Application of PtNPF6.4 gene in enhancing low nitrogen stress resistance of poplar

By constructing an overexpression vector of the PtNPF6.4 gene in poplar, nitrogen absorption and photosynthesis were enhanced, solving the growth limitation of poplar under low nitrogen stress and achieving significant improvement in growth, development and photosynthesis, providing theoretical support for forest tree breeding.

CN121320428APending Publication Date: 2026-01-13HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511792332.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-01
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

In existing technologies, poplar trees have low nitrogen use efficiency under low nitrogen stress conditions, which affects their growth and productivity. There is a lack of effective genetic modification methods to improve nitrogen absorption and transport capacity.

Method used

By constructing transgenic poplar materials with overexpression and knockout of the PtNPF6.4 gene, the expression of the PtNPF6.4 gene or its protein function is promoted, thereby improving nitrogen absorption and photosynthesis in poplar trees and enhancing their resistance to low nitrogen stress.

Benefits of technology

It significantly improved the growth and development of poplar under low nitrogen stress conditions, increased nitrogen content, enhanced photosynthetic capacity, and promoted growth, providing a theoretical basis and excellent candidate genes for nitrogen-efficient breeding of forest trees.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320428A_ABST
    Figure CN121320428A_ABST
Patent Text Reader

Abstract

The invention relates to an application of a PtNPF6.4 gene in enhancing low nitrogen stress resistance of poplar, and by creating a PtNPF6.4 gene overexpression and knocking out a transgenic poplar material, the nitrogen content of a PtNPF6.4 overexpression strain under a low nitrogen stress condition is improved, and the plant height, the leaf number, the biomass and the root development are remarkably improved; meanwhile, the plant shows higher net photosynthetic rate, stomatal conductance and transpiration rate. The gene effectively promotes nitrogen absorption of the poplar under low nitrogen stress, the photosynthesis of the poplar is remarkably improved, the growth and development of the poplar are further promoted, and the low nitrogen stress resistance of the poplar is enhanced. The important function of the PtNPF6.4 gene in the aspect of remarkably improving the low nitrogen stress of the poplar is found for the first time, a theoretical basis and an excellent candidate gene are provided for efficient nitrogen breeding of forest trees, and the PtNPF6.4 gene has important theoretical and practical significance in directional breeding of artificial wood trees and accurate improvement of forest quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of the PtNPF6.4 gene in enhancing the resistance of poplar to low nitrogen stress. Background Technology

[0002] Nitrogen is one of the mineral elements required in the largest quantities for plant growth and development, and it is also a key limiting factor restricting forest growth and productivity. In natural and agroforestry ecosystems, nitrogen availability often fluctuates, and low nitrogen stress has become one of the major abiotic stress factors affecting normal plant growth. Therefore, improving plants' adaptability to low nitrogen stress is of great significance for ensuring healthy forest growth, increasing timber yield and quality, reducing fertilizer application, and alleviating environmental pressure. Furthermore, using modern biotechnology to improve forest trees and enhance nitrogen use efficiency can not only shorten the breeding cycle but also improve the purposefulness and feasibility of breeding programs.

[0003] Plants mainly rely on their roots to absorb inorganic nitrogen from the soil, including nitrates (NO3). - Nitrate is the primary nitrogen source for most plants. To adapt to the dynamic changes in nitrate concentration in the external environment, plants have evolved two nitrate transport systems. When the nitrate concentration in the environment is low (<1 mM), the high-affinity transport system (HATS), a transport system capable of efficiently uptakeing low concentrations of nitrate, begins to function. When the nitrate concentration is high (>1 mM), the low-affinity transport system (LATS) is mainly responsible for the rapid uptake of nitrate under high concentration conditions, participating in the nitrate transport process. Members of the nitrate transporter 1 / peptide transporter family (NPF) play crucial roles in both HATS and LATS, not only participating in nitrogen uptake and transport but also exhibiting important regulatory functions in plant responses to nitrogen stress.

[0004] Poplar (Populus) is an important afforestation and timber species in my country, characterized by easy propagation, rapid growth, and good environmental adaptability. As a fast-growing plant, poplar has an extremely high demand for nitrogen. Breeding poplar varieties with efficient nitrogen absorption and utilization characteristics, and tolerance to low nitrogen stress, is an important way to improve forestry production efficiency and achieve sustainable management. Furthermore, as a perennial woody model plant, its nitrogen absorption and utilization mechanism may have evolved a different regulatory network than that of herbaceous plants. Research findings on poplar can provide a reference for research on other economic tree species and have important reference value for promoting the genetic improvement of woody plants. Current research has found that PtNPF6.4 is a key transporter protein in poplar involved in nitrate absorption. Our previous work confirmed that this protein plays an important role in nitrogen absorption in poplar, but its physiological function and potential stress resistance mechanism under low nitrogen stress conditions remain unclear. Therefore, in-depth exploration of the role of the poplar PtNPF6.4 gene in the process of nitrogen utilization in poplar will provide crucial theoretical support for efficient nitrogen breeding of forest trees. Summary of the Invention

[0005] This invention utilizes molecular biology and genetic improvement techniques to create transgenic poplar materials with PtNPF6.4 gene overexpression and knockout. The study found that PtNPF6.4 overexpression lines exhibited increased nitrogen content under low nitrogen stress, significantly improved plant height, leaf number, biomass, and root development. Simultaneously, the plants displayed higher net photosynthetic rate, stomatal conductance, and transpiration rate. This indicates that the gene effectively promotes nitrogen uptake in poplar under low nitrogen stress, significantly enhancing photosynthesis and thus promoting growth and development, thereby strengthening the poplar's resistance to low nitrogen stress. This provides a theoretical basis and excellent candidate genes for high-efficiency nitrogen breeding in forest trees, and has significant theoretical and practical implications for the targeted cultivation of artificial timber forests and the precise improvement of forest quality.

[0006] This invention provides the application of the PtNPF6.4 gene in any of the following A1)-A4): A1) Enhance the resistance of poplar to low nitrogen stress; A2) Prepare products that enhance the resistance of poplar to low nitrogen stress; A3) Cultivate poplar germplasm resistant to low nitrogen stress; A4) Prepare and cultivate poplar germplasm products resistant to low nitrogen stress; The amino acid sequence encoded by the PtNPF6.4 gene is shown in SEQ ID NO:2.

[0007] Furthermore, the nucleotide sequence of the PtNPF6.4 gene is shown in SEQ ID NO:1.

[0008] Furthermore, by promoting the expression of the PtNPF6.4 gene or enhancing the function or activity of its protein, the resistance of poplar to low nitrogen stress can be enhanced.

[0009] Furthermore, the PtNPF6.4 gene enhances the photosynthesis of poplar trees by promoting nitrogen absorption, thereby promoting their growth and development and improving their resistance to low nitrogen stress.

[0010] Furthermore, the PtNPF6.4 gene promotes photosynthesis in poplar trees by increasing net photosynthetic rate, stomatal conductance, intercellular carbon dioxide concentration, and transpiration rate.

[0011] Furthermore, the poplar germplasm exhibits all or some of the following: B1) Increased plant height, number of leaves, and biomass; B2) Increased nitrogen content in roots, stems, and leaves; B3) Increased total nitrogen content in plants; B4) Increased net photosynthetic rate, stomatal conductance, intercellular carbon dioxide concentration, and transpiration rate.

[0012] This invention also provides the application of the overexpression vector containing the PtNPF6.4 gene in any of the following A1)-A4): A1) Enhance the resistance of poplar to low nitrogen stress; A2) Prepare products that enhance the resistance of poplar to low nitrogen stress; A3) Cultivate poplar germplasm resistant to low nitrogen stress; A4) Prepare and cultivate poplar germplasm products resistant to low nitrogen stress; The amino acid sequence encoded by the PtNPF6.4 gene is shown in SEQ ID NO:2.

[0013] Furthermore, the backbone vector of the overexpression vector is the expression vector pK2GW7.

[0014] Furthermore, the construction method of the overexpression vector containing the PtNPF6.4 gene includes: S1. Poplar cDNA was amplified using primers as shown in SEQ ID NO:3-4 to obtain the PtNPF6.4 gene fragment as shown in SEQ ID NO:1; S2. Using the PtNPF6.4 gene fragment obtained in step S1 as a template, amplification is performed using primers as shown in SEQ ID NO:5-6, so that the attB1 site sequence is added upstream of the PtNPF6.4 gene fragment and the sequence homologous to GFP is added downstream. S3. Using a plasmid containing the GFP fragment as a template, amplification is performed using primers as shown in SEQ ID NO:7-8, adding an overlapping extension PCR sequence homologous to the R end of the PtNPF6.4 gene upstream and an attB2 site sequence downstream. S4. Using a high-fidelity enzyme, the PtNPF6.4 obtained in step S2 and the GFP fragment obtained in step S3 were ligated by overlap extension PCR to obtain the ligation product attB1-PtNPF6.4-GFP-attB2. S5. The ligation product attB1-PtNPF6.4-GFP-attB2 was recombined into the intermediate vector pDONR207 via the BP reaction, and then recombined into the pK2GW7 expression vector via the LR reaction to obtain the overexpression vector pK2GW7-PtNPF6.4-GFP containing the PtNPF6.4 gene.

[0015] The present invention also provides a method for enhancing the resistance of poplar to low nitrogen stress or for cultivating poplar germplasm resistant to low nitrogen stress, by promoting the expression of the PtNPF6.4 gene in poplar or enhancing the function or activity of its protein, thereby enhancing the resistance of poplar to low nitrogen stress; wherein the amino acid sequence encoded by the PtNPF6.4 gene is shown in SEQ ID NO:2.

[0016] Furthermore, using the expression vector pK2GW7 as the backbone vector, an overexpression vector containing the PtNPF6.4 gene was constructed to increase the expression level of the PtNPF6.4 gene, and then transformed into poplar trees to obtain PtNPF6.4 gene overexpression lines.

[0017] Furthermore, the overexpression vector containing the PtNPF6.4 gene was transferred into Agrobacterium GV3101 competent cells and genetically transformed into poplar trees via Agrobacterium infection.

[0018] Beneficial Effects: This invention uses Populus tremula × P. alba 717-1B4 as the research object, and successfully created transgenic materials of PtNPF6.4 overexpression lines and ptnpf6.4 mutants in poplar through molecular biology and genetic improvement methods. The function of PtNPF6.4 in the efficient nitrogen utilization of poplar under low nitrogen stress was preliminarily evaluated. Results of different concentrations of nitrate treatment on PtNPF6.4 transgenic poplar showed: 1. Under low nitrogen stress, the plant height, number of leaves, biomass and root development of PtNPF6.4 overexpression lines were significantly better than those of wild type and mutant, indicating that PtNPF6.4 can significantly promote the growth and development of poplar and nitrogen uptake.

[0019] 2. The PtNPF6.4 overexpression lines exhibited higher net photosynthetic rate, stomatal conductance, and transpiration rate under low nitrogen conditions, indicating that they alleviated the inhibition of plant growth by low nitrogen stress by promoting photosynthesis and promoted the growth and development of poplar.

[0020] 3. PtNPF6.4 overexpression significantly increased nitrogen content in plants, especially in leaves and roots, further confirming its key role in nitrogen absorption and translocation.

[0021] This invention is the first to discover the important function of the PtNPF6.4 gene in significantly improving the performance of poplar trees under low nitrogen stress. It provides a theoretical basis and excellent candidate gene for the selection of high nitrogen utilization rate forest tree varieties and high nitrogen efficiency breeding of forest trees. It has important theoretical and practical significance for the targeted cultivation of artificial timber forests and the precise improvement of forest quality. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This document describes the construction of an overexpression vector for Populus PtNPF6.4 in Example 1 of this invention. Figure A shows the full-length amplification of the PtNPF6.4 gene; Figure B shows the addition of homologous arms to PtNPF6.4; Figure C shows the addition of homologous arms to GFP; Figure D shows the overlap extension PCR of PtNPF6.4 and GFP; Figure E shows the DH5α colony PCR identification of pDONR207-PtNPF6.4-GFP; Figure F shows the DH5α colony PCR identification of pK2GW7-PtNPF6.4-GFP; Figure G shows the GV3101 colony PCR identification of pK2GW7-PtNPF6.4-GFP; In Figures E, F, and G, the red arrows indicate the strains selected and preserved in the next experiment.

[0024] Figure 2 This is the construction of the poplar PtNPF6.4 gene editing expression vector in Example 1 of the present invention. Figure A shows the amplification of the PtNPF6.4 gene gRNA fragment; Figure B shows the PCR identification of the gene editing vector DH5α colony; Figure C shows the PCR identification of the gene editing vector GV3101 colony. In Figures B and C, the red arrows indicate the strains selected and preserved in the next experiment.

[0025] Figure 3The images show the genetic transformation process of poplar trees in Example 2 of this invention. The first row, from left to right, shows the differentiation, bud elongation, and rooting stages of the genetic transformation of poplar trees with the overexpression vector pK2GW7-PtNPF6.4-GFP. The second row, from left to right, shows the co-culture, differentiation, bud elongation, and rooting stages of the genetic transformation of poplar trees with the gene editing vector pKSE401-PtNPF6.4.

[0026] Figure 4 This is for the identification of the DNA level of the overexpression line in Example 2 of the present invention.

[0027] Figure 5 To identify the RNA level of the overexpression strain in Example 2 of this invention, one-way ANOVA and multiple comparisons showed that different letters indicated significant differences between groups.

[0028] Figure 6 This is for the identification of DNA levels in the gene-edited strains in Example 2 of the present invention.

[0029] Figure 7 This shows the gene editing process of the gene-edited strain in Example 2 of the present invention.

[0030] Figure 8 The figures show the phenotypes of poplar trees under different nitrate concentrations in Example 3 of this invention. The scale bar is 5 cm. From left to right, they are: 717 wild type, PtNPF6.4-OE-34, PtNPF6.4-OE-36, PtNPF6.4-OE-37, PtNPF6.4-OE-39, ptnpf6.4-5, ptnpf6.4-30, ptnpf6.4-41, and ptnpf6.4-53.

[0031] Figure 9 This figure shows the development of poplar tree height and leaf number under different nitrate concentrations in Example 3 of the present invention. Figures A and B show the changes in tree height under LN and HN conditions, respectively; Figures C and D show the changes in leaf number under LN and HN conditions, respectively. Data are expressed as mean ± standard error (mean ± SE, n=6). One-way ANOVA and multiple comparisons were performed. Different lowercase letters on the bars in the figures represent differences between different genotypes under the same nitrogen conditions at the same time.

[0032] Figure 10 Figure 3 shows the nitrogen content of poplar trees under different nitrate concentrations in Example 3 of this invention. Figures A, B, C, and D represent the nitrogen content of plant roots, stems, leaves, and total nitrogen content, respectively. Data are expressed as mean ± standard error (mean ± SE, n=6). After one-way ANOVA and multiple comparisons, different lowercase letters on the bars in the figures represent differences between different genotypes under the same nitrogen conditions.

[0033] Figure 11The figures show the photosynthetic indices of poplar trees under different nitrate concentrations in Example 3 of this invention. Figures A, B, C, and D represent net photosynthetic rate, transpiration rate, intercellular CO2 concentration, and stomatal conductance, respectively. Data are expressed as mean ± standard error (mean ± SE, n=6). Multiple comparisons were performed using one-way ANOVA. Different lowercase letters on the bars in the figures indicate differences between different genotypes under the same nitrogen conditions. Detailed Implementation

[0034] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0035] Example 1: Construction of PtNPF6.4 overexpression vector and gene editing vector 1. Construction of PtNPF6.4 overexpression vector The overexpression vector for PtNPF6.4 was constructed using the pK2GW7 expression vector and the Gateway cloning system.

[0036] (1) PCR amplification of the target fragment PtNPF6.4 The PtNPF6.4 gene sequence was extracted from the genome of Populus 717 (as shown in SEQ ID NO:1, and the protein sequence it encodes is shown in SEQ ID NO:2). Specific primers (without stop codons) were designed at appropriate sites, and the primer sequences were submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The amplification primer sequence information for PtNPF6.4 is shown in SEQ ID NO:3-4. PtNPF6.4-F:ATGTTCTCTTCCGGAAACACA (SEQ ID NO:3) PtNPF6.4-R:GTGGAAAGTGGGCTCATCAACTTC (SEQ ID NO:4) The first round of PCR amplification was performed using amplification primers. Using 717 Yang cDNA as a template, the full-length CDS sequence of the PtNPF6.4 gene was amplified using a high-fidelity enzyme PCR system. The high-fidelity enzyme PCR amplification system consisted of: 4 μL 5× Phusion™ HF Buffer, 2 μL 2 mM dNTPs, 0.2 μL Phusion™ High–Fidelity DNA Polymerase, 50-100 ng Template DNA, 0.2 μL Forward Primer, 0.2 μL Reverse Primer, and ddH2O to 20 μL. The high-fidelity enzyme PCR reaction program was: 98℃ for 3 min, 35 cycles of 98℃ for 10 sec, 60℃ for 30 sec, and 72℃ for 60 sec / kb, followed by one cycle at 72℃ for 10 min.

[0037] Weigh 0.6 g of agarose, add 50 mL of electrophoresis buffer and 4 μL of nucleic acid dye to prepare a medium-sized agarose gel. After amplification, perform agarose gel electrophoresis, as shown below. Figure 1 As shown in Figure A, the band size is approximately 2000 bp, indicating successful amplification of PtNPF6.4. The product was purified and recovered using the FastPure Gel DNA Extraction Mini Kit (Novozymes, China). The specific steps are as follows: ① After electrophoresis of the PCR products, cut the gel and place it into a 1.5 mL centrifuge tube. First weigh the centrifuge tube, then weigh the centrifuge tube containing the gel, and calculate the gel weight. Each 100 mg of gel is equivalent to 100 µL of volume.

[0038] ② Add an equal volume of Buffer GDP, and incubate in a 55°C water bath for 10 minutes to completely dissolve the gel. Invert the container 2-3 times during the water bath to mix thoroughly.

[0039] ③ Place the FastPure DNA Mini Columns-G adsorption column into a 2 mL Collection Tube, transfer the sol solution into the adsorption column, and centrifuge at 12000 rpm for 1 min.

[0040] ④ Discard the filtrate, place the adsorption column in the collection tube, add 300 µL of Buffer GDP to the adsorption column, let stand for 1 min, and centrifuge at 12000 rpm for 1 min.

[0041] ⑤ Discard the filtrate, place the adsorption column in the collection tube, and add 700 µL of Buffer GW to the adsorption column. Centrifuge at 12000 rpm for 1 min.

[0042] ⑥ Repeat step 5.

[0043] ⑦ Discard the filtrate, place the adsorption column back into the collection tube, and centrifuge at 12000 rpm for 2 min.

[0044] ⑧ Place the adsorption column in a 1.5 mL sterile centrifuge tube, add 20 µL ddH2O to the center of the adsorption column, let stand for 2 min, and centrifuge at 2000 rpm for 1 min.

[0045] 9. Discard the adsorption column, check the quality of the purified product by electrophoresis, and check the product concentration by microplate.

[0046] (2) PtNPF6.4 with adapter PCR amplification Using the recovered product of PtNPF6.4 as a template, the attB1 site sequence was added to the upstream primer, and a sequence homologous to GFP was added to the downstream primer. The primer sequences were submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The primer sequence information for PtNPF6.4 adapters is shown in SEQ ID NO:5-6 of the sequence listing: OX-PtNPF6.4-F:ggggacaagtttgtacaaaaaagcaggcATGTCTCTTCCGGAAACACA (SEQ IDNO: 5) OX-PtNPF6.4-R:agttcttctcctttactGTGGAAAGTGGGCTCATCAACTTC (SEQ ID NO: 6) A second round of PCR amplification was performed using a high-fidelity enzyme system. The high-fidelity enzyme PCR system and PCR reaction procedure were the same as above. After amplification, agarose gel electrophoresis was performed. Figure 1 As shown in Figure B, the band size is approximately 2000 bp, indicating that the PtNPF6.4 has been successfully ligated. The amplification product will be purified and recovered again.

[0047] (3) GFP adapter PCR amplification Using a plasmid containing the GFP fragment as a template, an overlapping extension PCR sequence homologous to the R-terminus of the PtNPF6.4 gene was designed upstream, and the attB2 site sequence was added downstream. The primer sequences were submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The GFP adapter primer sequence information is shown in SEQ ID NO:7-8 of the sequence listing: PtNPF6.4-GFP-F:gaagttgatgagcccactttccacAGTAAAGGAGAAGAACT (SEQ ID NO:7) GFP-R-B2:ggggacccactttgtacaagaaagctgggttcacacGTGGTGGTGGTGGT (SEQ ID NO:8) PCR amplification was performed using a high-fidelity enzyme system. The PCR amplification system consisted of: 10 μL of 5× Phusion™ HF Buffer, 1 μL of 10 mM dNTPs, 0.3 μL of Phusion™ High–Fidelity DNA Polymerase, 2 μL of Template DNA, 2.5 μL of PtNPF6.4-GFP-F Primer, 2.5 μL of GFP-R-B2 Primer, and ddH2O to 50 μL. The high-fidelity enzyme PCR reaction procedure was the same as above. After amplification, agarose gel electrophoresis was performed, as shown below. Figure 1 As shown in C, the band size is approximately 750 bp, which is correct. It will then be purified and recovered.

[0048] (4) PtNPF6.4 and GFP overlap extension PCR Using a high-fidelity enzyme, PtNPF6.4 was ligated to the GFP fragment via overlap extension PCR (also known as bridging PCR) to obtain the ligation product attB1-PtNPF6.4-GFP-attB2.

[0049] PCR amplification system: 10 μL 5× Phusion™ HF Buffer, 1 μL 10 mM dNTPs, 0.2 μL Phusion™ High–Fidelity DNA Polymerase, 2 μL OX-GFP PCR purified product, 2 μL OX-PtNPF6.4 PCR purified product, 2 μL OX-PtNPF6.4-F Primer, 2 μL GFP-R-B2 Primer, ddH2O to 50 μL. The high-fidelity enzyme PCR reaction procedure is the same as above. After amplification, perform agarose gel electrophoresis, as shown... Figure 1 As shown in D, the band size is approximately 2500 bp, which is correct. It will be purified and recovered.

[0050] (5) Construction of pK2GW7-PtNPF6.4-GFP vector The ligation product of attB1-PtNPF6.4-GFP-attB2 was recombined into the intermediate vector pDONR207 via a BP reaction. The reaction mixture consisted of 1.1 μL of the purified PCR product, 0.5 μL of the pDONR207 intermediate vector, and 0.4 μL of Gateway® BPClonase® II. After the reaction, the cells were transformed into E. coli DH5α. Mix 5 μL of the gene recombination ligation product with 30 μL of DH5α competent bacteria. Ice bath for 15 min, heat shock at 42 ℃ for 90 sec, then immediately place on ice for 5 min; Add 700 μL of LB medium and incubate at 37 ℃ in a shaker for 60 min. Take 200 μL of bacterial culture, mix it with a pipette, and spread it evenly on an LB agar plate containing 50 ug / mL kan resistance. Incubate overnight in an inverted incubator at 37 ℃.

[0051] Then, positive clones of *E. coli* DH5α transformed after the BP reaction were verified by PCR. The PCR reaction system was as follows: Forward Primer 0.15 μL, Reverse Primer 0.15 μL, 2× PCR mix 5 μL, ddH2O to 10 μL. The PCR reaction program was: 94℃ for 5 min, 35 cycles of 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 60 sec / kb, followed by 72℃ for 10 min. After colony PCR amplification, agarose gel electrophoresis was performed. Figure 1 As shown in E., the E. coli that tested positive were shaken briefly, then sent for sequencing. After confirming that the sequencing sequence was correct, the pDONR207-PtNPF6.4-GFP plasmid was extracted.

[0052] The pK2GW7 vector was then recombined into the final expression vector via an LR reaction. The reaction mixture consisted of 0.6 μL of pK2GW7 vector, 1 μL of pDONR207-PtNPF6.4-GFP, and 0.4 μL of Gateway® LR Clonase® II. After the reaction, the vector was transformed into E. coli DH5α.

[0053] Positive clones of *E. coli* DH5α transformed after the LR reaction were then verified by PCR. The PCR reaction system was as follows: Forward Primer 0.15 μL, Reverse Primer 0.15 μL, 2× PCR mix 5 μL, ddH2O to 10 μL. The PCR reaction program was: 94℃ for 5 min, 35 cycles of 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 60 sec / kb, followed by 72℃ for 10 min. After colony PCR amplification, agarose gel electrophoresis was performed. Figure 1 As shown in F. The E. coli that tested positive were shaken briefly, then sent for sequencing. After successful sequencing, the pK2GW7-PtNPF6.4-GFP plasmid was extracted.

[0054] Finally, the successfully sequenced pK2GW7-PtNPF6.4-GFP positive recombinant plasmid was transformed into Agrobacterium GV3101 competent cells, and colony PCR identification of the transformed Agrobacterium was performed using 35SF / OX-PtNPF6.4-R. The reaction system and procedure were the same as above, and the gel electrophoresis results are as follows. Figure 1 G. After successfully sending the PCR product for testing, preserve the strain with the correct band size for future use in subsequent genetic transformation.

[0055] 2. Construction of PtNPF6.4 gene editing vector (1) Design of gRNA for PtNPF6.4 gene editing Based on the conserved sequence of PtNPF6.4, two gRNAs capable of editing the 717 Yang PtNPF6.4 gene were designed using the online websites CRISPR-P v2.0 and AspenDB. GRNA amplification primers were designed based on the gene sequence and submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The PtNPF6.4 gRNA primer amplification sequence information is shown in the sequence listing SEQ ID NO: 9-12: NPF6.4T1-BsF: atatatggtctcgattgACCAGTGCTGCCATGATTCTgtt (SEQ ID NO:9) NPF6.4T1-F0: tgACCAGTGCTGCCATGATTCTgttttagagctagaaatagc (SEQ ID NO: 10) NPF6.4T2-R0: aacTGTGCTCATCGTCTTCATCCcaatctcttagtcgactctac (SEQ ID NO: 11) NPF6.4T2-BsR:attattggtctcgaaacTGTGCTCATCGTCTTCATCCcaa (SEQ ID NO:12) (2) PCR amplification of gRNA The PtNPF6.4 fragment containing gRNA was amplified by PCR. The PCR reaction system was as follows: pCBC-DT1T2 1 μL, 2×Canace buffer 25 μL, Coocden High–Fidelity DNA Polymerase 0.5 μL, NPF6.4T1-BsF 2 μL, NPF6.4T1-F0 0.1 μL, NPF6.4T2-R0 0.1 μL, NPF6.4T2-BsR 2 μL, ddH2O to 50 μL. The PCR reaction program was: 94℃ for 5 min, 35 cycles of 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 60 sec / kb, and 1 cycle of 72℃ for 10 min. After amplification, agarose gel electrophoresis was performed. Figure 2 As shown in Figure A, the band size is approximately 750 bp, which is correct. It will then be purified and recovered.

[0056] (3) Construction of pKSE401-PtNPF6.4 vector Transfected into the pKSE401 expression vector via Goldgate reaction. The PCR reaction mixture was as follows: 0.5 μL 10× T4 DNA Ligase buffer, 0.5 μL 10× buffer, 0.2 μL BSAI, 0.2 μL T4 DNA Ligase, 2 μL PCR product, and ddH2O to 5 μL. After the reaction, transformed into DH5α and colony PCR identification was performed. The reaction mixture was as follows: 0.3 μL Forward Primer, 0.3 μL Reverse Primer, 10 μL 2× PCR mix, and ddH2O to 20 μL. The electrophoresis results are shown below. Figure 2 As shown in B, positive colonies were selected for sequencing. The primers for gene editing detection are as follows: U6-26p-F: TGTCCCAGGATTAGAATGATTAGGC U6-29p-R: AGCCCTCTTTCTTTCGATCCATCAAC After sequencing and sequence alignment confirmed accuracy, the gene editing vector was constructed. Plasmid was extracted and transformed into Agrobacterium competent cells GV3101, followed by PCR verification. Figure 2C), use the same primers as above, and preserve the strain for later use if the band size is correct.

[0057] Example 2: Acquisition and positive identification of transgenic poplar material To further determine the function of the poplar PtNPF6.4 gene, the constructed PtNPF6.4 overexpression vector (pK2GW7-PtNPF6.4-GFP) and gene editing vector (pKSE401-PtNPF6.4) were genetically transformed into Populus 717 using Agrobacterium infection. Infection was performed through two different explant sites, and the process went through four stages: co-culture, differentiation and shoot formation, shoot elongation, and rooting. Through resistance screening, 10 OE-PtNPF6.4 overexpression lines and 12 ptnpf6.4 mutant transgenic lines were obtained. Figure 3 ).

[0058] Positive identification and expression level analysis of PtNPF6.4 overexpression lines were performed at both DNA and RNA levels. For DNA-level identification, amplification was performed using a primer pair consisting of the universal vector primer 35S-F and the specific primer PtNPF6.4-R. Simultaneously, Actin-F and Actin-R primer pairs were used to detect DNA quality. Results showed that, except for the wild-type WT, both the pK2GW7-PtNPF6.4 plasmid and the PtNPF6.4 overexpression lines amplified bands of approximately 1700 bp, indicating that the exogenous PtNPF6.4 gene had been successfully integrated into the plant genome. Figure 4 The positive identification primers are as follows: 35S-F:ACGCACAATCCCACTATCCTTC PtNPF6.4-R:GTGGAAAGTGGGCTCATCAACTTC (SEQ ID NO:4) Actin-F: CCATTGAGCACGGTATTGT Actin-R:TACGACCACTGGCATACAGG To further verify the stability of the transgenic materials, RNA-level validation was performed. RT-qPCR results showed that the four overexpression lines OE-PtNPF6.4-34, OE-PtNPF6.4-36, OE-PtNPF6.4-37, and OE-PtNPF6.4-39 had the highest expression levels, upregulated by 12.59, 46.58, 24.78, and 31.12 times, respectively, compared to the wild type. Figure 5These results indicate that all transgenic lines were stable positive lines and could be used for subsequent phenotypic verification experiments. Four lines with high expression levels of OE-PtNPF6.4-34, OE-PtNPF6.4-36, OE-PtNPF6.4-37, and OE-PtNPF6.4-39 were selected for subsequent experiments. Figure 5 ).

[0059] Positive identification of the PtNPF6.4 gene-edited lines was performed at the DNA level. Primers U6-26p-F and U6-29p-R were used for DNA level identification of the gene-edited plants, while primers Actin-F and Actin-R were used for DNA quality testing. Results showed that, except for the wild-type WT, both the pKSE401-PtNPF6.4 plasmid and the gene-edited lines could amplify bands of approximately 1000 bp. Figure 6 ).

[0060] Meanwhile, the editing status of the ptnpf6.4 mutant line was detected by Hi-TOM next-generation sequencing and compared with the reference sequences of two haplotypes of 717 Yang. The comparison results showed that the ptnpf6.4 line exhibited varying degrees of deletion and insertion editing. For example, the amino acid count of PtNPF6.4 was 584 aa. In the ptnpf6.4-5 line, one haplotype had a 6 bp deletion in the first gRNA region and a 1 bp insertion in the second gRNA region, leading to premature termination of translation and a reduction in the corresponding amino acid count to 527 aa. Figure 7 ).

[0061] Example 3: Effects of PtNPF6.4 on growth, development, nitrogen content, and photosynthesis of poplar under nitrogen stress. 1. Effects of PtNPF6.4 on the growth and development of poplar under nitrogen stress Three-week-old, robust, and pollution-free wild-type Populus 717, PtNPF6.4 overexpression lines, and ptnpf6.4 mutant lines were selected for tissue culture and cultured in sand in a plant growth chamber. Ca(NO3)2 was used as the sole nitrogen source, and nitrate concentrations of 0.8 mM and 8 mM were set to treat the plant materials with low nitrogen (LN) and high nitrogen (HN), respectively.

[0062] Phenotypic observations were conducted after 60 days of treatment with different nitrate concentrations. The results showed that plants under LN conditions exhibited yellow-green leaves, demonstrating a clear nitrogen deficiency phenotype, while plants under HN conditions were greener. Figure 8 Under LN conditions, the growth and development of OE-PtNPF6.4 overexpression lines were significantly better than those of wild-type and mutant lines, with the ptnpf6.4 mutant lines showing the worst growth and development. Figure 8Under HN conditions, the growth and development of the OE-PtNPF6.4 overexpression lines were slightly better than those of the wild type and the ptnpf6.4 mutant, but there was no significant difference between the wild type and the ptnpf6.4 mutant. Figure 8 Specifically, under LN conditions, plant height and leaf number were significantly lower than those under HN conditions. Under LN conditions, the number of leaves and plant height of the OE-PtNPF6.4 overexpression lines were significantly higher than those of the wild type and mutants, while the plant height of the ptnpf6.4 mutant lines was significantly lower than that of the WT and OE-PtNPF6.4 transgenic lines. Although the number of leaves was also significantly lower than that of the OE-PtNPF6.4 transgenic lines, it was not significantly different from that of the WT lines. Under HN conditions, the number of leaves and plant height of the OE-PtNPF6.4 overexpression lines were slightly higher than those of the wild type and the ptnpf6.4 mutant, but there was no significant difference in leaf number and plant height between the wild type and the ptnpf6.4 mutant. Figure 9 ).

[0063] Overall, these results indicate that PtNPF6.4 can promote the growth and development of poplar under low nitrogen stress.

[0064] 2. Effects of PtNPF6.4 on nitrogen content in poplar under nitrogen stress The nitrogen content of plants was determined by the Kjeldahl method to investigate whether PtNPF6.4 is involved in plant nitrogen uptake and translocation. Results showed that the nitrogen content in poplar under LN conditions was significantly lower than under HN conditions, and there were significant differences in nitrogen content among different plant parts, with the highest nitrogen content in leaves and the lowest in stems. Under LN conditions, the nitrogen content of PtNPF6.4 overexpression lines was significantly higher than that of the wild type, especially in leaves and roots, approximately 2-4 times higher, while the nitrogen content of ptnpf6.4 mutant lines was significantly lower than that of the wild type and overexpression lines. Under HN conditions, the nitrogen content of PtNPF6.4 overexpression lines was also significantly higher than that of the wild type. The nitrogen content in the roots and leaves of the ptnpf6.4 mutant was not significantly different from that of the wild type, but the nitrogen content in the stems was much lower than that of the wild type and overexpression lines. Figure 10 ).

[0065] Overall, regardless of LN or HN conditions, the total nitrogen content of PtNPF6.4 overexpression lines was significantly higher than that of wild-type and mutant lines, while the total nitrogen content of the ptnpf6.4 mutant lines was also the lowest. This indicates that PtNPF6.4 can promote nitrogen absorption and translocation in plants, thereby increasing the nitrogen content within the plant.

[0066] 3. Effects of PtNPF6.4 on photosynthesis in poplar under nitrogen stress To investigate whether PtNPF6.4 participates in photosynthesis, photosynthetic indices of transgenic and wild-type materials were measured after treatment with different nitrate concentrations. Specifically, the net photosynthetic rate of each plant line was measured starting 60 days after nitrate treatment, from 8:30 AM to 11:30 AM. Leaves with an LPI of 6-8 were selected for measurement. Gas exchange parameters were measured using a LI-6800 photosynthesis meter. Parameter settings during measurement: air velocity 500 μmol·s⁻¹. -1 Water vapor content 60%, CO2 flow rate 400 μmol·s -1 The leaf chamber temperature was 23℃, the red-to-blue light ratio was 9:1, and the light intensity was 1000 μmol·m⁻¹. 2 ·s -1 .

[0067] The results showed that LN stress significantly inhibited plant photosynthesis, and significantly reduced the net photosynthetic rate, intercellular carbon dioxide concentration, transpiration rate, and stomatal conductance. Figure 10 Under LN conditions, the net photosynthetic rate of PtNPF6.4 overexpression lines was higher than that of wild type, while the net photosynthetic rate of ptnpf6.4 mutants was significantly lower than that of wild type. Figure 10 No significant differences were observed in photosynthetic indices under HN conditions. Figure 10 The above results demonstrate that PtNPF6.4 promotes net photosynthetic rate, stomatal conductance, intercellular carbon dioxide concentration, and transpiration rate in plants. Especially under low nitrogen conditions, PtNPF6.4 can significantly alleviate the inhibition of photosynthesis by nitrogen stress and promote plant growth.

[0068] In summary, this study found that the poplar PtNPF6.4 gene plays an important role in enhancing the resistance of poplar to low nitrogen stress. Overexpression of this gene in poplar can significantly resist the effects of low nitrogen stress. Overexpression lines showed significantly improved photosynthesis, as well as excellent growth and development and nitrogen absorption capacity. This provides a theoretical basis and new target for high-efficiency nitrogen breeding of forest trees, and can significantly improve timber yield and quality, with broad application prospects.

[0069] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. Application of the PtNPF6.4 gene in any of the following A1)-A4): A1) Enhance the resistance of poplar to low nitrogen stress; A2) Prepare products that enhance the resistance of poplar to low nitrogen stress; A3) Cultivate poplar germplasm resistant to low nitrogen stress; A4) Prepare and cultivate poplar germplasm products resistant to low nitrogen stress; The amino acid sequence encoded by the PtNPF6.4 gene is shown in SEQ ID NO:

2.

2. Use according to claim 1, characterized in that, The nucleotide sequence of the PtNPF6.4 gene is shown in SEQ ID NO:

1.

3. Use according to claim 1, characterized in that, By promoting the expression of the PtNPF6.4 gene or enhancing the function or activity of its protein, the resistance of poplar to low nitrogen stress can be enhanced.

4. Use according to claim 1, characterized in that, The PtNPF6.4 gene enhances the photosynthesis of poplar trees by promoting nitrogen absorption, thereby promoting their growth and development and improving their resistance to low nitrogen stress.

5. Application of the overexpression vector containing the PtNPF6.4 gene in any of the following A1)-A4): A1) Enhance the resistance of poplar to low nitrogen stress; A2) Prepare products that enhance the resistance of poplar to low nitrogen stress; A3) Cultivate poplar germplasm resistant to low nitrogen stress; A4) Prepare and cultivate poplar germplasm products resistant to low nitrogen stress; The amino acid sequence encoded by the PtNPF6.4 gene is shown in SEQ ID NO:

2.

6. Use according to claim 5, characterized in that, The backbone vector of the overexpression vector is the expression vector pK2GW7.

7. The application according to claim 6, characterized in that, Methods for constructing overexpression vectors containing the PtNPF6.4 gene include: S1. Poplar cDNA was amplified using primers as shown in SEQ ID NO:3-4 to obtain the PtNPF6.4 gene fragment as shown in SEQ ID NO:1; S2. Using the PtNPF6.4 gene fragment obtained in step S1 as a template, amplification is performed using primers as shown in SEQ ID NO:5-6, so that the attB1 site sequence is added upstream of the PtNPF6.4 gene fragment and the sequence homologous to GFP is added downstream. S3. Using a plasmid containing the GFP fragment as a template, amplification is performed using primers as shown in SEQ ID NO:7-8, adding an overlapping extension PCR sequence homologous to the R end of the PtNPF6.4 gene upstream and an attB2 site sequence downstream. S4. Using a high-fidelity enzyme, the PtNPF6.4 obtained in step S2 and the GFP fragment obtained in step S3 were ligated by overlap extension PCR to obtain the ligation product attB1-PtNPF6.4-GFP-attB2. S5. The ligation product of attB1-PtNPF6.4-GFP-attB2 was recombined into the intermediate vector pDONR207 via the BP reaction, and then recombined into the pK2GW7 expression vector via the LR reaction to obtain the overexpression vector pK2GW7-PtNPF6.4-GFP containing the PtNPF6.4 gene.

8. A method for enhancing the resistance of poplar to low nitrogen stress or cultivating poplar germplasm tolerant to low nitrogen stress, characterized in that, By promoting the expression of the PtNPF6.4 gene in poplar or enhancing the function or activity of its protein, the low nitrogen stress resistance of poplar can be enhanced; wherein the amino acid sequence encoded by the PtNPF6.4 gene is shown in SEQ ID NO:

2.

9. The method according to claim 8, characterized in that, Using the expression vector pK2GW7 as the backbone vector, an overexpression vector containing the PtNPF6.4 gene was constructed to increase the expression level of the PtNPF6.4 gene, and then transformed into poplar trees to obtain PtNPF6.4 gene overexpression lines.

10. The method according to claim 9, characterized in that, An overexpression vector containing the PtNPF6.4 gene was transferred into Agrobacterium GV3101 competent cells and genetically transformed into poplar trees via Agrobacterium infection.