, specifically relating to an InDel molecular marker related to the total purine content of soybean seeds and its application. Background Technology

[0002] Purines are nitrogen-containing heterocyclic organic compounds widely found in living organisms and are important base components of nucleic acids (such as DNA and RNA). During human metabolism, purines break down to produce uric acid, and high uric acid has become the fourth "high" after hypertension, hyperlipidemia, and hyperglycemia, a significant contributing factor to gout, cardiovascular and cerebrovascular diseases, and other ailments. Therefore, controlling dietary purine intake is crucial for preventing related health problems.

[0003] Soybeans, being a purine-rich food, are a major source of purine intake. Therefore, selecting high-quality, low-purine soybean varieties can reduce purine intake in the population, decrease the incidence of metabolic diseases such as gout, and meet the nutritional needs of specific populations (such as patients with hyperuricemia).

[0004] However, current methods for identifying purine content in soybeans mainly rely on chemical analysis (such as high-performance liquid chromatography), which suffer from problems such as cumbersome techniques and long screening cycles. Furthermore, there are currently no reports on molecular biological methods for screening total purine content in soybean seeds, which severely restricts the breeding process of low-purine soybean varieties.

[0005] Therefore, it is essential to develop novel molecular markers to achieve rapid and accurate identification of the total purine content in soybean seeds. Summary of the Invention

[0006] In view of this, the primary objective of this application is to provide an InDel molecular marker related to the total purine content of soybean seeds, which fills the gap in the current lack of molecular biological methods for detecting the total purine content of soybean seeds, and achieves efficient identification of the total purine content of soybean seeds.

[0007] To achieve the above objectives, this application adopts the following technical solution:

[0008] One aspect of this application discloses an InDel molecular marker related to the total purine content of soybean seeds, wherein the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the InDel molecular marker with the nucleotide sequence shown in SEQ ID NO.1 corresponds to high-purine soybeans, and the InDel molecular marker with the nucleotide sequence shown in SEQ ID NO.2 corresponds to low-purine soybeans.

[0009] This application utilizes BSA sequencing and analysis of 20 high-purine (>180 mg / 100 g) and 20 low-purine (<95 mg / 100 g) samples and 2 parental lines selected from previous experiments. The analysis revealed a mutation site at 5854300 bp-5854389 bp downstream of Glyma.02G066200 (reference genome: soybean Glycine max Wm82.a4.v1 reference genome), with nucleotide sequences of SEQ ID NO.1 or SEQ ID NO.2. Specifically, when the nucleotide sequence is SEQ ID NO.1, the average purine content of soybean seeds is 170.23 mg / 100 g, and when the nucleotide sequence is SEQ ID NO.2, the average purine content of soybean seeds is 88.76 mg / 100 g. This application is based on the large fragment mutation at the 5854300 bp-5854389 bp site on chromosome 2, which causes changes in the purine content of soybean seeds.

[0010] For high-purine soybeans, the nucleotide sequence of the InDel molecular marker is as shown in SEQ ID NO.1 below (the underlined part is the mutation site, located on soybean chromosome 2 at positions 5854300bp-5854389bp, a total of 90bp):

[0011] TTCTTTACTAAGTGGATGACAGGTATAAAAATCAATGAATAATAATAATTGAAAGAAAATTTACTTTTTAATAATGTGATATGCTTTTATTAGGTAAAAATAAAAACGAAGCTGAGAAATAAAGACACGATTTT CGTCTGAAATT TGGACACCCTGATTTTTGGGTTCATCGTGATTTTATTTTATTTTATCATTATTACTTCTAACGTGACAATTATATG TGT GATGTTGTCTTTCTTTGGTCAATTCGTTTACAGGGTCG (261bp).

[0012] For low-purine soybeans, the nucleotide sequence of the InDel molecular marker is as shown in SEQ ID NO.2 below (the underlined site is the mutation site, located at 5854300 bp on chromosome 2):

[0013] TTCTTTACTAAGTGGATGACAGGTATAAAAATCAATGAATAATAATAATTGAAAGAAAATTTACTTTTTAATAATGTGATATGCTTTTATTAGGTAAAAATAAAAACGAAGCTGAGAAATAAAGACACGATTTT CGATGTTGTCTTTCTTTGGTCAATTCGTTTACAGGGTCG (172bp).

[0014] Another aspect of this application discloses primer pairs for amplifying the InDel molecular marker described in this application. For the InDel molecular marker disclosed in this application, corresponding primer pairs were developed using primer development methods commonly or well-known in the art.

[0015] In this application, the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0016] Because the base sequence lengths of soybeans with high and low purine content differ after amplification, the total purine content of soybean seeds can be rapidly and accurately identified by analyzing the amplification products.

[0017] Another aspect of this application discloses a reagent kit containing the primer pairs described in this application. Because this kit contains primer pairs that amplify the InDel molecular marker, it enables rapid identification of the total purine content in soybean seeds. It is understood that, in addition to the primer pairs, the kit can also be configured with corresponding auxiliary reagents depending on the detection technology; those skilled in the art possess this capability, and it will not be elaborated upon here. Furthermore, the kit typically includes an instruction manual that specifies the detection procedures and how to interpret the detection results.

[0018] Another aspect of this application discloses a method for identifying the total purine content of soybean seeds, comprising the following steps:

[0019] Using the genomic DNA of the soybean to be tested as a template, PCR amplification was performed using the primer pair described in this application to obtain the amplification product;

[0020] The amplified products were analyzed, and the total purine content of soybean seeds was determined based on the analysis results.

[0021] In some examples of this application, the genomic DNA of the soybean to be tested is extracted from soybean seeds or leaves. There are no particular limitations on the specific extraction method; any method commonly used or well-known in the art can be employed. As an example, this application uses the SDS method for extracting soybean genomic DNA.

[0022] In this application, there are no particular limitations on the reaction system and conditions for PCR amplification. Based on the ability of those skilled in the art, PCR amplification can be achieved with the primer pairs and molecular markers available. As an example, the PCR amplification system is as follows: in a 25 μL reaction system, 2.0 μL of 150 ng / μL template DNA, 1.0 μL each of 10 μM upstream and downstream primers, 12.5 μL of 1.0 U Prime Star Max enzyme, and 8.5 μL of ddH2O.

[0023] The PCR reaction conditions were as follows: Step 1: Pre-denaturation at 95℃ for 3 min; Step 2: Denaturation at 95℃ for 10 s; Step 3: Annealing at 60℃ for 15 s after a 0.3℃ drop; Step 4: Extension at 72℃ for 20 s; and a total of 38 cycles were performed from Step 2 to Step 4. Finally, Step 5: Extension at 72℃ for 5 min, and storage at 4℃.

[0024] In this application, there are no particular limitations on the method of analyzing the amplified products. For example, it can be sequencing, where the length of the obtained nucleotide sequence is used to determine the purine content of soybean seeds. Alternatively, it can be agarose gel electrophoresis, where the intensity of the amplified product bands is used to determine the total purine content of soybean seeds.

[0025] As a preferred example, agarose gel electrophoresis is used to analyze the amplification products, which can quickly determine the purine content in soybean seeds. If the amplification product has a high band (261bp), it is identified as a high-purine soybean; if the amplification product has a low band (172bp), it is identified as a low-purine soybean.

[0026] Another aspect of this application discloses any of the following applications:

[0027] (i) The application of the InDel molecular markers, primer pairs or kits described in this application in the identification of total purine content in soybean seeds;

[0028] (ii) Application of the primer pairs described in this application in the preparation of a detection tool for identifying the total purine content of soybean seeds.

[0029] There are no particular limitations on the detection tools; they can be any common molecular biology detection tools in the field. Specific examples include, but are not limited to, detection reagents, kits, chips, or liquid probes. Those skilled in the art can develop corresponding detection tools based on the content disclosed in this application, and they have such capability, so there are no particular limitations.

[0030] The beneficial effects of this application are:

[0031] The InDel molecular marker provided in this application is significantly correlated with the total purine content of soybean seeds. Primer pairs specifically amplifying this marker were developed based on the differences in purine content between high-purine and low-purine soybeans. Using these primer pairs, only PCR amplification of extracted soybean genomic DNA is required, and the amplification products can be analyzed to rapidly and accurately identify the purine content of soybean seeds, achieving efficient and convenient identification of soybean purine content. This provides an important reference for the breeding of low-purine soybeans and marker-assisted breeding, and has broad application prospects in the molecular breeding of new low-purine soybean varieties and lines. Attached Figure Description

[0032] Figure 1 The image shows the electrophoretic bands of soybeans under high and low purine conditions in Example 3. The high band (261bp) represents high-purine soybeans, and the low band (172bp) represents low-purine soybeans.

[0033] Figure 2 This is a bar chart showing the purine content of soybean seeds under different nucleotide sequences (different markers) in Example 3. express P <0.01 indicates that the difference is highly significant. Detailed Implementation

[0034] The present application will be further illustrated below with reference to specific embodiments. It should be noted that the specific embodiments below are for illustrative purposes only and do not limit the scope of the present application in any way.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application.

[0036] In addition, unless otherwise specified, methods without detailed conditions or steps are conventional methods, and the reagents and materials used are commercially available.

[0037] The chemical analysis and detection of purine content in soybean seeds refers to existing technologies, specifically Li J, Li N, Hu X, et al. Revealing the distribution pattern of soybean purine content and its influencing factors based on an ultra-micro detection system[J]. LWT[2025-11-06].DOI:10.1016 / j.lwt.2025.117683.

[0038] Example 1: Obtaining the InDel mutation site

[0039] Two materials with different purine contents (soybean variety ORS 96.47 mg / 100g and soybean variety Wodou 11 132.54 mg / 100g) were crossed to construct segregating populations. In 2023, the F1 generation hybrids were harvested at the Hainan Nanfan Base, and the F2 generation seeds were then planted at the Anhui Agricultural University Wanbei Experimental Station to obtain the F2 population.

[0040] F2 samples were tested. Twenty high-purine materials (>180 mg / 100 g), 20 low-purine materials (<95 mg / 100 g), and two parental lines were selected for BSA sequencing and analysis. A variant site was found downstream of Glyma.02G066200 at positions 5854300 bp-5854389 bp, with nucleotide sequences of SEQ ID NO.1 or SEQ ID NO.2. When the nucleotide sequence was SEQ ID NO.1, the average purine content of soybean seeds was 170.23 mg / 100 g, and when the nucleotide sequence was SEQ ID NO.2, the average purine content of soybean seeds was 88.76 mg / 100 g (reference genome: soybean Glycine max Wm82.a4.v1).

[0041] Example 2 Primer pair design

[0042] Based on the InDel molecular marker sites obtained in Example 1, the primer pairs designed using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) are as follows:

[0043] Upstream primer InDel-F (5'→3'):

[0044] TTCTTTACTAAGTGGATGACAGGT (SEQ ID NO. 3);

[0045] Downstream primer InDel-R (5'→3'):

[0046] GGTCAATTCGTTTACAGGGTCG (SEQ ID NO. 4).

[0047] Example 3: Identification of High- and Low-Purine Soybeans

[0048] In this embodiment, the InDel molecular marker from Example 1 and the primer pair from Example 2 are used to identify high- and low-purine soybeans. The specific detection method steps are as follows:

[0049] 3.1 DNA extraction from soybean seeds

[0050] (1) Use a punching machine to drill holes in soybean seeds and grind them into powder of about 0.03g. Put the powder into a 2mL centrifuge tube for later use.

[0051] (2) Add 1000 μL of SDS extraction solution to centrifuge tubes, incubate in a water bath at 60°C for 40 min, and shake well every 10 min.

[0052] (3) After the water bath, add 1000 μL of DNA extraction solution 25:24:1 to the centrifuge tube (shake well before use, take the lower layer for use), mix well, shake for 2 min, let stand for 2 min, and then centrifuge at 12000 r / min for 10 min.

[0053] (4) Take 800 μL of the supernatant and add it to another 2 mL centrifuge tube. Add 800 μL of chloroform-isoamyl alcohol (nucleic acid extraction solution 24:1), shake well for 2 min, let stand for 2 min, and centrifuge at 12000 r / min for 10 min.

[0054] (5) Take 600 μL of the supernatant and add it to a new 1.5 mL centrifuge tube. Add 600 μL of isopropanol and shake well. Place it in a -20℃ refrigerator and let it stand for 30 min.

[0055] (6) After standing, centrifuge at 12000 r / min for 10 min and discard the supernatant.

[0056] (7) Take 800 μL of 75% ethanol solution, rinse once, centrifuge at 12000 r / min for 3 min and then discard the ethanol.

[0057] (8) Place in a fume hood to air dry, then add 30 μL of distilled water to dissolve.

[0058] (9) The DNA concentration was determined using an ultra-micro spectrophotometer and diluted to 160 ng / μL.

[0059] 3.2 PCR amplification of DNA fragments

[0060] The extracted soybean DNA fragment was amplified using the primer pairs described in SEQ ID NO.3 and SEQ ID NO.4 designed in Example 2 to obtain the amplification product.

[0061] The PCR reaction system is shown in Table 1:

[0062] Table 1 PCR reaction system (25 μL)

[0063]

[0064] The PCR amplification procedure is shown in Table 2:

[0065] Table 2 PCR amplification program

[0066]

[0067] 3.3 Agarose gel electrophoresis

[0068] Take 4 μL of PCR amplification product and perform electrophoresis on a 1.5% agarose gel. Verify the bands using a gel imaging system.

[0069] The purine content of soybean grains in different numbered soybean materials (all from the F2 population in Example 1) was detected using the method described in this embodiment. The results are as follows: Figure 1 As shown in the figure, it can be seen that the primer pairs can effectively amplify the target fragments of materials with different purine levels, proving that the designed primer pairs are specific and avoid homology with non-target sequences. Meanwhile, in this embodiment, the purine content of the aforementioned soybean materials with different numbers was chemically analyzed and detected using an ultra-micro spectrophotometer. The statistical results are as follows: Figure 2 As shown, the average purine content of soybean seeds with the nucleotide sequence SEQ ID NO.1 is 170.23 mg / 100g, and the average purine content of soybean seeds with the nucleotide sequence SEQ ID NO.2 is 88.76 mg / 100g. (This is in conjunction with...) Figure 1 The first two bands represent two parents with different purine contents (Wodou 11 132.54mg / 100g, ORS 96.47mg / 100g). Among them, Wodou 11 is a high-purine soybean and ORS is a low-purine soybean. For the others, the high-purine soybean (261bp) band represents high-purine soybean and the low-purine soybean (172bp) band represents low-purine soybean.

[0070] Example 4

[0071] In this embodiment, the method of Example 3 was used to detect the purine content of 51 soybean materials (derived from the F3 and F4 offspring of the hybrid population in Example 1) and the seed purine content was verified by ultra-micro spectrophotometry to verify the InDel molecular marker and primer pair provided in this application. Some results are shown in Table 3.

[0072] Table 3. Detection results of some purines in 51 soybean samples.

[0073]

[0074] The 32 high-purine soybean samples were selected and numbered 4198-13, 4199-12, 4199-13, 4199-15, etc.; the remaining 19 low-purine soybean samples were selected and numbered 4198-10, 4200-1, 4205-5, etc.

[0075] The above results demonstrate that the InDel molecular markers and primer pairs in this application can accurately and rapidly identify high-purine and low-purine soybeans, and screen out high-quality low-purine soybeans.

[0076] It should be noted that this application is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments with the same structure and effect as the technical concept within the scope of this application are included in the technical scope of this application. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of this application, are also included in the scope of this application.

Claims

1. A method for identifying the total purine content of soybean seeds, characterized in that, The method comprises the following steps: The genomic DNA of the soybean to be tested is used as a template, and a primer pair for amplifying an InDel molecular marker is used for PCR amplification to obtain an amplification product; The amplification product is analyzed, and the total purine content of the soybean seed is determined according to the analysis result; The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the primer pair comprises an upstream primer with a nucleotide sequence shown in SEQ ID NO. 3 and a downstream primer with a nucleotide sequence shown in SEQ ID NO.

4. The InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 1 corresponds to high-purine soybean, and the InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 2 corresponds to low-purine soybean.

2. The method of claim 1, wherein, The genomic DNA of the soybean to be tested is extracted from soybean seeds or leaves.

3. The method of claim 1, wherein, The analysis method is agarose gel electrophoresis. If the amplification product is a high band of 261 bp, it indicates that the soybean to be tested is high-purine soybean. If the amplification product is a low band of 172 bp, it indicates that the soybean to be tested is low-purine soybean.

4. The method of claim 1, wherein, The amplification system of the PCR amplification is as follows: in a 25 μL reaction system, 2.0 μL of 150 ng / μL template DNA, 1.0 μL of 10 μM upstream primer and downstream primer, 12.5 μL of 1.0 U Prime starMax enzyme, and 8.5 μL of ddH2O.

5. The method of claim 1, wherein, The reaction conditions of the PCR are as follows: first step, 95℃ pre-denaturation for 3 min; second step, 95℃ denaturation for 10 s; third step, 60℃, drop 0.3℃, annealing for 15 s; fourth step, 72℃ extension for 20 s; a total of 38 cycles from the second step to the fourth step; finally, the fifth step, 72℃ extension for 5 min, and 4℃ storage.

6. Use of a primer pair for amplifying an InDel molecular marker in identifying total purine content in soybean seeds, characterized in that, The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the primer pair comprises an upstream primer with a nucleotide sequence shown in SEQ ID NO. 3 and a downstream primer with a nucleotide sequence shown in SEQ ID NO.

4. The InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 1 corresponds to high-purine soybean, and the InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 2 corresponds to low-purine soybean.

7. Use of a kit comprising a primer pair for an amplified InDel molecular marker for identifying total purine content in soybean seeds, characterized in that, The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the primer pair comprises an upstream primer with a nucleotide sequence shown in SEQ ID NO. 3 and a downstream primer with a nucleotide sequence shown in SEQ ID NO.

4. The InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 1 corresponds to high-purine soybean, and the InDel molecular marker with the nucleotide sequence shown in SEQ ID NO. 2 corresponds to low-purine soybean.

8. Use of the primer pair for amplifying the InDel molecular marker in the preparation of a detection tool for identifying the total purine content of soybean seeds, characterized in that, The nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO. 1 or SEQ ID NO. 2, and the primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO. 3 and a downstream primer with a nucleotide sequence shown as SEQ ID NO.

4. The InDel molecular marker with the nucleotide sequence shown as SEQ ID NO. 1 corresponds to high purine soybean, and the InDel molecular marker with the nucleotide sequence shown as SEQ ID NO. 2 corresponds to low purine soybean.

9. Use according to claim 8, wherein the compound is ###0002### The detection tool is a detection reagent, a kit, a chip or a liquid phase probe.

Images