IncRNA and application thereof in improving cold resistance of plants

By overexpressing lncRNA nucleotide sequences in Arabidopsis thaliana and rice, the expression of miRNA and target genes was regulated, which solved the physiological disorder problem of plants under low temperature stress, improved the cold resistance and survival rate of transgenic plants, and broadened the research path for breeding strong cold-resistant crops.

CN121320344APending Publication Date: 2026-01-13NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511434065.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-09
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

The physiological changes in plants under low-temperature stress lead to cellular metabolic disorders, which in severe cases result in cell death, affecting growth and yield. Existing technologies are insufficient to effectively improve the cold resistance of plants.

Method used

By overexpressing specific lncRNA nucleotide sequences in Arabidopsis thaliana and rice, transgenic plants were constructed using recombinant vectors and recombinant microbial cells to regulate the expression of miRNAs and target genes, thereby enhancing the cold resistance of the plants.

Benefits of technology

It significantly improved the survival rate and cold resistance of transgenic plants under low temperature conditions, elucidated the regulatory mechanism of lncRNA under low temperature stress, and provided new ideas for breeding highly cold-resistant crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320344A_ABST
    Figure CN121320344A_ABST
Patent Text Reader

Abstract

The invention discloses lncRNA (long non-coding ribonucleic acid) and application thereof in improving cold resistance of plants, and belongs to the technical field of plant breeding. The invention aims to provide a method for researching the cold resistance of plants. The invention provides an lncRNA (long non-coding ribonucleic acid) nucleotide sequence, wherein the sequence of the nucleotide sequence is as shown in SEQ ID NO. 11. The thought is broadened for the research of screening and cultivating new varieties of crops with strong cold resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding, specifically relating to a lncRNA and its application in improving the cold resistance of plants. Background Technology

[0002] Plant growth and development are easily disrupted by low temperatures, especially during the budding and flowering / fruiting stages, where the effects are particularly pronounced. This phenomenon not only limits crop yields but also poses a serious challenge to the sustainable development of agriculture. Under low-temperature stress, plant physiological characteristics (such as enzyme activity, cell membrane stability, and water regulation capabilities) undergo significant changes. These changes can trigger cellular metabolic disorders, and in severe cases, lead to cell death. At the cellular level, low temperatures disrupt signal transduction pathways and alter the levels of toxic metabolites, thereby posing a serious threat to crop growth and even yield. Summary of the Invention

[0003] The purpose of this invention is to provide a method for studying the cold resistance of plants.

[0004] The present invention provides a lncRNA nucleotide sequence, the sequence of which is shown in SEQ ID NO.11.

[0005] The present invention provides a recombinant vector or recombinant microbial cell containing the nucleotide sequence shown in SEQ ID NO.11.

[0006] This invention provides an application of the nucleotide sequence shown in SEQ ID NO.11 in improving the cold resistance of plants.

[0007] Further specifying, the plant is Arabidopsis thaliana or rice.

[0008] This invention provides the application of a recombinant vector containing the nucleotide sequence shown in SEQ ID NO.11 in improving the cold resistance of Arabidopsis thaliana or rice.

[0009] This invention provides the application of recombinant microbial cells containing the nucleotide sequence shown in SEQ ID NO.11 in improving the cold resistance of Arabidopsis thaliana or rice.

[0010] Further, the cold-resistant treatment conditions are specified as -10 ℃, 4 ℃, and 12 ℃.

[0011] This invention provides a method for improving the cold resistance of rice or Arabidopsis thaliana. After overexpressing the nucleotide sequence shown in SEQ ID NO. 11 in rice or Arabidopsis thaliana, Arabidopsis thaliana is cultured at -10 ℃ and 4 ℃, and rice is cultured at 10 ℃.

[0012] This invention provides a breeding method for cold-resistant rice or Arabidopsis thaliana, the specific steps of which are as follows: Step 1: Ligate the nucleotide sequence shown in SEQ ID NO.11 with the pCMBIA330035Su or pC1390U vector to obtain a recombinant vector; Step 2: Transform the recombinant vector obtained in Step 1 into Agrobacterium to obtain recombinant Agrobacterium; Step 3: Transfect the recombinant Agrobacterium described in Step 2 into Arabidopsis thaliana or rice to obtain transgenic Arabidopsis thaliana plants or transgenic rice plants.

[0013] This invention provides the application of transgenic Arabidopsis or rice containing the nucleotide sequence overexpressed as shown in SEQ ID NO.11 in cold-resistant breeding of Arabidopsis or rice.

[0014] Beneficial effects: (1) During the natural overwintering period of Dongnong Winter Wheat No. 1 (Dn1) in the field, samples were taken from its tillering nodes and leaves. RT-qPCR detection revealed a low temperature stress response. lncRNA The expression of [a specific substance] was significantly upregulated, and it was determined in response to low temperature stress. lncRNA The subject of this study was tobacco transient co-transfection, which confirmed that it is ncRNA.

[0015] (2) Analysis of transient co-transfection and dual-luciferase assay (Dual-LUC) of tobacco lncRNA The regulatory mechanism involved in the Dn1 response to low-temperature stress: First, determine lncRNA By directly binding to the target miRNA ( tae-miR164 Firstly, it inhibits its function; secondly, it indirectly regulates it. tae-miR164 target genes ( TaNAC6A The function of TaNAC6A (TraesCS3A02G406000).

[0016] (3) Using plant transgenic technology, T3 generation overexpression was screened and obtained. lncRNA and double overexpression lncRNA / tae- miR164 Transgenic Arabidopsis thaliana plants (OE- lncRNA and OE- lncRNA / tae-miR164 Under low-temperature stress, the survival rate, phenotypic changes, cold resistance physiological indicators, and expression patterns of cold resistance-related genes in transgenic Arabidopsis plants were observed and compared, confirming the overexpression of these genes. lncRNA It can significantly improve the cold resistance of transgenic Arabidopsis plants. Simultaneously, it screens out T0 generation overexpression... lncRNA Regenerated LJ11 rice plants (OE- lncRNA Furthermore, it was preliminarily determined that there were significant differences in the expression of cold-resistance-related genes in transgenic rice plants.

[0017] In summary, this study preliminarily reveals lncRNA The physiological and molecular mechanisms regulating Dn1 response to low-temperature stress. The findings not only provide insights into... lncRNAs This research provides insights into the molecular mechanisms regulating plant stress resistance and broadens perspectives for screening and cultivating new varieties of cold-resistant crops. Attached Figure Description

[0018] Figure 1 For Dn1 under low temperature stress lncRNA Changes in expression levels (A) in tillering nodes lncRNA Changes in expression levels (B) in leaves lncRNA Changes in expression levels; Figure 2 for lncRNA Sequence cloning (A) Gel electrophoresis image of the target band (B) Sequence comparison results; Note: M is the 2000bp Marker, and the digital lanes are all amplified target bands; Figure 3 for lncRNA Coding potential analysis (A) prediction lncRNA ORF(B) construction vector verification lncRNA Non-coding (C) transfection of tobacco leaves (GUS staining) confirmed lncRNA It cannot encode small peptides; Figure 4 for lncRNA Location on hexaploid wheat chromosomes (A) lncRNA Located on wheat Chr7B (B) lncRNA Located in the intron region of TraesCSC7B01G623500.1 (highlighted area is intron); Figure 5 For the acquisition of transgenic Arabidopsis plants, (A) MS solid medium (containing 50 μg·mL⁻¹) -1 Screening for T1 generation transgenic Arabidopsis thaliana positive plants (OE-) using kanamycin lncRNA (B) T1 generation transgenic Arabidopsis thaliana positive plant seedlings (OE- lncRNA ); Figure 6 Identification of T3 generation Arabidopsis thaliana positive plants: (A) Genomic PCR identification; (B) RT-qPCR identification; (C) Screening for high expression. lncRNA Transgenic Arabidopsis thaliana lines; Note: M is a 2000 bp Marker, WT is wild-type Arabidopsis thaliana, and the numbered lanes represent different transgenic Arabidopsis thaliana lines; Figure 7 To obtain double-overexpressing transgenic Arabidopsis plants, (A) MS solid medium (containing 50 μg·mL⁻¹) -1 Screening for positive T1 generation double-overexpressing transgenic Arabidopsis thaliana plants (OE-) using kanamycin lncRNA / tae-miR164 (2) T1 generation double overexpression transgenic Arabidopsis thaliana positive seedlings (OE- lncRNA / tae-miR164 ) Figure 8 Identification of positive T3 generation double-overexpressing transgenic Arabidopsis plants: (A) Genomic PCR identification; (B) RT-qPCR identification; (C) Screening for high expression. tae-miR164 Double-overexpression transgenic Arabidopsis thaliana lines; Note: M is 2000 bp Marker, WT is wild-type Arabidopsis thaliana, and the numbered lanes represent different double-overexpression transgenic Arabidopsis thaliana lines; Figure 9 Screening of mature embryo callus and positive plants of Agrobacterium-mediated genetic transformation of rice LJ11; Figure 10 Identification of positive T1 generation transgenic rice plants: (A) Genomic PCR identification; (B) RT-qPCR identification; (C) Screening for high expression. lncRNA The transgenic rice lines; Note: M is the 2000 bp Marker, WT is the wild-type LJ11, and the numbered lanes represent different transgenic rice lines; Figure 11 Phenotypic observation of Arabidopsis thaliana plants under low temperature stress; Figure 12 Survival rate of Arabidopsis thaliana plants after recovery from low temperature stress; Figure 13 Changes in leaf margins and epidermal hairs of Arabidopsis thaliana plants; Figure 14 The changes in root length of Arabidopsis thaliana plants: (A) Observation of root length of seedlings after 10 days; (B) Statistical analysis of root length. Figure 15 Comparison of stomatal opening in Arabidopsis thaliana leaves under low temperature stress; Figure 16 Comparison of cell counts in transverse sections of Arabidopsis thaliana leaves (100 μm). Figure 17 Changes in MDA content in Arabidopsis thaliana leaves under low temperature stress; Figure 18 The change in relative electrical conductivity of Arabidopsis thaliana leaves under low temperature stress; Figure 19 Changes in Pro content in Arabidopsis thaliana leaves under low temperature stress; Figure 20 To observe the changes in ROS content in Arabidopsis thaliana leaves under low temperature stress using histochemical staining methods, (A) DAB staining results and (B) NBT staining results were used. Figure 21 The content of H2O2 and O2 in the leaves of Arabidopsis thaliana plants under low temperature stress .- Content changes (A) H2O2 content (B) O2.- content; Figure 22 Changes in SOD activity and gene expression levels in Arabidopsis thaliana leaves under low temperature stress (A) SOD activity (B) AtSOD1 Changes in expression levels (C) AtSOD2 Changes in expression levels; Figure 23 Changes in POD activity and gene expression in Arabidopsis thaliana leaves under low temperature stress (A) POD activity (B) AtPER3 Changes in expression levels; Figure 24 Changes in CAT activity and gene expression levels in Arabidopsis thaliana leaves under low temperature stress (A) CAT activity (B) AtCAT1 Changes in expression levels (C) AtCAT2 Changes in expression levels (D) AtCAT3 Changes in expression levels; Figure 25 The changes in the expression levels of cold resistance-related genes in the leaves of transgenic Arabidopsis thaliana plants under low temperature stress; Figure 26 Phenotypic changes in rice plants under low temperature stress; Figure 27 The change in relative electrical conductivity of rice plant leaves under low temperature stress; Figure 28 To compare the changes in ROS content in rice plant leaves under low temperature stress using histochemical staining methods, (A) DAB staining results and (B) NBT staining results were presented. Figure 29 The content of H2O2 and O2 in rice plant leaves under low temperature stress .- Content changes (A) H2O2 content (B) O2 .- content; Figure 30 Changes in SOD enzyme activity and gene expression levels in the leaves of transgenic rice plants under low temperature stress (A) SOD activity (B) OsSOD1 Changes in expression levels (C) OsSOD2 Changes in expression levels; Figure 31 Changes in CAT enzyme activity and gene expression in rice plant leaves under low temperature stress (A) CAT activity (B) OsCATC Changes in expression levels; Figure 32 Key genes in the cold signaling pathway in rice plant leaves under low temperature stress OsDREB1A Changes in expression levels; Figure 33 for lncRNA and tae-miR164 Schematic diagram of complementary regions and mutation sites; Figure 34 for mlncRNA(A) Gel electrophoresis image of the target band; (B) Sequence comparison results; Note: M is a 5000 bp marker, and the digital lanes are all amplified target bands; Figure 35 Electrophoresis diagram for identification of recombinant dual-luciferase plasmid (A) lncRNA -LUC Agrobacterium tumefaciens culture PCR detection of the target band (B) mlncRNA -LUC Agrobacterium tumefaciens culture PCR detection of the target band (C) tae-miR164 - SK Agrobacterium tumefaciens culture PCR detection of the target band; Note: M is a 2000 bp marker, and the digital lanes represent the amplified target band; Figure 36 For Dual-LUC identification lncRNA and tae-miR164 Interaction (A) Fluorescence imaging (B) Relative activity of LUC; Figure 37 To identify the recombinant pBI121-GUS plasmid and pCAMBIA230035Su plasmid, the results (A) show that M is a 2000 bp marker and 1 is a 35S:: tae-miR164 Agrobacterium bacterial culture PCR detection of the target band (B): M is a 2000 bp marker, and 1 is a 35S marker. lncRNA Agrobacterium tumefaciens bacterial culture PCR detection of the target band, 2 for 35S:: mlncRNA Agrobacterium bacterial culture PCR detection target band (C): M is a 2000 bp marker, and I is a 35S marker. TaNAC6A - Detection of the target band by PCR of Agrobacterium tumefaciens in GUS bacterial culture; Figure 38 Validating GUS reporter genes in vivo lncRNA inhibition" tae-miR164 Targeted cutting TaNAC6A mRNA (A) Leaves injected with 35S::GUS bacterial solution alone (B) Leaves injected with 35S::GUS bacterial solution alone TaNAC6A -GUS bacterial solution was injected alone into the leaves (C) for 35 seconds:: tae-miR164 Inject the bacterial solution into the leaf (D) for 35 seconds. lncRNA Inject the bacterial solution into the leaf (E) for 35 seconds. lncRNA Leaves of bacterial solution; (F) co-immersion "35S:: tae-miR164 +35S:: TaNAC6A The leaves of "-GUS bacterial solution" (G) were co-immersed with "35S:: TaNAC6A -GUS+35S:: tae-miR164 +35S:: lncRNA The leaves (H) of the bacterial solution were soaked for 35 seconds. TaNAC6A -GUS+35S:: tae-miR164 +35S:: lncRNA"The leaves of the bacterial solution." Detailed Implementation

[0019] Dn1 wheat is Dongnong Winter Wheat No. 1, recorded in Xing Jinpu, Zhao Xin, Liang Jiawen, et al. Study on JA synthesis-related genes in winter wheat under low temperature stress [J]. Journal of Triticeae Crops, 2022, 42(1):9. DOI:10.7606 / j.issn.1009-1041.2022.01.03; LJ11 rice (cold-sensitive variety) was recorded in Zhenhua Guo, Wendong Ma, Lijun Cai, Tao Guo, Hao Liu, Linan Wang, Junliang Liu, Bo Ma, Yanjiang Feng, Chuanxue Liu, GuojunPan.. Comparison of anther transcriptomes in response to cold stress at therapeutic stage between susceptible and resistant Japonica rice varieties [J]. BMC plant biology,2022,22(1):500; The article recorded in the pCMBIA330035Su vector, Qiuwei Lu, Fuye Guo, Qinghua Xu, JingCang. LncRNA improves cold resistance of winter wheat by interacting with miR398[J]. Functional Plant Biology, 2020, 47:544-557; The pC1390U vector is described in the article Zhiqi Liu, Enyang Mei, Xiaojie Tian, ​​Mingliang He, Jiaqi Tang, Min Xu, Jiali Liu, Lu Song, Xiufeng Li, Zhenyu Wang, Qingjie Guan, Qijiang Xu, Qingyun Bu. OsMKKK70 regulates grain size and leaf angle in rice through the OsMKK4-OsMAPK6-OsWRKY53 signaling pathway[J]. J. Integr. PlantBiol. 2021,63:2043-2057.

[0020] Example 1. Cloning of Low Temperature Stress Response lncRNA Method 1. Using cDNA from wheat tillering nodes as a template, TaActin For internal reference genes, TaActin Primers ( TaActin-F SEQ ID NO.1 TaActin-R (SEQ ID NO.2), the target gene is lncRNA (Primers are for qPCR) lncRNA-F SEQ ID NO.3, qPCR lncRNA-R: SEQ ID NO.4), using 2 -ΔΔCt The relative expression level of the target gene is calculated using this method.

[0021] Results: RT-qPCR was used to detect the presence of Dn1 in the leaves and tillering nodes. lncRNA The expression levels under conditions of 5 ℃, 0 ℃, -10 ℃ and -25 ℃ were compared and analyzed. The results showed that: in tillering nodes lncRNA The expression level was highest at 0℃ and lowest at -25℃; as the temperature decreased, the expression level showed a trend of first increasing and then decreasing. Figure 1 A in the leaf); lncRNA The expression level was highest at -25 ℃, and gradually increased as the temperature decreased. Figure 1 (B in the text). The results showed that in the cold-resistant winter wheat variety Dn1, as the temperature decreased... lncRNA The overall expression level showed an upward trend, indicating that lncRNA It participates in regulating the strong cold resistance of Dn1.

[0022] 2. Using cDNA as a template, the cloning primers are ( lncRNA-F SEQ ID NO.5; lncRNA-R (SEQ ID NO.6), amplification lncRNA The PCR reaction system for the sequence is as follows: 10 μL of 2×Taq MasterMix (Dye), 1 μL of Forward Primer, 1 μL of Reverse Primer, 1 μL of Template cDNA, and 20 μL of ddH2O. The PCR amplification program is as follows: 95℃, 5 min; 95℃, 15 s; 58℃, 30 s; 72℃, 1 min, 35 cycles; 72℃, 5 min.

[0023] 3. After separation of PCR products by agarose gel electrophoresis, the target band was recovered and purified using an agarose gel DNA recovery kit. The recovered and purified target fragment was inserted into the pClone007 cloning vector and ligated overnight at 4°C. Subsequently, the ligation solution was transformed into *E. coli* DH5α competent cells, and positive clones were screened by colony PCR: 5-8 single colonies were selected as templates, and after PCR amplification, colonies with the same size as the target sequence were sent to a sequencing company for sequencing identification. Colonies whose sequencing results were completely identical to the target sequence were considered positive clones (pClone007-). lncRNA The sequence was frozen at -80°C. Comparison with the full-length sequence from the gene sequencing results revealed no base mutations, achieving a 100% match. Figure 2 This proves that cloning was successful. lncRNA The full-length sequence.

[0024] 4. Biological verification lncRNA It is a non-coding RNA (ncRNA). (1) lncRNA -GUS and ORF Construction of the GUS vector: using plasmid pClone007- lncRNA Using this as a template, primers with homologous adapter sequences were designed and synthesized, as follows: pBI121-lncRNA-F SEQ ID NO.7 pBI121- lncRNA-R SEQ ID NO.8 pBI121-ORF-F SEQ ID NO.9 pBI121-ORF-R SEQ ID NO.10. Obtained via PCR amplification of homologous adapters. lncRNA Full-length sequence and its ORF sequence.

[0025] Connected to the carrier lncRNA Sequence: SEQ ID NO.11 TTGGCTGGTTTCTTCCCATTCTTTCTTCTTCCACTAATCTAATGGTTTCATTCTCCCATCGAGAGGTTATGATACTAGCAAGAGTCCTATTCTTCTCCTCTCGATCCTACCTTGGGTTATGTTTGACAGGGATGGTCAGTGAACTTCTATTGGTTTC AAAGGAGGATAGAGATCCATTGGGGAAGGCTCGAAAGGTTATTCGATATCAAAGGTTGACCCTCGACGCGCCGCAGCCACTATTTTTACTCCTTTTATGCAATTATGAACGAAACTTTCTCGATTCCAATGCAACTTATCCTTTTGGAGTTGACGTAA; ORF The sequence (SEQ ID NO.12) uses Bam pBI121-GUS was cleaved with HI single enzyme and incubated overnight at 37 °C to obtain the linearized pBI121-GUS vector. Subsequently, lncRNA sequence sum ORF The sequence was inserted into the linearized vector and transformed into Escherichia coli DH5α. Positive E. coli colonies were successfully identified by PCR amplification and sequencing.

[0026] (2) Transform Agrobacterium GV3101 competent cells, add 1 μg pBI121- lncRNA and pBI121- ORF Plasmids were added to Agrobacterium GV3101 competent cells, centrifuged, and then evenly spread on YEB plates (containing 50 μg / mL plasmids). -1 Rifampicin 50 μg·mL -1 Agrobacterium tumefaciens was cultured at 28 °C for 2 days on kanamycin, and single positive colonies were selected, amplified by PCR, and sequenced to identify the positive Agrobacterium colonies.

[0027] (3) Injecting positive Agrobacterium tumefaciens bacterial solution into tobacco leaves Use the inoculum solution (containing 10 mM 2-morpholinoethanesulfonic acid, pH 5.7, 10 mM) Dilute with 200 μL acetylsuccine containing pBI121- lncRNA and pBI121- ORF Positive Agrobacterium tumefaciens culture ( Place in the dark for 4-6 hours.

[0028] Healthy and uniform 28-day-old tobacco leaves were selected. A positive Agrobacterium tumefaciens bacterial suspension was injected into the tobacco leaves using a needleless syringe. Tobacco leaves injected with Agrobacterium tumefaciens GV3101 suspension containing the pBI121 empty vector served as a positive control. The injected tobacco leaves were cultured in the dark for 1 day, followed by light culture for 2 days. The injected leaves were then removed for β-glucuronidase (GUS) histochemical staining, and photographs were taken to record the expression of the target gene.

[0029] Results: To further confirm lncRNA Belonging to ncRNA, we will lncRNA The potential coding peptide sequence (91 amino acids: SEQ ID NO. 25) was compared and analyzed on the NCBI Blastp website, but no valid match was found, indicating that the peptide may be unknown or non-existent. Analysis using CPC 2.0 software showed a value of 0.0767448, indicating that the peptide does not have coding function. All these results confirm that this sequence is a long non-coding RNA. Figure 3 The A in the formula does not have the function of encoding proteins.

[0030] Despite lncRNA Containing short open reading frames (ORFs) may enable the encoding of small peptides and function in the form of small peptides, but this is not always the case through the ORF Fin. Der analysis revealed that lncRNA Only one ORF starting with ATG exists in the transcript. In order to... Investigating lncRNA To determine whether it possesses the ability to encode peptides, we constructed a 35S:: lncRNA -GUS vector ( Figure 3 (B in the text). This carrier will... lncRNA Fusion with GUS reporter gene to Validating lncRN To determine whether gene A can encode small peptides, a 35S::ORF-GUS vector was constructed. The encoding ability of the ORF was verified by fusing the upstream ORF sequence with the GUS reporter gene. The empty vector pRI121-GUS (35S::GUS) served as a positive control.

[0031] The above-mentioned vectors were transiently transfected into tobacco leaves using an Agrobacterium-mediated transformation method, and GUS activity was detected by histochemical staining. The results showed that GUS activity was detected only in the positive control group, while it was significantly higher in the 35S:: lncRNA GUS activity was not detected in either the -GUS or 35S::ORF-GUS groups. Figure 3 (C) in the above. lncRNA It cannot encode peptides, but instead performs its biological functions as a long non-coding RNA.

[0032] A comparison in the Chinese Spring CS-IAAS T2T chromosome database (WheatOmics) revealed... lncRNA Located on chromosome 7B of hexaploid wheat ( Figure 4 From A), further location (JBrows) reveals that... lncRNA It is a sequence of an intron region within the full-length (2200 bp) intron region of the TraesCSC7B01G623500.1 (Chr7B:725525397-725527596) gene. Figure 4 (B) This can be seen lncRNA It is an intronic lncRNA.

[0033] Example 2. Confirmation lncRNA and tae-miR164 Interaction Dual-LUC experiments confirm that... lncRNA and tae-miR164 Interaction, transient cotransfection experiments in tobacco confirmed lncRNA- tae-miR164 and TaNAC6A Interacting.

[0034] 1. Successful cloning mlncRNA sequence Based on the degeneracy of codons, we lncRNA of tae-miR164 Point mutation design was performed on the endogenous target-simulated binding region (eTM) to construct... mlncRNA sequence( Figure 33 Subsequently, the mutated gene sequence was amplified using PCR and sequenced. Sequence alignment results showed that... mlncRN A was successfully cloned ( Figure 34 ).

[0035] 2. Dual-LUC confirmed lncRNA and tae-miR164 Interaction use Eco 31Ⅰ The pGreenII-0800-miRNA vector was digested with enzymes, and then combined with... lncRNA and mlncRNA Homologous recombination ligation of the PCR products was performed, and a novel PCR product was successfully constructed. lncRNA -LUC and mlncRNA -LUC recombinant vector plasmid. Next, using... Eco 31Ⅰ The pGreenII-62-SK vector was digested with enzymes, and then ligated with a vector containing a 5' linker using homology ligation. tae-miR164The PCR products were then recombined. These recombinant vector plasmids were subsequently transformed into *E. coli* DH5α, and after PCR screening, the target recombinant vector plasmid was successfully transformed into *Agrobacterium* GV3101. PCR identification yielded a single specific band, and the gene containing [the desired recombinant vector] was successfully constructed. lncRNA -LUC and mlncRNA -LUC and tae-miR164 -SK's Agrobacterium tumefaciens. Figure 35 ).

[0036] Using the Agrobacterium-mediated transformation method, different combinations of Agrobacterium were injected into the same leaf, and fluorescence was detected using in vivo imaging technology. After collecting fluorescence signals, the changes in their intensity were used to verify the results. lncRNA and tae-miR164 The interaction between them. The results show that, lncRNA -LUC+ tae-miR164 The fluorescence intensity was significantly reduced in tobacco leaves co-converted with SK; mlncRNA -LUC+ tae-miR164 The fluorescence intensity was higher in tobacco leaves co-converted with SK. Figure 36 It can be seen that, physically, lncRNA and tae-miR164 Interacting.

[0037] 3. Transient cotransfection experiments with tobacco confirmed... lncRNA - tae-miR164-TaNAC6A Interaction (1) Construction of pBI121-GUS and pCAMBIA230035Su expression vectors Given that it has already been confirmed in the past tae-miR164 - TaNAC6A Interaction, for confirmation lncRNA Can be used as a ceRNA regulator tae-miR164 - TaNAC6A Its functions. First of all... Bam After digestion of the pBI121-GUS vector with HI enzyme, it is coupled with a vector containing a 5' linker. TaNAC6A Homologous recombination ligation of PCR products successfully constructed [a novel PCR product]. TaNAC6A Recombinant vector plasmid ( Figure 37 (C in the text). Subsequently, the plasmid containing the 35S promoter (pCAMBIA230035Su) was subjected to... Pac I. Enzyme digestion and linearization treatment, followed by reaction with enzymes carrying 5' linkers. lncRNA , mlncRNA and tae-miR16 Homologous recombination ligation of the PCR products from strain 4 was performed, successfully constructing recombinant expression vector plasmids. Subsequently, these recombinant vector plasmids were transformed into *E. coli* DH5α, and after screening and PCR sequencing, the target recombinant vectors were obtained. Finally, these recombinant vectors were transformed into *Agrobacterium* EHA105, and colony PCR verification yielded the expected single target band.Figure 37 (A and B in the text).

[0038] (2) Tobacco transient cotransfection experiment Leaves infiltrated with 35S::GUS were used as a control group, showing the GUS phenotype stained by histochemical staining. Figure 38 A); and containing 35S:: TaNAC6A -GUS leaves exhibit a similar GUS phenotype ( Figure 38 (B in the text). However, 35S:: tae- miR164 35S:: lncRNA and 35S:: mlncRNA Leaves individually soaked with bacterial solution did not show the GUS phenotype. Figure 38 (C, D, and E in the original text). In the co-conversion "35S:: TaNAC6A -GUS and 35S:: miR164 "After mixing the bacterial solution, the GUS content in the leaves decreased significantly, indicating that..." tae-miR164 Able to inhibit TaNAC6A The expression ( Figure 38 (F in the text). In the co-conversion "35S:: TaNAC6A -GUS、35S:: tae-miR164 and 35S:: lncRNA "After mixing the bacterial solution, the GUS content in the leaves was higher than that of "35S:: TaNAC6A -GUS+35S:: tae-miR164 The number of "groups" has increased significantly. Figure 38 (G in the text) can be seen as, lncRNA Able to remove " tae-miR164 right TaNAC6A "Inhibition". In addition, co-transformation of "35S:: TaNAC6A -GUS、35S:: tae-miR164 and 35S:: mlncRNA "After mixing the bacterial solution, the GUS content in the leaves did not increase significantly." Figure 38 (H in the text), indicating that mutations occur in the eTM region. mlncRNA Cannot be removed tae-miR164 right TaNAC6A "Suppression." In summary, this clause lncRNA It can act as a ceRNA to regulate tae-miR164- TaNAC6A Synergistic effect under low temperature stress.

[0039] Example 3. Construction and screening of overexpressed target genes ( lncRNA and tae-miR164 Transgenic Arabidopsis or rice plants I. lncRNAThe sequences were ligated into plant expression vectors (pCMBIA330035Su and pC1390U). (1) Obtaining the target gene sequence with restriction enzyme sites: using pClone007- lncRNA Using a plasmid as a template, an enzyme restriction site was added to the 5' end. Pac The sequence of Ⅰ) is the PCR primer: lncRNA -User-F: SEQ ID NO.13, lncRNA -User-R: SEQ ID NO.14, lncRNA- pC1390-F: SEQ ID NO.15 lncRNA- pC1390-R: SEQ ID NO.16, PCR amplification followed by agarose gel electrophoresis, and the amplified band was recovered and purified using an agarose gel DNA recovery kit, yielding the DNA with restriction enzyme sites. lncRNA sequence.

[0040] (2) Prepare linearized pCMBIA330035Su vector, whose restriction enzyme sites are: Pac I; Simultaneously, linearized pC1390U vector was prepared, with its restriction enzyme sites being: Bam HI.

[0041] (3) Using a one-step cloning kit, clone the embryos containing the embryos. Pac I restriction site lncRNA The sequence was ligated into the linearized pCMBIA330035Su vector to construct pCMBIA330035Su- lncRNA The recombinant vector was transformed into *E. coli* DH5α competent cells. Simultaneously, the vector carrying... Bam HI lncRNA with restriction sites The sequence was ligated with the linearized pC1390U vector to construct pC1390U- lncRNA The recombinant vector was then transformed into E. coli DH5α competent cells. Positive clones were subsequently identified by colony PCR and sequencing.

[0042] (4) Transform the identified positive clones into Agrobacterium GV3101 competent cells.

[0043] II. pre-tae-miR164 The sequence was ligated into the plant expression vector pCAMBIA3300. tae-miR164The precursor sequence gene (ggUGGAGAAGCAGGGCACGUGCAuccauuuccagcucggcauucccggcguccggccggccggcugccgcggccuugccuggcuggguagugcgucgcucgauccggccgugcgccggcggccggcccuugcaugcaugugccuuucuucuccacc, SEQ ID NO.17) was inserted into the pCAMBIA3300 plant expression vector to obtain pCAMBIA3300- tae-miR164 The recombinant vector was transformed into *E. coli* DH5α competent cells. Positive clones were identified by colony PCR and sequencing, and then transformed into *Agrobacterium* GV3101 competent cells. The vector was then introduced into… tae-miR164 The precursor sequence is expressed as the mature sequence: UGGAGAAGCAGGGCACGUGCA.

[0044] III. Identification of transgenic Arabidopsis and rice plants and screening of high-expression plants (1) Overexpression lncRNA Screening and identification of transgenic Arabidopsis plants: Genomic DNA was extracted from leaves of T1 generation transgenic Arabidopsis plants. Using Arabidopsis genomic DNA as a template, 35S-F primers of the 35S promoter and R primers of the target gene were used for cloning. 35S-F SEQ ID NO.18; lncRNA-R (SEQ ID NO.19) was used as the PCR primer for genomic PCR screening.

[0045] Total RNA was extracted from leaves of T3 generation transgenic Arabidopsis thaliana and reverse transcribed into cDNA. The cDNA was then used as a template for RT-qPCR detection. lncRNA Expression level. Primers used were: qRTlncRNA-F SEQ ID NO.20; qRTlncRNA-R SEQ ID NO.21. AtActin For internal reference gene ( AtActin -F: SEQ ID NO.22; AtActin -R: SEQ ID NO.23), using 2 -ΔΔCt The method calculates the relative expression level of the target gene.

[0046] (2) Overexpression lncRNA Screening and identification of transgenic rice plants: Genomic DNA was extracted from the leaves of T1 generation transgenic rice plants. Using the rice genomic DNA as a template, ... HRT-F The target gene cloning primer R is the PCR primer ( HPT-F SEQ ID NO.24; lncRNA-R(SEQ ID NO19).

[0047] Total RNA was extracted from leaves of T1 generation transgenic rice and reverse transcribed into cDNA. The cDNA was then used as a template for RT-qPCR detection. lncRNA Expression level. Primers used: qRTlncRNA-F SEQ ID NO.20; qRTlncRNA-R SEQ ID NO.21. OsActin For internal reference gene ( OsActin-F SEQ ID NO.26; OsActin-R (SEQ ID NO.27), using 2 -ΔΔCt The relative expression level of the gene to be tested can be calculated.

[0048] (3) Screening and identification of transgenic Arabidopsis thaliana plants with double overexpression: Total RNA was extracted from leaves of T3 generation double transgenic Arabidopsis thaliana plants and reverse transcribed into cDNA. Using cDNA as a template, RT-qPCR was performed. tae-miR164 Expression level. Primers used: qRTtae- miR164-F SEQ ID NO.28 qRTtae-miR164-R: SEQ ID NO.29. AtActin For internal reference gene ( AtActin -F: SEQ ID NO.22; AtActin -R: SEQ ID NO.23), using 2 -ΔΔCt The relative expression level of the gene to be tested can be calculated.

[0049] Results: 1. Using the dip-flower method, the fused pCAMBIA330035Su -lncRNA The Agrobacterium-positive strain of the vector was transfected into Arabidopsis inflorescences. After the inflorescences matured, the T0 generation seeds were harvested and sown on 1 / 2 MS solid medium (containing 30 μg·mL⁻¹). -1 Kanamycin element Cultured on [a medium], and screened for T1 generation overexpression. lncRNA Transgenic Arabidopsis plants and harvested seeds ( Figure 5 These seeds were then further cultured on 1 / 2 MS solid medium (containing 30 μg·mL⁻¹). -1 Subculture with kanamycin until T3 overexpression is selected. lncRNA Transgenic Arabidopsis thaliana plants (OE- lncRNA ).

[0050] Using wild-type (WT) as a control, 10 plants with consistent growth were randomly selected for overexpression. lncRNA Transgenic Arabidopsis thaliana T3 generation plants were subjected to genomic PCR amplification, and all results yielded a single target band. Figure 6(A) indicates that the T3 generation with stable inheritance was successfully obtained, and overexpression was achieved. lncRNA Transgenic Arabidopsis thaliana positive plants (OE- lncRNA Subsequently, using the leaves of the aforementioned 10 plants, semi-quantitative and relative quantitative RT-PCR analysis was performed to screen for plants with high gene expression. lncRNA Two transgenic Arabidopsis thaliana lines (OE- lncRNA -1、OE- lncRNA -2), which will also serve as plant material for constructing double transgenic Arabidopsis thaliana lines ( Figure 6 (B and C in the text).

[0051] 2. Using the dip-pouring method, the fused pCAMBIA3300- tae-miR164 Agrobacterium-positive strains transfected and overexpressed the vector lncRNA Arabidopsis thaliana plants (OE- lncRNA -1), after the transgenic plants mature, harvest the T0 generation double-transgenic Arabidopsis seeds. Sow these seeds in 1 / 2 MS medium (containing 30 μg·mL⁻¹). -1 Resistance selection culture was performed on kanamycin. Figure 7 (A and B in the text); Continuous culture until T3 generation double-overexpression transgenic Arabidopsis plants were successfully screened (OE- lncRNA / tae-miR164 ), and through semi-quantitative gene analysis and quantitative RT-PCR analysis, high expression of [genes] was screened. tae-miR164 Two double transgenic Arabidopsis thaliana lines (OE- lncRNA / tae-miR164 -1、OE- lncRNA / tae-miR164 -6)( Figure 8 (A, B, and C in the original text).

[0052] 3. After removing the husks from LJ11 rice seeds, soak them in a 70% alcohol solution for 10 min, then rinse them three times with sterile water. Sow them onto callus induction medium (specific formulation can be found in Tang Jiaqi. Molecular Mechanism Analysis of OsWRKY53 Negative Regulation of Cold Tolerance in Rice during the Heading Stage [D]. Doctoral Dissertation, Northeast Forestry University, 2022.) and culture them in a light incubator (28 ℃) for approximately 30 days until callus differentiation occurs. Subculture the healthy callus particles onto a new callus induction medium and continue culturing for 7 days. Then, infect them with a solution (already transformed with pC1390U). -lncRNA Agrobacterium GV3101 bacterial suspension with plasmid and 20 μg·mL -1Rice embryo callus tissue was infected with acetylsyleugenone and placed on a co-culture medium covered with a layer of sterile filter paper. The culture was then incubated in a dark incubator at 20 °C for 2 days. After co-culture, the sterilized callus was transferred to a selection medium (specific formulation can be found in Tang Jiaqi. Molecular Mechanism Analysis of OsWRKY53 Negative Regulation of Cold Tolerance in Rice Heading Stage [D]. Doctoral Dissertation, Northeast Forestry University, 2022.) and cultured in a light incubator (28 °C) for 14 days. The selected resistant callus was transferred to a differentiation medium (specific formulation can be found in Tang Jiaqi. Molecular Mechanism Analysis of OsWRKY53 Negative Regulation of Cold Tolerance in Rice Heading Stage [D]. Doctoral Dissertation, Northeast Forestry University, 2022.) and cultured at 28 °C under 24 h light conditions for approximately 30 days to obtain transgenic seedlings 3-4 cm tall. Figure 9 ) Using genomic DNA from the leaves of transgenic rice seedlings as a template, and with the 35S promoter fragment sequence from the pC1390U vector as the upstream primer and the target gene fragment sequence as the downstream primer, PCR amplification was performed to identify positive plants (wild-type (WT) as the control). Results showed that in 20 randomly selected plants... lncRNA Among the transgenic T1 generation plants, 16 plants showed specific bands in PCR amplification ( Figure 10 A in the text indicates that lncRNA Successfully transferred into rice LJ11. Subsequently, extraction was successfully performed. lncRNA Rice RNA was analyzed using semi-quantitative and relative quantitative RT-PCR to screen for high expression of [specific genes / organizations]. lncRNA Two transgenic rice lines (OE- lncRNA -1 and OE- lncRNA -10) Figure 10 (B and C in the text).

[0053] Example 4. Observation of Arabidopsis thaliana and rice plant phenotypes and detection of cold resistance molecular physiological indicators I. Observation of phenotypic changes in Arabidopsis thaliana and rice (1) Wilting state: Under low temperature stress, the wilting morphology of leaves of Arabidopsis thaliana and rice plants was observed, and the survival rate of Arabidopsis thaliana after recovery was counted.

[0054] (2) Leaf morphology and stomatal opening: The leaf morphology and stomatal status of Arabidopsis thaliana seedlings aged 28 days were observed using stereomicroscope and scanning electron microscope.

[0055] (2) Root length measurement: Arabidopsis seeds were inoculated on 1 / 2 MS solid medium and cultured at 24 ℃ for 16 h light / 8 h dark for 10 days. The taproot length of Arabidopsis plants was measured using Image J 1.47 software.

[0056] (3) Leaf anatomical observation: Fresh Arabidopsis leaves were placed in FAA fixative to prepare permanent paraffin sections of leaf cross sections stained with toluidine blue. The microstructure of Arabidopsis leaves was observed and photographed using a Pannoramic 250 FLASH digital slide scanner.

[0057] II. Determination of cold-resistance-related physiological indicators in Arabidopsis and rice plants (1) MDA content determination: The content was determined using a malondialdehyde (MDA) test kit (MDA-2-Y, Suzhou Keming, China).

[0058] (2) Measurement of relative conductivity: The measurement method is the same as that of Peng Kankan (Peng Kankan. Molecular mechanism of winter wheat miR5049-3p and miR1120a interacting with their target genes 6PGL and FBA in response to low temperature stress [D]. Master's thesis of Northeast Agricultural University, 2018).

[0059] (3) Pro content determination: Proline (PRO) content test kit (PRO-2-Y, Suzhou Keming, China) was used for determination.

[0060] (4) The DAB and NBT histochemical staining methods are the same as those used by Tian Yu (Tian Yu. Physiological molecular mechanism of winter wheat TaG6PDH and Ta6PGDH in response to low temperature stress [D]. Master's thesis of Northeast Agricultural University, 2019).

[0061] (5) ROS content determination: Hydrogen peroxide (H2O2) test kit (H2O2-2-Y, Suzhou Keming, China) and superoxide anion (O2) test kit were used. .- The test kit (SA-2-G, Suzhou Keming, China) was used for testing.

[0062] (6) SOD, POD and CAT enzyme activity assay: Superoxide dismutase (SOD) test kit (SOD-2-W, Suzhou Keming, China), catalase (CAT) test kit (CAT-2-W, Suzhou Keming, China) and peroxidase (POD) test kit (POD-2-Y, Suzhou Keming, China) were used for assay.

[0063] III. Detection of cold resistance-related gene expression levels in Arabidopsis and rice plants by RT-qPCR 1. Total RNA was extracted from Arabidopsis leaves and reverse transcribed into cDNA. Using the cDNA as a template, primers for RT-qPCR were designed using Primer 5.0 software and synthesized by Ribobio as follows: AtSOD1-F SEQ ID NO.30 AtSOD1-R SEQ ID NO.31, AtSOD2-F SEQ ID NO.32, AtSOD2-RSEQ ID NO.33 AtPER3-F SEQ ID NO.34; AtPER3-R SEQ ID NO.35 AtCAT1-F SEQ ID NO.36 AtCAT1-R SEQ ID NO.37 AtCAT2-F SEQ ID NO.38 AtCAT2-R SEQ ID NO.39 AtCAT3-F SEQ ID NO.40 AtCAT3-R SEQ ID NO.41, AtDREB1-F SEQ ID NO.42 AtDREB1-R SEQ ID NO.43 AtDREB2-F SEQ ID NO.44 AtDREB2-R SEQ ID NO.45 AtCOR47-F SEQ ID NO.46 AtCOR47-R SEQ ID NO.47 AtCOR15a-F SEQ ID NO.48 AtCOR15a-R SEQ ID NO.49 AtABI5-F SEQ ID NO.50 AtABI5- R SEQ ID NO.51, used for qRT-PCR reaction. AtActin For internal reference gene ( AtActin -F: SEQ ID NO.22; AtActin -R: SEQ ID NO.23), using 2 -ΔΔCt The relative expression level of the gene to be tested can be calculated.

[0064] 2. Total RNA was extracted from the leaves of transgenic rice plants and reverse transcribed to synthesize cDNA. RT-qPCR was then performed using the cDNA as a template. OsActin For internal reference gene ( OsActin-F SEQ ID NO.26 OsActin-R (SEQ ID NO.27), using 2 -ΔΔCt The relative expression level of the gene to be tested was calculated using this method. Primers are as follows: OsSOD1-F SEQ ID NO.52, OsSOD1-R SEQ ID NO.53 OsSOD2-F SEQ ID NO.54 OsSOD2-R SEQ ID NO.55 OsCATC-F SEQ ID NO.56 OsCATC-R SEQ ID NO.57 OsAPX-FSEQ ID NO.58 OsAPX-R SEQ ID NO.59 OsDREB1A-F SEQ ID NO.60 OsDREB1A-R SEQ ID NO.61.

[0065] Results: 1. Phenotypic observation and survival rate statistics of transgenic Arabidopsis plants under low temperature stress: To investigate the changes in cold resistance of transgenic Arabidopsis plants, three types of Arabidopsis plants (WT, OE-) cultured under normal (24 ℃) conditions for 28 days were subjected to low temperature stress. lncRNA and OE- lncRNA / tae-miR164 Using OE-114 as the experimental material (WT as the control group), the plants underwent cold acclimatization (continuous cultivation at 4 ℃ for 3 days), followed by cultivation at -10 ℃ for 4 h. Phenotypic changes were then observed and compared. Results showed that the phenotypic and growth status of Arabidopsis plants in each group did not change significantly after cold acclimatization. However, after cultivation at -10 ℃, all three Arabidopsis species exhibited varying degrees of leaf curling and darkening of leaf color. Under low-temperature stress, compared with WT plants, OE-114 showed significantly greater leaf growth. lncRNA The plant exhibits less leaf curling and darkening of color, indicating enhanced cold resistance; while OE- lncRNA / tae-miR164 Plants and WT plants suffered more severe damage from low temperatures. Figure 11 After restoring the culture of three Arabidopsis thaliana plants (at 24 ℃ for 7 consecutive days), OE- lncRNA The plants recovered well, almost back to normal, while WT and OE- lncRNA / tae- miR164 The plant was in poor condition and almost completely died. Figure 11 By statistically analyzing and comparing the survival rates after recovery, OE- lncRNA The plant survival rate was significantly higher than that of WT and OE- lncRNA / tae-miR164 Plant height (approximately 80%) Figure 12 ).visible, lncRNA It played a significant role in the cold resistance response of transgenic Arabidopsis plants.

[0066] 2. Development of epidermal hairs and changes in leaf margins in transgenic Arabidopsis plants: By observing and comparing the leaf shapes of three Arabidopsis plants, it was found that OE- lncRNA The plant's leaves have more serrations than WT and OE-. lncRNA / tae-miR164 Plants. Further observation of the epidermal trichome density of the leaves of the three Arabidopsis species using a stereomicroscope revealed that OE- lncRNA The plant has the highest density of epidermal trichomes on its leaves, OE- lncRNA / tae-miR164 No significant difference from WT plants ( Figure 13 ).visible, lncRNAIt plays a significant role in the leaf shape and epidermal hair development of transgenic Arabidopsis plants.

[0067] 3. Changes in root length of transgenic Arabidopsis plants: Among the three Arabidopsis plants cultured under normal (24 ℃) conditions, OE- lncRNA The longest taproot is found in the WT plant, followed by the OE plant. lncRNA / tae-miR164 The shortest taproot of the plant ( Figure 14 ).visible, lncRNA Transgenic Arabidopsis thaliana plants played a significant role in taproot development.

[0068] 4. Changes in stomatal aperture of transgenic Arabidopsis plants under low-temperature stress: Leaves of three Arabidopsis species cultured under different conditions were collected in the morning, fixed, and the stomatal apertures on the leaf epidermis were observed using a scanning electron microscope. The results showed that the stomata on the leaves of the three Arabidopsis species cultured under normal conditions were all in a dilated state; although the stomata on the leaves of the three Arabidopsis species cultured at 4 ℃ for 3 consecutive days showed a tendency to close, the stomatal apertures on the leaves were significantly reduced. lncRNA The degree of stomatal closure on plant leaves compared to WT and OE- lncRNA / tae-miR164 Slightly lighter ( Figure 15 It is evident that under cold stress, lncRNA It plays an important role in regulating stomatal movement in the leaves of transgenic Arabidopsis plants.

[0069] 5. Changes in leaf cell number in transgenic Arabidopsis plants under low-temperature stress: Paraffin sections were prepared from leaves of three Arabidopsis species cultured under normal (24 ℃) conditions. Observation and comparison of leaf cross sections revealed that: OE- lncRNA The ratio of the number of lower epidermal cells and cell layers in Arabidopsis thaliana leaves to WT and OE- lncRNA / tae-miR164 The number of Arabidopsis thaliana plants increased ( Figure 16 ).visible, lncRNA It plays an important role in promoting the division and differentiation of leaf tissue cells in transgenic Arabidopsis plants.

[0070] 6. Changes in cold-resistance-related physiological indicators of transgenic Arabidopsis plants: After measuring and comparing the cold-resistance physiological indicators of three Arabidopsis species under low-temperature stress, the following findings were observed: (1) Changes in MDA content in leaves Compared to the 24 ℃ condition, the MDA content in the leaves of all three Arabidopsis species increased to varying degrees as the temperature decreased; under the three temperature conditions (24 ℃, 4 ℃, and -10 ℃), the OE- lncRNA The MDA content in the plant leaves was lower than that in WT or OE. lncRNA / tae-miR164 The plants showed the most significant differences at -10℃. Figure 17 ).

[0071] (2) Changes in relative conductivity of blades Under conditions of 24 ℃ and 4 ℃, OE- lncRNA OE- lncRNA / tae-miR164 There was no significant difference in the relative electrical conductivity of the leaves of OE- and WT plants; at -10 ℃, the relative electrical conductivity of OE- lncRNA The relative electrical conductivity of the plant leaves was significantly lower than that of OE-. lncRNA / tae-miR164 and WT plants ( Figure 18 ).

[0072] (3) Changes in Pro content in leaves Under low temperature stress (4 °C and -10 °C), OE- lncRNA The Pro content in the plant leaves was higher than that in the OE content. lncRNA / tae-miR164 and WT plants ( Figure 19 ).

[0073] 7. Changes in reactive oxygen species (ROS) content in transgenic Arabidopsis plants under low temperature stress (1) Changes in leaves stained with DAB and NBT chemical tissue Under three temperature conditions (24 ℃, 4 ℃, and -10 ℃), as the temperature decreased, the leaf color (brown when stained with DAB and blue when stained with NBT) of all three Arabidopsis species gradually deepened. However, under different temperature conditions, OE- lncRNA The plant's leaf color is different from that of OE- lncRNA / tae-miR164 The color is slightly lighter than that of WT plants, with the most significant difference observed at -10℃. Figure 20 ).

[0074] (2) ROS (H2O2 and O2) in leaves .- Changes in ROS (H2O2 and O2) content: Under 24 ℃ conditions, the ROS (H2O2 and O2) content in the leaves of three Arabidopsis thaliana plants changed. .- The differences in ROS content were not significant. Under three temperature conditions (24 ℃, 4 ℃, and -10 ℃), the ROS content in the leaves of all three transgenic Arabidopsis plants showed an increasing trend with decreasing temperature; under 4 ℃ and -10 ℃ conditions, the OE- lncRNA The ROS content in the plant leaves was higher than that in the OE content. lncRNA / tae-miR164 The leaves of WT plants contain low levels of ROS, but high levels of OE- lncRNA / tae-miR164 There was no significant difference between the plants and those grown at WT. Figure 21 The changes in ROS content were consistent with the trends observed in DAB and NBT chemical tissue staining. This indicates that, at the physiological level, lncRNA It played an important role in regulating the response of transgenic Arabidopsis plants to low-temperature stress.

[0075] 8. Changes in antioxidant enzyme activity and gene expression in leaves of transgenic Arabidopsis plants under low-temperature stress: After measuring and comparing the enzyme activity and gene expression changes of antioxidant enzyme systems in three Arabidopsis plants under low-temperature stress, the following findings were observed: (1) SOD activity and AtSODs Changes in expression Under three temperature conditions (24 ℃, 4 ℃ and -10 ℃), as the temperature decreased, the SOD activity in the leaves of WT plants gradually decreased, but the OE- lncRNA and OE- lncRNA / tae-miR164 SOD activity in the plants showed a trend of first increasing and then decreasing. SOD activity reached its peak at 4 ℃. Furthermore, under different temperature conditions, OE- lncRNA SOD activity in plant leaves was higher than that in WT and OE- lncRNA / tae-miR164 plant ( Figure 22 (A in the middle).

[0076] RT-qPCR was used to detect the presence of [unclear text - possibly related to Arabidopsis thaliana leaves] AtSOD1 and AtSOD The expression levels of WT and OE- were observed to change under three temperature conditions. The results showed that, with decreasing temperature, the expression levels of WT and OE- decreased. lncRNA and OE- lncRNA / tae-miR164 plant leaves of AtSOD1 The expression levels all showed an upward trend; under different temperature conditions, OE- lncRNA In plant leaves AtSOD1 The expression levels were higher than those of WT and OE- lncRNA / tae-miR164 Plant (see) Figure 22 (B in the text). Meanwhile, under the three temperature conditions, as the temperature decreased, the amount of [unclear - possibly referring to a specific component or element] in the leaves of WT plants [unclear - possibly referring to a specific component or element]. AtSOD2 Expression levels decreased significantly, while OE- lncRNA and OE- lncRNA / tae-miR164 In plant leaves AtSO D2 expression levels showed a trend of first decreasing and then increasing, especially at -10 ℃. lncRNA In the plant leaves AtSOD of 2 expression levels were significantly higher than those of WT and OE- lncRNA / tae-miR164 Plant (see) Figure 22 (C in the middle).

[0077] (2) POD activity and AtPODs Comparison of Expression Changes Under three temperature conditions (24 ℃, 4 ℃ and -10 ℃), POD activity in WT plant leaves gradually increased with decreasing temperature; however, OE- lncRNA and OE- lncRNA / tae-miR164 The activity of POD in plant leaves showed a trend of first increasing and then decreasing. Under different temperature conditions, OE-lncRNA The POD activity in the plant leaves was higher than that in WT and OE- lncRNA / tae- miR164 plant ( Figure 23 (A in the middle).

[0078] RT-qPCR was used to detect the presence of thaliana in Arabidopsis plants. AtPER3 After observing changes in expression levels, it was found that under three temperature conditions, as the temperature decreased, the expression levels in the three transgenic Arabidopsis plants decreased. AtPER3 The expression levels all showed an increasing trend; under different temperature conditions, OE- lncRNA In the plant leaves AtPER3 The expression levels were higher than those of WT and OE- lncRNA / tae-miR164 The plants, especially under conditions of 4 ℃ and -10 ℃ AtPER3 The expression levels differed significantly ( Figure 23 (B in the middle).

[0079] (3) CAT activity and AtCATs Comparison of Expression Changes Under three temperature conditions (24 ℃, 4 ℃, and -10 ℃), CAT activity in the leaves of all three Arabidopsis species decreased with decreasing temperature. Furthermore, at 4 ℃ and -10 ℃, OE- lncRNA CAT activity in plant leaves was higher than that in WT and OE- lncRNA / tae-miR164 plant ( Figure 24 (A in the middle).

[0080] Application of RT-qPCR detection AtCAT1 , AtCAT2 and AtCAT3 After observing changes in expression levels, it was found that under three temperature conditions, as the temperature decreased, OE- lncRNA In the plant leaves AtCAT1 Expression levels showed an upward trend, but WT and OE- lncRNA / tae-miR164 In the plant leaves AtCAT1 The expression level showed a decreasing trend. At 4℃ and -10℃, respectively, OE- lncRNA plant AtCAT1 The expression levels were all higher than those of WT and OE- lncRNA / tae-miR164 medium to tall plants Figure 24 (B) Under three temperature conditions, as the temperature decreased, the leaves of the three Arabidopsis thaliana plants showed changes in... AtCAT2 and AtCAT3 The expression level of OE- showed a trend of first increasing and then decreasing, among which OE- lncRNA In the plant leaves AtCAT2 and AtCAT3 The expression levels were all higher than those of WT and OE- lncRNA / tae-miR164 medium to tall plants Figure 24(C and D in the text). It is evident that at the biochemical and molecular level, lncRNA It plays an important role in mitigating oxidative damage caused by low-temperature stress in transgenic Arabidopsis plants.

[0081] 9. Changes in the expression of key genes in the cold signaling pathway in leaves of transgenic Arabidopsis plants under low-temperature stress: RT-qPCR was used to detect the expression changes of five genes related to the cold signaling pathway in leaves of three Arabidopsis species under low-temperature stress. AtDREB1 , AtDREB2 , AtCOR15a and AtCOR47 A key gene in the ABA-independent cold signal transduction pathway. AtABI5 Key genes in ABA-dependent cold signal transduction pathways 。 The results showed that under conditions of 4 ℃ and -10 ℃, AtDREB1, AtDREB2 , AtABI5, AtCOR47 and AtCOR15a Expression levels significantly increased ( Figure 25 ).visible, lncRNA It plays an important role in the cold signal transduction process in plants and participates in the regulation of cold resistance in transgenic Arabidopsis plants.

[0082] 10. Phenotypic changes in transgenic rice plants under low temperature stress: WT and two transgenic rice lines (OE- lncRNA -1 and OE- lncRNA -10) After cultivation at 12 ℃ for 4 days, the phenotype was observed and compared with that of rice plants cultivated at 28 ℃. The results showed that at 28 ℃, the two transgenic rice lines (OE- lncRNA -1 and OE- lncRNA The plant height of the -10) transgenic rice plants was basically the same as that of the WT plants, and the leaves were normal green; at 12 ℃, the wilting degree of the WT plants was significantly greater than that of the two transgenic rice lines (OE-). lncRNA -1 and OE- lncRNA -10)( Figure 26 It is evident that under low-temperature stress, overexpression lncRNA It improved the cold resistance of genetically modified rice plants.

[0083] 11. Changes in cold resistance-related physiological indicators of transgenic rice plants under low temperature stress (1) Changes in relative conductivity of blades At 28 ℃, two transgenic rice lines (OE- lncRNA -1 and OE- lncRNA The relative electrical conductivity of leaves from OE-10 plants was not significantly different from that of WT plants; however, at 12 ℃, compared with WT plants, the two OE-10 plants showed significantly higher relative electrical conductivity. lncRNAThe relative electrical conductivity of leaves in transgenic rice plants was significantly reduced. This indicates that under low-temperature stress, overexpression... lncRNA This helps maintain the stability of cell membranes in the leaves of transgenic rice plants. Figure 27 ).

[0084] (2) ROS (H2O2 and O2) in leaves .- Content changes The leaves of three rice plants were stained using DAB and NBT. The results showed that the leaves of all three rice plants were darker at 12 ℃ than at 28 ℃. However, at 12 ℃, the staining intensity of the leaves of WT rice plants was significantly lower than that of the two transgenic rice lines (OE-). lncRNA -1 and OE- lncRNA The leaves are deeper (-10) Figure 28 To accurately assess overexpression under low temperature stress. lncRNA The effects of excessive ROS accumulation in rice plants were investigated by examining the levels of H2O2 and O2 in the leaves of three rice species. .- The content was quantitatively determined. The results showed that, although at 12 ℃, the levels of H2O2 and O2 in the leaves of the three rice plants were relatively low. .- The content was higher than that under 28 ℃ conditions, but under 28 ℃ and 12 ℃ conditions, the content of the two transgenic rice lines (OE- lncRNA -1 and OE- lncRNA -10) H2O2 and O2 in the leaves .- The content was lower than that of WT plants ( Figure 29 H2O2 and O2 .- The changes in content were consistent with the results of chemical tissue staining, indicating that under low temperature stress, overexpression... lncRNA can To improve the ability of transgenic rice plants to scavenge ROS and prevent their excessive accumulation, thereby reducing or avoiding the oxidative damage of ROS to membrane lipids.

[0085] 12. Changes in antioxidant enzyme activity and gene expression in leaves of transgenic rice plants under low temperature stress Under low temperature stress, the enzyme activities and gene expression changes of antioxidant enzyme systems in two rice plants were measured and compared, and the results showed that: (1) SOD activity and OsSODs Changes in expression levels The SOD activity in rice leaves was detected using a kit method. The results showed that, at 12 ℃, the SOD activity in wild-type (WT) plants and two transgenic rice lines (OE-) was significantly higher than that in rice leaves. lncRNA -1 and OE- lncRNA SOD activity and related genes (-10) OsSOD1 and OsSOD2) The expression levels were significantly higher than the corresponding values ​​under 28 ℃ conditions. Furthermore, regardless of whether the conditions were 28 ℃ or 12 ℃, the expression levels of these two transgenic rice lines (OE-) were significantly higher. lncRNA -1 and OE- lncRNA -10) The SOD activity in the leaves was significantly higher than that in wild-type (WT) plants. Figure 30 ) (2) CAT activity and OSCATC Comparison of changes in expression levels The activity of CAT in rice leaves was detected using a kit method. The results showed that, at 12℃, CAT activity in WT plants and two transgenic rice lines (OE-) was significantly increased. lncRNA -1 and OE- lncRNA CAT activity and its gene (-10) OsCATC The expression levels of both transgenic rice lines (OE-) showed an increasing trend. Furthermore, regardless of whether the temperature was 28℃ or 12℃, the expression levels of both lines remained relatively stable. lncRNA -1 and OE- lncRNA The CAT activity in the leaves of -10) plants was significantly higher than that in WT plants. Figure 31 ) 13. Changes in the expression of key genes in the cold signaling pathway in transgenic rice plants under low temperature stress RT-qPCR technology was used to detect key genes for cold signal transduction in the leaves of three types of rice plants under low temperature stress. OsDREB The expression changes of 1A) were observed, and the results showed that at 12 ℃, although WT plants and two transgenic rice lines (OE-) showed no change, the expression of 1A) was significantly reduced. lncRNA -1 and OE- lncRNA -10) in the leaves OsDREB1A of The expression levels were significantly increased compared to those under 28 ℃ conditions, but the expression levels of the two transgenic rice lines (OE-) were significantly higher. lncRNA -1 and OE- lncRNA -10) Leaf OsDREB1A in The expression level was still significantly higher than that of WT plants ( Figure 32 ).In summary, lncRNA It plays an important role in regulating the cold resistance of transgenic Arabidopsis and rice plants.

Claims

1. A lncRNA nucleotide sequence, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

11.

2. A recombinant vector or recombinant microbial cell containing the nucleotide sequence shown in SEQ ID NO.

11.

3. Application of the nucleotide sequence shown in SEQ ID NO.11 in improving plant cold resistance.

4. The application according to claim 3, characterized in that, The plant in question is either Arabidopsis thaliana or rice.

5. Application of recombinant vectors containing the nucleotide sequence shown in SEQ ID NO.11 in improving the cold resistance of Arabidopsis thaliana or rice.

6. Application of recombinant microbial cells containing the nucleotide sequence shown in SEQ ID NO.11 in improving the cold resistance of Arabidopsis thaliana or rice.

7. The application according to any one of claims 3 to 6, characterized in that, The cold-resistant treatment conditions are -10 ℃, 4 ℃ and 12 ℃.

8. A method for improving the cold resistance of rice or Arabidopsis thaliana, characterized in that, After overexpressing the nucleotide sequence shown in SEQ ID NO. 11 in rice or Arabidopsis thaliana, Arabidopsis thaliana was cultured at -10 °C and 4 °C, and rice at 12 °C.

9. A breeding method for cold-resistant rice or Arabidopsis thaliana, characterized in that, The specific steps of the method are as follows: Step 1: Ligate the nucleotide sequence shown in SEQ ID NO.11 with the pCMBIA330035Su or pC1390U vector to obtain a recombinant vector; Step 2: Transform the recombinant vector obtained in Step 1 into Agrobacterium to obtain recombinant Agrobacterium; Step 3: Transfect the recombinant Agrobacterium described in Step 2 into Arabidopsis thaliana or rice to obtain transgenic Arabidopsis thaliana plants or transgenic rice plants.

10. Application of transgenic Arabidopsis or rice containing the nucleotide sequence overexpressed as shown in SEQ ID NO.11 in cold-resistant breeding of Arabidopsis or rice.