Application of cotton GhLTP53 gene in plant salt stress

By silencing or overexpressing the cotton GhLTP53 gene, genetic engineering techniques were used to improve the salt stress resistance of cotton and Arabidopsis thaliana, solving the problem of low efficiency in traditional breeding and enhancing the salt stress tolerance of plants.

CN121320366APending Publication Date: 2026-01-13AGRI SCI RES INST OF THE SEVENTH DIVISION OF XINJIANG PROD & CONSTR CORPS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511469845.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Cotton is sensitive to salt stress, traditional breeding methods are inefficient and lack excellent salt-tolerant genetic background, making it difficult to effectively improve the salt stress resistance of cotton with existing technologies.

Method used

By silencing or overexpressing the GhLTP53 gene in cotton, plant plants with silenced or overexpressed GhLTP53 genes can be obtained through VIGS or Agrobacterium-mediated transformation using plant genetic engineering techniques, thereby enhancing their resistance to salt stress.

Benefits of technology

It significantly improved the salt stress tolerance of cotton and Arabidopsis, enhanced the salt resistance of plants, and improved growth status and physiological indicators.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320366A_ABST
    Figure CN121320366A_ABST
Patent Text Reader

Abstract

The invention discloses application of a cotton GhLTP53 gene in plant salt stress, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the cotton gene GhLTP53 is as shown in SEQ ID NO. 1, and the amino acid sequence coded by the gene is as shown in SEQ ID NO. 2. According to the invention, the tolerance of a GhLTP53 gene silencing cotton plant obtained by a VIGS technology to salt stress is obviously enhanced, and the sensitivity of an arabidopsis thaliana homozygous line overexpressing the GhLTP53 gene obtained by a transgenic technology to salt stress is obviously improved. The result shows that the GhLTP53 can play an important role in the plant salt stress response process, has important significance in breeding and research for improving the salt tolerance of cotton, and can be applied to breeding of stress-resistant cotton varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to cotton genes. GhLTP53 Applications in plant salt stress tolerance. Background Technology

[0002] Cotton (Gossypium spp.), a classic representative of the genus Gossypium in the Malvaceae family, is the world's most economically valuable natural fiber crop, playing an irreplaceable role in the evolution of human civilization and the modern industrial system. Its biological core lies in cotton fiber, which develops from the differentiation of epidermal cells in the seed coat. This is a unique single-celled seed hair, its main component being cellulose with a purity of over 90%. During the maturation process, this fiber undergoes secondary wall thickening, ultimately forming a hollow, flat structure with natural twists. This endows cotton fiber with excellent moisture absorption and breathability, a soft hand feel, excellent dyeability, and good biodegradability, establishing its enduring dominant position in the textile industry. Furthermore, beyond its textile origins, the comprehensive value of cotton has been deeply expanded and highlighted in the modern diversified industrial chain. Cotton constitutes a key hub extending from agricultural planting to numerous industries such as textiles, chemicals, pharmaceuticals, and new materials. Therefore, any technological innovation aimed at increasing cotton yield, improving fiber quality, enhancing resistance to stress (such as resisting biological and abiotic stresses), or tapping into the added value of its by-products has profound economic value and strategic significance.

[0003] Soil salinization is a key abiotic stress factor restricting the sustainable development of global agriculture, posing a serious threat to the production of cotton, an important economic crop. As a typical salt-sensitive crop, cotton is susceptible to salt damage during germination, seedling stage, and reproductive growth. In high-salt environments, cotton plants suffer multiple damages, including ion toxicity, osmotic stress, and nutrient imbalance, manifesting as a sharp decline in photosynthetic efficiency, impaired membrane system stability, excessive accumulation of reactive oxygen species, and stunted growth, ultimately leading to a significant decrease in fiber yield and quality. While traditional breeding methods have achieved some success in improving cotton salt tolerance, they are time-consuming, have limited efficiency, and are constrained by the scarcity of superior salt-tolerant genetic backgrounds in cotton germplasm. Therefore, in-depth analysis of the molecular regulatory network of cotton's response to salt stress and the subsequent discovery of key salt-tolerant functional genes are crucial for cultivating high-yielding, high-quality, and highly salt-tolerant new cotton varieties using modern molecular breeding techniques (such as genetic engineering or marker-assisted selection).

[0004] Lipid transfer proteins (LTPs) are a class of small, basic, soluble proteins encoded by a multi-gene family. Their name derives from their core biochemical characteristic: the ability to specifically bind to and mediate the transfer of hydrophobic molecules such as phospholipids and glycolipids between different biological membranes in vitro. Members of this family typically possess a distinctive sequence feature: a characteristic motif composed of eight highly conserved cysteine ​​residues, which stabilize their three-dimensional structure through the formation of four precise disulfide bonds, thus creating a hydrophobic cavity—the structural basis for their binding and transport of lipid molecules. The functions of the LTP gene family extend far beyond their name, playing multiple crucial roles in plant life processes. First, at the physiological and developmental level, LTPs are essential factors for the formation of plant epidermal tissue and the cuticle. They participate in constructing and strengthening the protective barrier of the plant surface by transporting cuticle monomers and waxy precursors; this function is directly related to the integrity of crop organs, water retention capacity, and the appearance quality of fruits. Second, at the level of stress adaptation, LTPs are widely recognized as an important class of disease-related proteins. When plants encounter stresses such as pathogen infection, drought, and salinity, their expression is significantly upregulated. These genes not only directly exert antibacterial activity but also synergistically activate the plant's overall defense response network by strengthening the cell wall and participating in systemic signal transduction, making them an important component of the plant's innate immune system. Therefore, identifying salt-sensitive LTP genes in cotton is of great significance. Summary of the Invention

[0005] In view of the problems existing in the prior art, the present invention aims to study cotton. GhLTP53 Application of genes in plant salt stress.

[0006] The technical solution of the present invention is as follows: A gene that is sensitive to salt GhLTP53 Its nucleotide sequence is shown in SEQ ID NO.1. Its encoded amino acid sequence is shown in SEQ ID No.2.

[0007] Furthermore, the gene GhLTP53 Application in assessing plant salt stress resistance.

[0008] Furthermore, the application is to silence cotton. GhLTP53 Genes that enhance plant resistance to salt stress.

[0009] Furthermore, genes GhLTP53 Salt-sensitive transgenic plants were obtained by transforming plants into plants using plant overexpression vectors mediated by Agrobacterium.

[0010] Furthermore, the plant is cotton or Arabidopsis thaliana.

[0011] Furthermore, the cotton is upland cotton (TM-1).

[0012] Beneficial effects: This invention discloses the upland cotton gene. GhLTP53 Application in enhancing plant salt stress resistance. This invention utilizes VIGS technology. GhLTP53 Gene silencing significantly enhanced the tolerance of cotton plants to salt stress, and transgenic technology achieved overexpression. GhLTP53 The homozygous Arabidopsis line with the gene showed significantly increased sensitivity to salt stress, and this was validated by comparing phenotypic changes, leaf wilting degree, detached leaf water loss rate, relative leaf water content, germination rate, and root elongation after salt stress treatment. Results were obtained... GhLTP53 The transcription factor GH_A06G0216 binds to the upstream promoter. The results indicate that... GhLTP53 It plays an important role in the plant salt stress response process and is of great significance in the breeding and research of improving cotton salt tolerance. It can be applied to the selection of stress-resistant cotton varieties. Attached Figure Description

[0013] Figure 1 The diagram shows the gene silencing efficiency of albino plants (PDS) after VIGS injection into cotton plants (A) and WT, TRV2:00 and TRV2:GhLTP53 in the embodiments of the present invention (B).

[0014] Figure 2 This is a schematic diagram illustrating the phenotypic changes of plants treated with VIGS injection before and after salt stress, as provided in an embodiment of the present invention.

[0015] Figure 3 This is a schematic diagram of DAB staining results after salt stress treatment of plants injected with VIGS, provided in an embodiment of the present invention.

[0016] Figure 4 This is a schematic diagram showing the statistical results of chlorophyll content (A), plant height (B), and root length (C) of plants treated with salt stress after VIGS injection, as well as a schematic diagram of plant height and root length (D) provided in this embodiment of the invention.

[0017] Figure 5 This is a schematic diagram showing the results of measuring the water loss rate (A) and relative water content (B) of detached leaves after salt stress treatment of plants injected with VIGS, provided in an embodiment of the present invention.

[0018] Figure 6 This invention relates to the acquisition of transgenic Arabidopsis thaliana with the GhLTP53 gene and the detection of GhLTP53 gene expression level in the T2 generation. A: Positive screening process of transgenic Arabidopsis thaliana with the GhLTP53 gene; B: PCR detection of transformation results of T1 generation transgenic Arabidopsis thaliana, M is Marker 2000.

[0019] Figure 7 The GhLTP53 transgenic line and wild-type phenotype under salt stress treatment provided in this embodiment of the invention.

[0020] Figure 8 The physiological indicators and biochemical traits of the GhLTP53 transgenic line and wild-type were determined under salt stress treatment as provided in this embodiment of the invention. A: DAB staining of rosette leaves of the GhLTP53 Arabidopsis transgenic line; B: Chlorophyll content determination; C: Determination of water loss rate of detached leaves; D: Determination of relative water content of leaves.

[0021] Figure 9 This is a schematic diagram of the luciferase complementary reporter gene experiment results provided in an embodiment of the present invention. Detailed Implementation

[0022] The specific implementation of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the methods used in the following embodiments are conventional methods; the reagents and materials used are commercially available unless otherwise specified.

[0023] Using the Arabidopsis thaliana LTP protein sequence, LTP genes in four cotton species (upland cotton, sea island cotton, Asian cotton, and Gossypium redmondii) were searched using Local BLASTP. The identified LTP genes were validated using HMM (Hidden Markov Model) maps obtained from the Pfam (PF14368) database. The domains of the LTP protein were analyzed using NCBI Batch-CDD. To investigate the physicochemical properties of the LTP gene, analysis was performed using an online database (https: / / web.expasy.org / compute_pi / ), resulting in gene GH_D04G0683, designated as GhLTP53. Primers were designed using SnapGene, and PCR (Polymerase Chain Reaction) was used to amplify the protein from the upland cotton standard line TM-1. The full-length CDS was 348 bp (SEQ ID No. 1), encoding 115 amino acids (SEQ ID No. 2), with a relative molecular weight of 12.21 kDa and an isoelectric point of 8.62.

[0024] The following introduces cotton genes. GhLTP53 Applications in plant salt stress tolerance.

[0025] Example 1 Verification using VIGS experiments GhLTP53 The role of genes in cotton's resistance to salt stress 1.1 Construction of plant VIGS vector TRV2:GhLTP53 Upland cotton TM-1 was used as the VIGS injection material. After soaking the seeds for one day, they were planted in a sterilized substrate composed of sand and vermiculite, placed in a greenhouse environment at 28 ℃, following a photocycle of 16 hours of light and 8 hours of darkness, and maintaining a relative humidity of 68% to allow for normal growth. When the cotton seedlings' cotyledons were fully expanded, they were injected with VIGS. During injection, the underside of the cotyledons was punctured with the syringe needle, and then the target gene, PDS, and empty vector (TRV2:00) bacterial solution were injected into the leaf, filling the entire leaf. After injection, the cotton seedlings were cultured in the dark in a greenhouse for 24 hours; after 24 hours, normal growth culture was carried out. The cotton seedlings injected with PDS showed an albino phenotype after about 12 days of growth. Figure 1 (A) Once the albino phenotype was relatively stable, RNA was extracted from true leaves of cotton plants carrying the WT, empty vector, and the target gene (TRV2:GhLTP53), and reverse transcribed into cDNA for RT-qPCR detection. RT-qPCR was used to detect the expression of GhLTP53 in WT, TRV2:00, and TRV2:GhLTP53. The results showed that the expression of the GhLTP53 gene in WT and TRV2:00 did not change significantly, but the expression in TRV2:GhLTP53 plants was significantly reduced and lower than that in WT and TRV2:00, indicating that the GhLTP53 gene silencing in TRV2:GhLTP53 plants was successful (see [link to article]). Figure 1 (Comparison of silencing efficiency in B). After the plants developed three true leaves, they were transferred to trays containing 250 mM / L NaCl for salt stress treatment. True leaves were collected at 0 h and one week, and then frozen in liquid nitrogen and stored at -80℃.

[0026] 1.2 Identification of gene-silenced cotton phenotypes for salt stress resistance Before salt stress treatment, under the control (CK) conditions, WT, TRV2:00, and TRV2:GhLTP53 seedlings showed uniform growth. After one week of treatment with 250 mM / L NaCl, WT and TRV2:00 seedlings showed uniform growth but more severe leaf yellowing and wilting, while TRV2:GhLTP53 seedlings exhibited better leaf growth (see...). Figure 2 This indicates that silencing the GhLTP53 gene increases the salt tolerance of cotton plants.

[0027] 1.3 Effects of DAB on Salt Stress Before and After Treatment GhLTP53 Gene-silenced plants, WT and empty vector (TRV2:00) staining Leaves from WT, TRV2:00, and TRV2:GhLTP53 cotton plants treated with salt were collected at 0 h and 1 week. DAB staining was used to verify leaf damage after salt stress treatment. First, the DAB staining working solution was prepared: reagent A and reagent B were mixed at a volume ratio of 1:19. In this example, 3 mL of reagent A and 57 mL of reagent B were used. Then, cotton leaves from 0 h and 1 week of salt stress treatment were immersed in the DAB staining working solution for staining, with the time controlled at 10-16 h. After staining, the leaf color was removed by gradient washing with anhydrous ethanol, 70% and 50% anhydrous ethanol, three times for each gradient, 1 h each time. DAB staining showed that under normal conditions, the ROS accumulation in the leaves of WT, TRV2:00, and TRV2:GhLTP53 cotton was very low, and the brown appearance of the leaves was not obvious. After salt stress treatment, cotton plants showed brown areas on their leaves. The browning of leaf veins was more pronounced in WT and TRV2:00 plants than in TRV2:GhLTP53 plants, indicating that under the same 250 mM / L NaCl salt stress conditions, TRV2:GhLTP53 plants suffered less damage, while WT and TRV2:00 plants suffered more severe damage. Figure 3 ), GhLTP53 Gene silencing enhances the salt tolerance of cotton plants.

[0028] 1.4 GhLTP53 Measurement of physiological changes in gene-silenced cotton plants under salt stress The chlorophyll content (SPAD), plant height, and root length of cotton leaves from WT, TRV2:00, and TRV2:GhLTP53 were measured at 0 and 7 days of salt treatment. Using a SPAD analyzer to determine the relative chlorophyll content in cotton leaves, we observed that at 0 days of salt stress treatment, the chlorophyll content of WT, TRV2:00, and TRV2:GhLTP53 was essentially the same, with no significant difference. However, after 7 days of salt treatment, the chlorophyll content of TRV2:GhLTP53 plants decreased less than that of WT and TRV2:00 plants, indicating that gene-silenced plants under salt stress showed better growth than WT and TRV2:00 plants. Figure 4 (A). Furthermore, by comparing plant height and root length, we found that after silencing the TRV2:GhLTP53 gene, the TRV2:GhLTP53 plants had longer plant height and root length than the WT and TRV2:00 plants. Figure 4 (B, C, and D) Explanation GhLTP53 It may play a crucial role in regulating the growth of cotton stems and roots. From the results, we can see... GhLTP53 The plant's resistance to salt stress increases after silencing.

[0029] 1.5 Determination of water loss rate and relative water content of detached leaves Cotton leaves were collected for the determination of physiological traits, including relative leaf water content (RLWC) and excised leaf water loss (ELWL). All experiments were performed in at least three biological replicates.

[0030] Excised Leaf Water Loss (ELWL): Three cotton leaves of roughly the same size were taken, and their fresh weight (FW) was measured. The leaves were then placed in a 28℃ greenhouse for 24 hours, and their wilted weight (WW) was measured. The leaves were then dried in a 50℃ oven for 24 hours, and their dry weight (DW) was measured. The calculation formula is: Excised Leaf Water Loss (ELWL) = [(FW-WW) / (FW-DW)] × 100%.

[0031] Relative Leaf Water Content: Take three cotton leaves of roughly the same size and immediately weigh the fresh weight (FW). Soak the leaves in distilled water at 28℃ for 24 hours, blot dry the surface moisture with paper, and weigh the saturated weight (SW). Then, dry the leaves in a 50℃ oven for 48 hours and weigh the dry weight (DW). Calculation formula: Relative Leaf Water Content (RLWC) = [(FW-DW) / (SW-DW)] × 100% The measurement results of ELWL and RLWC are as follows: Figure 5 Figures A and B are shown. The results showed that under normal conditions, there were no significant differences in the physiological parameters of WT, TRV2:00, and TRV2:GhLTP53. However, when salt stress was applied to each strain, GhLTP53 Silent plants showed a positive effect compared to WT.

[0032] After salt stress treatment GhLTP53 The water loss rate of detached leaves from silent plants was significantly lower than that of WT and TRV2:00, indicating that silent plants... GhLTP53 The leaves of the gene-modified plants lost water more slowly than those of WT and TRV2:00 plants, thus enhancing the water retention capacity of the leaves under salt stress. Figure 5 (A). After salt stress treatment, the relative water content of leaves with the GhLTP53 gene silenced was significantly higher than that of leaves with WT and TRV2:00. Figure 8 (B) From the results we can see GhLTP53 The salt tolerance of gene-silenced plants was significantly increased compared with that of WT plants.

[0033] Example 2 Validation using plant overexpression vectors GhLTP53 The role of genes in salt stress in Arabidopsis 2.1 Construction of plant overexpression vector pCAMBIA3301-GhLTP53 according to GhLTP53 Gene cloning primers were designed based on the CDS coding region sequence (F: GAACACGGGGGACTCTTGACATGAAGTTCATTGGCTGTTTTC; R: GATCGGGGAAATTCGAGCTGGTCATCAAGGCAAAGTGTATTCTCC). Using upland cotton cDNA as a template, the gene was amplified by PCR. GhLTP53 The target gene fragment was obtained by double digestion of the plant overexpression vector pCAMBIA3301 (Basta resistant) with restriction endonucleases NcoI and BstEII, and the target gene fragment and vector fragment were recovered. The target gene fragment and vector fragment were ligated, and the ligation product was transformed into *E. coli* DH5α competent cells. The recombinant vector pCAMBIA3301-GhLTP53 was obtained. After confirming correct sequencing results, the plasmid containing the target gene was extracted and transformed into *Agrobacterium* GV3101 competent cells. After *Agrobacterium* grew into single colonies, colony PCR was performed on the single colonies, obtaining single colonies with PCR products of the same size as the target gene. The single colonies were then cultured by shaking and stored at -80℃ for later use. Thus, the plant overexpression recombinant vector pCAMBIA3301-GhLTP53 was successfully constructed.

[0034] 2.2 Screening of transformed Arabidopsis thaliana and transgenic Arabidopsis thaliana In a clean bench, Arabidopsis seeds were placed in 2.0 mL centrifuge tubes, and 0.1% HgCl2 was added to cover the seeds. The tubes were gently shaken for 4-5 min, centrifuged at 12000 r / min for 1 min, and the HgCl2 was discarded. The seeds were then washed twice with sterile water and placed in a 4 ℃ refrigerator for vernalization for 2-3 days. Arabidopsis seeds were then sown on prepared MS solid medium and placed in an Arabidopsis greenhouse (22℃, 16 h light / 8 h dark). Once the Arabidopsis had two true leaves, they were transplanted into potting soil. During peak flowering, open flowers and pods were removed, preserving as many flower buds as possible. Inflorescence infection was performed, and the Arabidopsis were thoroughly watered 24 hours before infection. The resuspension of Agrobacterium containing the pCAMBIA3301-GhLTP53 plasmid also contained Silweet-77 200 μL / L, MS 2.15 g / L, sucrose 50 g / L, AS 200 mmol / mL, and pH 5.7-5.8. To improve transformation efficiency, infection was performed once a week for a total of 3 times. After each infection, the bacteria were incubated in the dark for 24 h, followed by normal growth in a greenhouse.

[0035] Normal, mature seeds were harvested from infected Arabidopsis plants. After drying at 37°C, the seeds were evenly sown into nutrient soil and covered with plastic wrap for cultivation. Once green shoots appeared (approximately 2-4 days), the plastic wrap was removed, and herbicide was sprayed twice daily, morning and evening. Herbicide preparation: 750 μL of Basta (10% solution) diluted in 500 mL of water. One week after herbicide application, the plants were cultured normally for 5-6 days. Negative-positive plants developed yellow cotyledons and true leaves, smaller leaves, and failed to grow normally, while positive transgenic plants had light green cotyledons and true leaves with larger leaves. T1 generation positive Arabidopsis thaliana were screened by PCR (…). Figure 6 (A) Healthy Arabidopsis seedlings were transplanted into small pots filled with nutrient soil. After 3-4 weeks of normal growth, rosette leaves were harvested and DNA extracted. Specific primers (F: ATGAAGTTCATTGGCTGTTTTC, R: GATCGGGGAAATTCGAGCTGGTCA) were designed using the gene start position and a sequence segment from the vector. PCR was performed to identify positive seedlings, with wild-type Arabidopsis DNA used as a negative control. Based on the PCR results, false-positive plants were removed, and positive plants were retained. Figure 6 (B) Screening and identification of T2 generation single-copy positive Arabidopsis thaliana. Seeds from the normally grown and matured T1 generation positive Arabidopsis thaliana were sterilized in a clean bench with 0.1% mercuric chloride for 4-5 min, washed three times with sterile water for 5 min each time, and then spread on MS solid medium containing 0.1% Basta (10% solution) for a second screening and identification. Because Arabidopsis thaliana is a diploid plant, the positive Arabidopsis thaliana selected in the first screening were heterozygous. In the T2 generation positive lines, a segregation ratio of 3:1 (positive plant: negative plant) was observed. Single-copy lines that met the segregation ratio were retained, planted under normal conditions, and leaf DNA was extracted for molecular detection. Positive plants were retained. Seeds from the harvested T2 generation lines were further screened by spraying with herbicide to obtain T3 generation stable transgenic Arabidopsis thaliana lines. Leaf DNA was extracted for PCR detection. Homozygous lines were retained. After normal growth, seeds were collected and stored for subsequent experiments.

[0036] 2.3 Arabidopsis thaliana overexpressing GhLTP53 responds to salt stress Stable T3 generation transgenic Arabidopsis thaliana lines and wild-type (WT) were sown on 1 / 2 MS solid medium and grown in an Arabidopsis greenhouse for 8 days (until the seedlings had 4-5 cotyledons). Afterward, they were transferred to nutrient soil for soil cultivation. Two weeks after soil cultivation, both wild-type and transgenic Arabidopsis lines were subjected to salt stress treatment with 250 mM / L NaCl. Phenotypic characteristics were observed at 3, 6, and 12 days of stress treatment. A comparison of the phenotypes of the GhLTP53 transgenic line and wild-type (WT) and the size and morphology of rosette leaves in response to salt stress is shown below. Figure 7 As shown.

[0037] The results showed that before salt stress treatment, the wild-type and GhLTP53 transgenic lines exhibited good phenotypes and growth status with no significant differences. After salt stress treatment, Arabidopsis plants suffered varying degrees of damage. In GhLTP53-overexpressing plants, large areas of rosette leaves withered after salt stress treatment, and most transgenic plants were nearly dead after 12 days of salt treatment. Wild-type (WT) plants showed wilting leaves, but overall plant viability was better, and the mortality rate after 12 days of salt treatment was significantly lower than that of transgenic plants. Figure 7 Therefore, salt stress has a greater impact on transgenic lines compared to wild-type lines.

[0038] 2.4 DAB overexpression before and after salt stress treatment GhLTP53 Arabidopsis thaliana and WT rosette leaves were stained. Wild-type and transgenic Arabidopsis thaliana were stained using a DAB staining kit, following the same staining method as the DAB staining experiment on leaves of cotton plants with the GH_D04G0683 (GhLTP53) gene silenced. Four leaves were used in each group, and the results were repeated three times.

[0039] DAB staining results are as follows Figure 8 As shown in Figure A. DAB staining results showed that wild-type Arabidopsis leaves had lower ROS accumulation and were lighter brown; the transgenic lines had significantly more brown areas on their leaves than wild-type Arabidopsis leaves, and the staining was deeper. Under the same salt stress treatment, the GhLTP53 transgenic Arabidopsis lines suffered more damage. Therefore, under salt stress conditions, the GhLTP53 transgenic lines suffered greater cell damage than wild-type Arabidopsis.

[0040] 2.5 Determination of chlorophyll content, water loss rate of detached leaves, and relative water content of leaves Transgenic lines and wild-type (WT) plants were grown under normal conditions for 4 weeks, followed by 7 days of salt stress treatment. The chlorophyll content of rosette leaves in both the control and treatment groups was measured using a SPAD analyzer. The chlorophyll content was as follows: Figure 8As shown in B, under non-salt stress treatment, there was no difference in chlorophyll content between wild-type Arabidopsis and the GhLTP53 transgenic line; after salt stress, the chlorophyll content of the transgenic line leaves decreased significantly compared to that of wild-type Arabidopsis, indicating that the growth of the transgenic Arabidopsis was worse than that of wild-type Arabidopsis under salt stress treatment.

[0041] Leaves of Arabidopsis thaliana were collected for the determination of physiological traits, including relative leaf water content (RLWC) and excised leaf water loss (ELWL). All experiments were performed in at least three biological replicates.

[0042] Excised Leaf Water Loss (ELWL): Twelve Arabidopsis thaliana leaves of approximately the same size were taken, and their fresh weight (FW) was measured. The leaves were then placed in a 21°C greenhouse for 24 hours, and their wilted weight (WW) was measured. The leaves were then dried in a 50°C oven for 24 hours, and their dry weight (DW) was measured. The calculation formula is: Excised Leaf Water Loss (ELWL) = [(FW-WW) / (FW-DW)] × 100%.

[0043] Relative Leaf Water Content: Twelve Arabidopsis thaliana leaves of roughly the same size were taken, and their fresh weight (FW) was immediately measured. The leaves were then soaked in distilled water at 21°C for 24 hours. The surface moisture of the leaves was then blotted dry with paper, and the saturated weight (SW) of the sample was measured. The leaves were then dried in a 50°C oven for 48 hours, and the dry weight (DW) of the sample was measured. Calculation formula: Relative Leaf Water Content (RLWC) = [(FW-DW) / (SW-DW)] × 100%.

[0044] The measurement results of ELWL and RLWC are as follows: Figure 8 Figures C and D are shown. The results showed that under normal conditions, there were no significant differences in the physiological indicators between the transgenic line and the wild type (WT). However, when salt stress was applied to each plant, the GhLTP53 transgenic line showed salt sensitivity compared to the wild type.

[0045] After salt stress treatment, the water loss rate of detached leaves of the GhLTP53 transgenic line was significantly higher than that of wild-type Arabidopsis, indicating that overexpression of the GhLTP53 gene directly led to a decrease in the water retention capacity of leaves and an accelerated rate of water loss under salt stress. Figure 8 (C) After salt stress treatment, the relative leaf water content of the GhLTP53 transgenic line was significantly lower than that of wild-type Arabidopsis, indicating that salt stress impaired the plant's ability to maintain water balance under salt stress, and the overexpressing plants showed a higher degree of damage. Figure 8(D). The results show that the GhLTP53 transgenic line is more sensitive to salt stress than the wild type.

[0046] Example 3 Luciferase Complementation Reporter Gene Assay Using the PlantTFDB transcription factor prediction online website, the transcription factor binding to the upstream promoter of GhLTP53 was predicted, and GH_A06G0216 was obtained. It is speculated that GH_A06G0216 (belonging to the MYB family, denoted as GhMYB) may be a potential transcription factor binding to the upstream promoter of GhLTP53. To verify whether the transcription factor GH_A06G0216 has a regulatory effect on the upstream promoter of GhLTP53, a 2000 bp upstream promoter of GhLTP53 was cloned from the mixed DNA of TM-1, inserted into the pGreen-0800-LUC vector, and the pGreen-0800-GhLTP53 recombinant plasmid was constructed. Then, a 762 bp full-length CDS of GhMYB was cloned from the mixed cDNA of TM-1, inserted into the pGreen-62-SK vector, and the GhMYB-62-SK recombinant plasmid was constructed. GhMYB-62-SK and pGreen-0800-GhLTP53 were used as experimental groups, and pGreen-62-SK and pGreen-0800-GhLTP53 were used as control groups. The protein expression was detected by Luciferase activation assay, and the results were observed by fluorescence imaging.

[0047] It was found that the co-conversion of GhMYB-62-SK and pGreen-0800-GhLTP53 into tobacco could produce a fluorescent signal. Figure 9 Therefore, it was hypothesized that GhMYB could bind to the GhLTP53 promoter. The results indicate that GhMYB influences transcription by binding to the GhLTP53 promoter.

[0048] In summary, this invention obtained GhLTP53 gene-silenced cotton lines through VIGS experiments. By comparing the salt stress tolerance of wild-type cotton (WT), empty plants (TRV2:00), and gene-silenced lines (TRV2:GhLTP53), the results showed that the phenotype and physiological indicators of gene-silenced lines (TRV2:GhLTP53) under salt stress treatment were better than those of wild-type and empty plants. This invention also obtained GhLTP53 overexpressing transgenic Arabidopsis homozygous lines through transgenic technology. By comparing the salt stress tolerance of wild-type Arabidopsis and transgenic Arabidopsis, the results showed that Arabidopsis plants suffered varying degrees of damage after salt stress treatment. After salt stress treatment, the rosette leaves of the overexpressing Arabidopsis plants showed extensive wilting, and most of the plants died after 12 days of salt treatment. Wild-type Arabidopsis plants also showed wilting leaves, but overall plant activity was better, and no significant mortality was observed. Compared to the wild type, salt stress had a greater impact on the transgenic lines. Furthermore, after salt stress treatment, the water loss rate of detached leaves in the GhLTP53 transgenic lines was significantly higher than that in wild-type Arabidopsis, indicating that overexpression of the GhLTP53 gene reduces the plant's water-holding capacity. After salt stress treatment, the relative water content of the leaves in the GhLTP53 transgenic lines was significantly lower than that in wild-type Arabidopsis, indicating a more severe impairment of the overexpressing lines' ability to maintain water balance. These results show that the GhLTP53 transgenic lines are more sensitive to salt stress than the wild type, suggesting that this gene plays a negative regulatory role in plant salt tolerance. We verified through dual-luciferase reporter gene assays that the transcription factor GH_A06G0216 can bind to the promoter of GhLTP53 and affect its transcription.

Claims

1. A cotton gene GhLTP53 Its characteristics , Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The cotton gene according to claim 1 GhLTP53 Its characteristics are, The amino acid sequence encoded by the gene is shown in SEQ ID No.

2.

3. The cotton gene as described in claim 1 GhLTP53 Application in plant salt stress tolerance.

4. The application according to claim 3, characterized in that, The plant in question is cotton.

5. The application according to claim 4, characterized in that, By silencing the cotton GhLTP53 Genes that enhance cotton's resistance to salt stress.

6. The application according to claim 3, characterized in that, The gene GhLTP53 Salt-sensitive transgenic plants were obtained by transforming plants into overexpression vectors via Agrobacterium-mediated transformation.

7. The application according to claim 6, characterized in that, The plant in question is Arabidopsis thaliana.