SV molecular marker for identifying Nonglong root No.1 in termitomyces albuminosus strain and application of SV molecular marker

By identifying the SV molecular markers of the black-skinned chicken mushroom strain using high-throughput sequencing technology, and designing specific primer pairs for PCR amplification and electrophoresis identification, the identification problem of the black-skinned chicken mushroom strain Nongchanggen No. 1 was solved, achieving rapid and accurate strain identification, reducing costs and time, and making it suitable for the promotion of edible mushroom strains.

CN121294731AActive Publication Date: 2026-01-09INST OF URBAN AGRI CHINESE ACADEMY OF AGRI SCI +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511883028.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-15
Publication Date
2026-01-09
Estimated Expiration
2045-12-15

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify the black-skinned chicken mushroom strain Zhongnong Changgen No. 1, leading to frequent cross-contamination of strains and intellectual property disputes. There is a lack of efficient molecular markers for its identification.

Method used

High-throughput sequencing technology was used to identify structural variation (SV) molecular markers of black-skinned chicken mushroom strains. Specific primer pairs were designed for PCR amplification, and specific bands were identified by agarose gel electrophoresis, thus developing an identification method suitable for breeding and production.

Benefits of technology

It achieves rapid and accurate strain identification with high specificity and low cost. It can distinguish the Or002 strain of black-skinned chicken mushroom in a short time, avoiding the mixing and disputes of strains, and is suitable for the promotion of edible mushroom strains.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294731A_ABST
    Figure CN121294731A_ABST
Patent Text Reader

Abstract

The invention discloses an SV molecular marker for identifying Nonglong root No.1 in termitomyces albuminosus strains and application of the SV molecular marker, and belongs to the technical field of edible fungus strain identification. The invention aims to solve the problems of strain mixing and property right dispute caused by lack of a rapid and accurate identification method in production and popularization of the excellent termitomyces albuminosus strain. The nucleotide sequence of the SV molecular marker is as shown in SEQ ID NO: 1. The invention further discloses application of the SV molecular marker, the specific primer pair or the kit in non-diagnostic-purpose identification of the collybia albuminosa strain Nonglong root No.1. The specific structural variation site of the Zhongnong longroot No.1 strain can be specifically recognized at the genome level through PCR amplification and electrophoresis detection, the method is mainly used for rapid molecular identification of the Zhongnong longroot No.1 strain, strain purity detection, early screening of breeding materials and tracing of market products, and a reliable technical means is provided for intellectual property protection of the strain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of edible fungi strain identification technology, and relates to an SV molecular marker for identifying the black-skinned chicken mushroom strain Nongchanggen No. 1 and its application. Background Technology

[0002] Black-skinned chicken mushroom, scientifically known as *Oudemansiella raphanipes*, is commonly called black-skinned chicken mushroom in the market. Its fruiting body has a tender texture and unique flavor, and is rich in protein, amino acids, vitamins, and other nutrients. It also has effects such as lowering blood pressure and inhibiting tumors, making it a rare edible fungus with both nutritional and medicinal value. Black-skinned chicken mushroom has been initially cultivated in facility-based factories in Shandong and other places (Or034). Although Sichuan Province ranks fifth in the country in black-skinned chicken mushroom production, facility-based cultivation is still in its initial stage, and suitable varieties for factory cultivation are very scarce.

[0003] Zhongnong Changgen No. 1 (Or002) was bred through multispore hybridization using black-skinned chicken mushroom Or005 and Or010 as parents. In comparative trials in Guihua Town, Pengzhou City, Chengdu, it exhibited excellent yield traits and has value for industrial application. Therefore, molecular markers need to be developed for complementary protection.

[0004] With the rapid advancement of high-throughput sequencing technology, especially the widespread application of long-read sequencing, powerful tools have been provided for analyzing large-scale genomic variations. Structural variation (SV) molecular marker technology is a molecular marker technique based on whole-genome resequencing or de novo assembly to systematically identify insertions, deletions, inversions, translocations, and copy number variations in large sequence fragments (50 bp or more) within the genome. Simply put, this technology directly identifies large DNA regions with differences in length or location by comparing the genomic sequences of different individuals, and develops molecular markers that can specifically detect these variations. Polymorphism in samples is ultimately determined by observing different banding patterns or genotype data through primer design for PCR amplification of the target SV site or through sequencing analysis, followed by electrophoresis or bioinformatics analysis. Most SV markers are co-dominant markers, which can reveal far richer genome-level polymorphisms than traditional markers such as SNPs or SSRs. The detection process does not rely on human subjective experience in traditional methods, and can accurately analyze large-scale variations across the entire genome in a single experiment, providing a direct and efficient solution for causal gene localization of important traits. Summary of the Invention

[0005] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0006] Another objective of this invention is to improve the SV molecular marker for identifying the black-skinned chicken mushroom strain Zhongnongchanggen No. 1 (black-skinned chicken mushroom strain Or002; which has obtained the Sichuan Province Non-Major Crop Variety Identification Certificate, Identification No.: Chuanrenjun 2025020). This invention addresses common issues of strain mixing and intellectual property disputes during the promotion of edible fungi strains, and serves as a complementary protection for the black-skinned chicken mushroom strain Or002. In practical applications, the SV molecular marker provided by this invention only requires PCR and agarose gel electrophoresis, resulting in low cost, high throughput, and high specificity, making it suitable for breeding and production practices.

[0007] Therefore, the present invention provides the following technical solution: The SV molecular marker for identifying the black-skinned chicken mushroom strain Nongchanggen 1 is shown in SEQ ID NO:1.

[0008] GAGGATAGAGGATGAAGGGAACGGTGATGTTCTGAGACTTGTTGAGATAGAGGAATCCGAGGAATCACGACGTCGCTTCGTAAAAGTCATCATGCACTTACCTGGAAAGGAGAAGGACAGCGTTTGTCCCCC AAGTGGGTATACTTTTCGACTCACAACGCGGTATTCCTGATAATCTTTGATTAGGTCATTCGTCTACACAAGAACAATTGCTTGAAGGCCTGGCTTGAACCCCATAGTATCTCTTCGGATCCACCTCGAAA CGCGACTACATCGAAGCCTGCGACTAAAGCTGACAATTGCTTGAAGGCCTGGCTTGAACCCCATAGTTTCTCTTCGGATCCACCTCGAAACGCGACTACATCGAAGCCTGCGACTAAAGCTGCCACTATGG CCAGTATCAATATTCCACCGCCTCTGCCTGCCGATAGTGCGTCAATTGGAGCAAGACTGTTTGGAGAAAAAATGCTGCTTATAGTGGTCAAGTTCCTTGGTTCCGCCGCCGCGTACACATTCGTAGAGGC A specific primer pair for identifying the Nongchanggen 1 strain of black-skinned chicken mushroom, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

[0009] F: 5'-GAGGATAGAGGATGAAGGGA-3' (SEQ ID NO: 2) R: 5'-GCCTCTACGAATGTGTACG-3' (SEQ ID NO: 3) A kit for identifying the black-skinned chicken mushroom strain Nongchanggen 1, comprising the aforementioned specific primer pair.

[0010] A method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 1 for non-diagnostic purposes, comprising the following steps: a) Extract genomic DNA from the black-skinned chicken mushroom sample to be tested; b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction; c) Perform electrophoretic detection on the PCR amplification products obtained in step b); d) Identification based on electrophoresis results: If two specific bands appear in the amplification product, the sample is identified as Zhongnong Changgen No. 1 strain. Preferably, the larger band is 524 bp and the smaller band is 438 bp.

[0011] Preferably, in the method described, the PCR amplification reaction procedure in step b) is as follows: preheating at 95°C for 3-5 minutes; performing 30-35 cycles, each cycle including 95°C for 10-30 seconds, 55°C for 10-30 seconds, 72°C for 20-40 seconds; and finally extending at 72°C for 3-8 minutes.

[0012] Preferably, in the method, the PCR amplification reaction program is as follows: preheating at 95°C for 3 minutes; 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and a final extension at 72°C for 5 minutes.

[0013] Preferably, in the method described, the electrophoresis detection in step c) is performed using an agarose gel with a concentration of 2% to 3% and electrophoresis at a voltage of 80-120V for 30-50 minutes.

[0014] The application of the SV molecular marker, the specific primer pair, or the kit in the identification of Nongchanggen No. 1 strain of black-skinned chicken mushroom for non-diagnostic purposes.

[0015] The present invention has at least the following beneficial effects: The test black-skinned chicken mushrooms were identified using the special primers provided in this invention. The results showed that only the PCR amplification product of the black-skinned chicken mushroom strain Or002 showed a specific band, while the PCR amplification products of other black-skinned chicken mushrooms did not show a specific band. This indicates that the primers designed in this invention can amplify and distinguish the specific gene fragment of black-skinned chicken mushroom Or002.

[0016] Therefore, the dedicated primers provided by this invention can be applied to the rapid identification and detection of Or002. These primers not only provide more accurate identification results than conventional morphological methods, but also offer shorter detection times and higher accuracy compared to other detection methods. The detection time is only 3 hours, while the fruiting experiment requires 3-4 months.

[0017] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0018] Figure 1 The image shows the agarose gel electrophoresis results of one embodiment of the present invention, which shows that "Zhongnong Changgen No. 1" exhibits two distinctive bands.

[0019] Figure 2 This is a sequence diagram of the SV molecular marker used in this invention. Detailed Implementation

[0020] The present invention will now be described in further detail so that those skilled in the art can implement it based on the description.

[0021] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not imply the presence or addition of one or more other elements or combinations thereof.

[0022] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.

[0023] According to one embodiment of the present invention, the present invention uses the published genome data of black-skinned chicken mushroom as a reference, and uses high-throughput sequencing technology to obtain the whole genome data of the strain to be tested. Then, based on the reference genome, a set of specific primers were designed and synthesized to establish a method for specific identification of black-skinned chicken mushroom Or002, and the effectiveness of the established method was evaluated by an experiment.

[0024] The SV molecular marker for identifying the black-skinned chicken mushroom strain Nongchanggen No. 1 (Black-skinned Chicken Mushroom Or002) was determined, and its nucleotide sequence is shown in SEQ ID NO:1. The sequence diagram is shown below. Figure 2 As shown.

[0025] SEQ ID NO:1: GAGGATAGAGGATGAAGGGAACGGTGATGTTCTGAGACTTGTTGAGATAGAGGAATCCGAGGAATCACGACGTCGCTTCGTAAAAGTCATCATGCACTTACCTGGAAAGGAGAAGGACAGCGTTTGTCCCCC AAGTGGGTATACTTTTCGACTCACAACGCGGTATTCCTGATAATCTTTGATTAGGTCATTCGTCTACACAAGAACAATTGCTTGAAGGCCTGGCTTGAACCCCATAGTATCTCTTCGGATCCACCTCGAAA CGCGACTACATCGAAGCCTGCGACTAAAGCTGACAATTGCTTGAAGGCCTGGCTTGAACCCCATAGTTTCTCTTCGGATCCACCTCGAAACGCGACTACATCGAAGCCTGCGACTAAAGCTGCCACTATGG CCAGTATCAATATTCCACCGCCTCTGCCTGCCGATAGTGCGTCAATTGGAGCAAGACTGTTTGGAGAAAAAATGCTGCTTATAGTGGTCAAGTTCCTTGGTTCCGCCGCCGCGTACACATTCGTAGAGGC To achieve the aforementioned objectives, this invention employs high-throughput sequencing technology to sequence the tested strains of *Termitomyces albuminosus*. By comparing the sequences of these strains with a reference genome, a specific molecular marker was identified. Primers were developed using this specific molecular marker to perform PCR amplification on total DNA extracted from different *Termitomyces albuminosus* species. The PCR products were then subjected to agarose gel electrophoresis to identify a specific band capable of specifically identifying Or002.

[0026] F: 5'-GAGGATAGAGGATGAAGGGA-3' (SEQ ID NO: 2) R: 5'-GCCTCTACGAATGTGTACG-3' (SEQ ID NO: 3) Finally, the present invention provides a method for identifying Or002. The method described in the present invention uses primers developed using the above-mentioned Or002 specific molecular marker to identify black-skinned chicken mushroom. The Or002 amplification product obtained by PCR should show a specific band after electrophoresis.

[0027] Specifically, the method for identifying Or002 according to the present invention includes: a) Extract total genomic DNA from the test samples of black-skinned chicken mushroom strains or fruiting bodies; b) Perform PCR amplification on the extracted total DNA using the primers to obtain PCR amplification products; c) Perform agarose gel electrophoresis to specifically identify Or002.

[0028] The preferred PCR amplification program of this invention is as follows: preheating at 95°C for 3 min; 30 cycles: 95°C for 15 s, 55°C for 15 s, 72°C for 30 s; and a final extension at 72°C for 5 min.

[0029] The preferred electrophoresis procedure of this invention is as follows: 3% agarose, constant voltage mode, 100V, 80mA, 40mins.

[0030] Example 1 Genomic DNA extraction from *Termitomyces albuminosus*. After 8 days of mycelial culture, the mycelia were collected, and total DNA was extracted using a modified CTAB method.

[0031] Primer design The Wuhan Hope Group was commissioned to perform second-generation genome sequencing on the *Termitomyces albuminosus* mycelial samples obtained in Example 1. After quality control using FastQC software, the sequencing data was compared one-to-one with the reference genome using BWA (Burrows-Wheeler Aligner) software. Then, GATK (Genome Analysis Toolkit, 4.2.6.1) software was used to screen and filter variant information, eliminating variant sites with low confidence. Finally, IGV (Integrative GenomicsViewer, 2.6.3) software was used to identify the unique heterozygous variant site of Or002 that distinguishes it from other *Termitomyces albuminosus* species, as well as variant sites of other *Termitomyces albuminosus* species. Primers were developed using the SV site located at 2797265-2797355 of GWHBRAH00000001 in *Termitomyces albuminosus*. The following primer (Primerpair 6) was selected from the 10 primer sets designed by the inventors for use: F: 5'-GAGGATAGAGGATGAAGGGA-3' R: 5'-GCCTCTACGAATGTGTACG-3' PCR amplification and identification of the fungi to be tested. The fungi to be tested were used to extract total DNA using a modified CTAB method. The extracted total DNA was amplified by PCR using the specific primers designed in Example 1. The PCR amplification system is as follows.

[0032] PCR system: 20 μL 2xMix, 2 μL F primer, 2 μL R primer, 25 μL ddH2O, 1 μL DNA PCR program: preheat at 95℃ for 3 min; 30 cycles: 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s; final extension at 72℃ for 5 min. Primer concentration was 100 µM.

[0033] like Figure 1 As shown, the results were detected using a gel imaging system after 3% agarose gel electrophoresis. The *Termitomyces albuminosus* strain Or002 exhibited a heterozygous deletion, displaying two specific bands, while other *Termitomyces albuminosus* strains showed only one band. Therefore, the simple operation of this invention allows for rapid identification of *Termitomyces albuminosus* strain Or002.

[0034] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.

Claims

1. Identification of the SV molecular marker of Nongchanggen 1 in the black-skinned chicken mushroom strain, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. A specific primer pair for identifying the Nongchanggen No. 1 strain of *Termitomyces albuminosus*, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

3. A kit for identifying the Nongchanggen No. 1 strain of *Termitomyces albuminosus*, characterized in that, It includes the specific primer pair as described in claim 2.

4. A method for identifying the strain Nongchanggen 1 of *Termitomyces albuminosus* for non-diagnostic purposes, characterized in that, Includes the following steps: a) Extract genomic DNA from the black-skinned chicken mushroom sample to be tested; b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction; c) Perform electrophoretic detection on the PCR amplification products obtained in step b); d) Identification based on electrophoresis results: If two specific bands appear in the amplification product, the sample to be tested is determined to be Zhongnong Changgen No. 1 strain.

5. The method according to claim 4, characterized in that, The PCR amplification reaction procedure described in step b) is as follows: preheat at 95°C for 3-5 minutes; perform 30-35 cycles, each cycle including 95°C for 10-30 seconds, 55°C for 10-30 seconds, 72°C for 20-40 seconds; and finally extend at 72°C for 3-8 minutes.

6. The method according to claim 5, characterized in that, The PCR amplification reaction procedure was as follows: preheating at 95°C for 3 minutes; 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and a final extension at 72°C for 5 minutes.

7. The method according to claim 4, characterized in that, The electrophoresis detection described in step c) involves using an agarose gel with a concentration of 2% to 3% and electrophoresis at 80-120V for 30-50 minutes.

8. The application of the SV molecular marker as described in claim 1, the specific primer pair as described in claim 2, or the kit as described in claim 3 in the identification of Nongchanggen No. 1 strain of black-skinned chicken mushroom for non-diagnostic purposes.

Citation Information

Patent Citations

  • Cultivation method of oudemansiella radicata strain

    CN112369275A

  • Oudemansiella radicata SSR molecular marker primer group and application thereof

    CN112725509A

  • Primer pair and method for identifying new Oudemansiella oosporium strain HCS

    CN119530440A