Specific sequence of Y chromosome of humulus lupulus and application of specific sequence in sex determination
By using PCR detection of Y-chromosome-specific sequences and primer pairs from hops, the stability and repeatability issues of sex identification in hops in existing technologies have been solved, enabling efficient sex identification at the seedling stage and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-11
- Publication Date
- 2026-03-31
AI Technical Summary
Existing methods for sex identification in hops are based on random markers, which have poor stability and repeatability, making it difficult to accurately identify males and females during the seedling stage, resulting in high breeding costs and low efficiency.
We provide a hop-specific Y chromosome sequence and its matching primer pair to accurately identify male and female sex through PCR detection. PCR amplification is performed using primers Y1F/Y1R, and sex is determined by agarose gel electrophoresis.
It enables efficient and stable identification during the seedling stage, improves breeding efficiency, saves resources, and is suitable for laboratory research and field breeding.
Smart Images
Figure CN121759629A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology. More specifically, it relates to a specific sequence of the Y chromosome of hops and its application in sex determination. Background Technology
[0002] Hops ( Humulus lupulus ) belongs to the Cannabaceae family ( Cannabaceae ) Humulus ( Humulus It is a perennial dioecious plant with a karyotype of 2n=18+XX / XY. Its female inflorescence bracts are rich in hop resins, essential oils and polyphenols, which are irreplaceable and important raw materials in the beer brewing process. Therefore, the ultimate goal of hop breeding is to obtain high-yielding, high-quality and disease-resistant superior female plants.
[0003] Hop hybridization breeding requires the construction of large hybrid populations and the selection of suitable parent combinations. While male plants are essential for pollination, the proportion of truly valuable male plants is extremely low, resulting in a large number of useless male plants consuming land and management resources. Sex cannot be distinguished morphologically in hop seedlings; determination is only possible after flowering, leading to large population sizes, high costs, and low efficiency. If sex could be rapidly and accurately identified during the seedling stage, only necessary male plants could be retained, concentrating resources on target female plants and superior male plants, thus significantly improving breeding efficiency. In basic research on hop sex determination, functional validation of sex-determining pathways (such as gene editing, VIGS, and overexpression) also requires accurate sex differentiation at the seedling stage; otherwise, experimental grouping bias and data distortion are likely. Developing molecular markers that can accurately predict sex at the seedling stage is of significant value for both hop breeding and basic research.
[0004] Current methods for sex identification in hops are mostly based on random markers such as RAPD, ISSR, and AFLP. However, due to sequence anonymity, unclear amplification sites, and susceptibility to varietal differences and PCR conditions, they exhibit poor stability and reproducibility, limiting their widespread application. Therefore, there is an urgent need for a new early sex identification technology system for hops that features clearly defined targets, robust amplification, ease of operation, and broad applicability. Summary of the Invention
[0005] The present invention aims to overcome the defects and deficiencies of the prior art and provide a Y chromosome-specific sequence of hops, and based on this sequence, to provide a universally applicable molecular method for early sex identification of hops, as well as its matching primers and kits.
[0006] The first objective of this invention is to provide a specific sequence of the Y chromosome of hops and its application.
[0007] A second objective of this invention is to provide a primer pair for identifying the sex of hops.
[0008] A third objective of this invention is to provide a kit for identifying the sex of hops.
[0009] The fourth objective of this invention is to provide a method for identifying the sex of hops.
[0010] A fifth objective of this invention is to provide applications of the aforementioned primer pairs, reagent kits, and methods.
[0011] The above-mentioned objective of this invention is achieved through the following technical solution: This invention provides a specific sequence of the Y chromosome of hops, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0012] This invention provides the application of the above-mentioned specific sequence as a detection target in identifying the sex of hops.
[0013] This invention provides the application of reagents for detecting the above-mentioned specific sequences in the preparation of products for identifying the sex of hops.
[0014] This invention provides a primer pair for identifying the sex of hops, including primer pairs that detect the aforementioned specific sequences.
[0015] As one of the schemes, the primer pair includes primer Y1F and primer Y1R, the sequence of primer Y1F is shown in SEQ ID NO.2, and the sequence of primer Y1R is shown in SEQ ID NO.3.
[0016] Based on this, the present invention also provides a kit for identifying the sex of hops, containing a reagent for detecting the above-mentioned specific sequence, or containing the above-mentioned primer pair.
[0017] In addition, the present invention provides a method for identifying the sex of hops, using the above-mentioned specific sequence as a target to test the sample, and determining the sex of the sample based on the result; if the test result is positive, the sample is male hops, and if the test result is negative, the sample is female hops.
[0018] Specifically, as a preferred embodiment, the method for identifying the sex of hops involves taking DNA from the sample to be tested, using the aforementioned primer pair or the aforementioned kit for detection, and determining the sex of the sample based on the results; if the test result is positive, the sample is a male hop, and if the test result is negative, the sample is a female hop.
[0019] As an alternative implementation, the detection is a PCR detection, and the gender of the sample to be tested is determined based on whether the PCR amplification product is positive.
[0020] Optionally, the annealing temperature for the PCR amplification is 58~62℃, and the number of cycles is 30~35.
[0021] Optionally, the annealing temperature for the PCR amplification is 60°C, and the number of cycles is 34.
[0022] As an alternative implementation, the PCR amplification reaction program is as follows: pre-denaturation at 95℃ for 3 min; followed by 30-35 cycles: denaturation at 94℃ for 25 s, annealing at 58-62℃ for 25 s, extension at 72℃ for 15 s; and finally extension at 72℃ for 5 min.
[0023] As an alternative implementation scheme, the PCR reaction system is as follows: 0.5~1.5 μL of DNA sample to be tested, 8~12 μL of 2×M5HiPer plus Taq HiFi PCR mix, 0.5~1.5 μL of 10 μmol / L primer Y1F, 0.5~1.5 μL of 10 μmol / L primer Y1R, and water to a final volume of 20 μL.
[0024] As an alternative implementation, the PCR amplification product is determined by gel electrophoresis. If a band of 250-500 bp appears, the material being tested is male hops.
[0025] Specifically, the band size is 377 bp.
[0026] The application of the above primer pairs, the above reagent kits, or the above methods in identifying the sex of hops should also be within the scope of protection of this invention.
[0027] The present invention has the following beneficial effects: This invention provides a Y-chromosome-specific sequence for hops and its matching primer pair, enabling accurate, efficient, and stable molecular identification of hop sex during the seedling stage. This Y-chromosome-specific sequence is obtained through screening based on the complete Y-chromosome assembly results. The target sequence specifically exists on the Y chromosome and has no homologous regions with the X chromosome or autosomes, fundamentally ensuring the specificity and reliability of sex determination.
[0028] The primer pair Y1F / Y1R designed for this sequence showed highly consistent amplification effects in multiple cultivated varieties (such as Cascade, Citra, Qingdao Big Flower, and Qilin Fenglv) and wild materials from different ecological zones: all male samples could stably amplify a clear band of 377 bp, while female samples showed no non-specific amplification, with a discrimination accuracy of 100%.
[0029] This invention utilizes conventional PCR and agarose gel electrophoresis for detection, offering simplicity, low cost, and flexible throughput, making it suitable for both laboratory research and field breeding practices. Particularly in hybridization breeding, it allows for the early removal of male plants with no potential value during the seedling stage, significantly saving land, water, fertilizer, and labor costs, and dramatically improving parental selection efficiency and breeding progress. In basic research, it provides reliable sex prediction support for key experiments such as elucidating sex determination mechanisms and verifying functional genes.
[0030] In summary, this invention provides a simple, rapid, and stable technical means for sex identification in hops, and has important application value in breeding population construction, hybrid parent screening, and basic research. Attached Figure Description
[0031] Figure 1 These are the PCR amplification results of primer pair Y1F / R in the genomes of female and male individuals. M: DL2000 marker; lanes 1-8 are female individuals, lanes 9-16 are male individuals, and lane 17 is the amplification result (negative control); lanes 1 and 9 are the cultivated variety "Cascade"; lanes 2 and 10 are the cultivated variety "Citra"; lanes 3 and 11 are the cultivated variety "Qingdao Big Flower"; lanes 4 and 12 are the cultivated variety "Qilin Fenglv"; lanes 5, 6, 13, and 14 are wild materials collected from Wushengyi Town, Yongdeng County, Lanzhou City; lanes 7 and 15 are wild materials collected from Habahe Birch National Forest Park; and lanes 8 and 16 are wild materials collected from Liupanshan National Forest Park. Detailed Implementation
[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0033] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0034] 2×M5 HiPer plus Taq HiFi PCR mix, purchased from Beijing Jumei Biotechnology Co., Ltd., product number MF002plus-V2-505.
[0035] Example 1: Obtaining sex-specific PCR molecular markers from hops I. Genome sequencing, assembly, and Y chromosome identification of male hop plants To obtain high-quality hop haplotype genomes and identify sex chromosomes, the study focused on hops ( Humulus lupulusThe male plants underwent whole-genome sequencing and assembly. Genome survey analysis revealed that the genome was a highly heterozygous complex genome. Subsequently, combining PacBio HiFi, ONT, and Hi-C data, two chromosome-level haplotype genomes, Hapl and Hap2, were successfully assembled, achieving high-quality assembly integrity and accuracy. To identify the sex chromosome, the Hapl and Hap2 genomes were compared with published hop genomes known to contain the X chromosome, identifying Chr10 in the Hap2 genome as the Y chromosome.
[0036] II. Screening of sex-specific PCR molecular markers in hops First, the Y chromosome sequence was extracted from the Hap2 hop genome and segmented into 200 bp fragments using a Python script. Sequences of 1000 were merged into a single file for processing to improve efficiency. Then, the autosome and X chromosome sequences were merged to construct a local database. The segmented Y chromosome sequences were used as query files to perform BLASTN alignments with this local database. After alignment, all results were integrated, and Y chromosome sequences that failed to align successfully with the database were identified for further analysis of their specificity.
[0037] For the selected Y chromosome-specific sequences, specific primers were designed and optimized. First, a Python script was used for primer screening, with multiple candidate primers set for each sequence to ensure optimal selection. Then, ePCR was used for simulated amplification to verify the amplification specificity of the designed primers. Finally, a Y chromosome-specific sequence and a highly specific primer Y1F / R based on this sequence were obtained.
[0038] The Y chromosome-specific sequence (5'-3') is shown in SEQ ID NO.1, SEQ ID NO.1: CTCAAATGTTCTAGGGCTGCCTTTATCGCCATCTAGATTAGAATTTGTACATATTTCAGAATCGGAGTAAGCGTCATACATAATTGAGGAATTTAATTCTATTTTGCTTTTGAGGTTGTGGATTTTATTCATGACCTTGATTGAAGGAAGCAATTATTCTAGGTTCTGCATTTGGGTACACAAAGTTTC TAAGAAGAATTGGATGTGCTGATTTTGACCTTCAATTTGGCTGGACATTAGTGAAGTAGAAATATGAGAGCATAAAATAAATAGTTGGACCTGATGTTTTACGCAATATTATGACCTTGGATTTTCATTTTGCTTGTTATTGATGTTGAGAACACACCTCAGGATTGCGAGCTTCAGTTGTCAGCTAC.
[0039] The primer Y1F sequence (5'-3') is CTCAAATGTTCTAGGGCTGCC (SEQ ID NO.2); The primer Y1R sequence (5'-3') is GTAGCTGACAACTGAAGCTCG (SEQ ID NO.3).
[0040] Example 2: Validation of sex-specific PCR molecular markers in hops I. Extraction of DNA from Male and Female Hops Plants High-quality genomic DNA was extracted from fresh leaves of sex-identified hop plants using a modified CTAB method. Validation materials included multiple cultivars (including Cascade, Tsingtao Big Flower, Citra, and Kirin Fenglv) and wild germplasm resources collected from the field to ensure genetic diversity.
[0041] Wild germplasm resources include wild materials collected from Wushengyi Town, Yongdeng County, Lanzhou City, wild materials collected from Habahe Birch National Forest Park, and wild materials collected from Liupanshan National Forest Park.
[0042] II. PCR Amplification PCR amplification was performed using extracted genomic DNA from male and female hop plants as templates. The amplification system consisted of: 1.0 μL hop DNA, 10.0 μL 2×M5 HiPer plus Taq HiFi PCR mix, 1.0 μL each of forward and reverse primers, and 7.0 μL sterile water.
[0043] The PCR amplification reaction conditions were as follows: pre-denaturation at 95 ℃ for 3 min; followed by 34 cycles: denaturation at 94 ℃ for 25 s, annealing at 60 ℃ for 25 s, extension at 72 ℃ for 15 s; and a final extension at 72 ℃ for 5 min. The amplification results were detected by 1.5% agarose gel electrophoresis.
[0044] Test results as follows Figure 1 As shown, all male materials amplified a specific band of 377 bp, while none of the female materials showed this band. The results indicate that the PCR molecular markers based on the Y chromosome-specific region obtained in this invention can accurately distinguish between male and female hop plants during the seedling stage, and are characterized by simple operation and stable results.
[0045] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A specific sequence of the hop Y chromosome, characterized in that, The nucleotide sequence is shown as SEQ ID NO.
1.
2. Use of the specific sequence of claim 1 as a target for detecting in identifying the sex of hops.
3. Use of a reagent for detecting the specific sequence of claim 1 in preparing a product for identifying the sex of hops.
4. A primer pair for identifying the sex of hops, characterized by, A primer pair comprising the specific sequence of claim 1.
5. The pair of primers according to claim 4, characterized in that, The primer pair comprises primer Y1F and primer Y1R, the sequence of primer Y1F is shown as SEQ ID NO. 2, and the sequence of primer Y1R is shown as SEQ ID NO.
3.
6. A kit for identifying the sex of hops, characterized in that, A reagent containing the specific sequence of claim 1, or a primer pair of claim 4 or 5.
7. A method of identifying the sex of hops, characterized by, Taking the specific sequence of claim 1 as a target, a sample to be tested is detected, and the sex of the sample to be tested is determined according to the result; if the detection result is positive, the sample to be tested is male hops, and if the detection result is negative, the sample to be tested is female hops.
8. The method of claim 7, wherein, DNA of a sample to be tested is taken, and a primer pair of claim 4 or 5 or a kit of claim 6 is used for PCR detection, and the sex of the sample to be tested is determined according to the result; if the detection result is positive, the sample to be tested is male hops, and if the detection result is negative, the sample to be tested is female hops.
9. The method of claim 8, wherein, The annealing temperature of the PCR amplification is 58-62℃, and the cycle number is 30-35 times.
10. Use of the primer pair of any one of claims 4-5, the kit of claim 6, or the method of any one of claims 7-9 in identifying the sex of hops.