Application of TMEM106A as target spot in preparation of diagnostic kit and targeted therapeutic drug

Abstract

The invention discloses an application of TMEM106A as a target spot in preparation of a diagnostic kit and a targeted therapeutic drug. Relates to the technical field of immunodiagnosis. Specific applications are provided. The invention discloses a key effect of TMEM106A in podocyte injury related to preeclampsia. TMEM106A is significantly down-regulated in urine of a PE patient, is closely related to podocyte injury and inflammatory response, and can be used as an early noninvasive diagnostic marker; meanwhile, the targeted podocyte up-regulation TMEM106A has remarkable anti-inflammatory and kidney protection effects, and a theoretical basis and practical feasibility are provided for targeted therapy of PE-related podocyte injury. The invention provides a new way for early precise diagnosis and intervention strategy of PE, and has wide clinical application prospect.

Description

Technical Field

[0001] This invention relates to the field of immunodiagnostic technology, and more specifically to the application of TMEM106A as a target in the preparation of diagnostic kits and targeted therapeutic drugs. Background Technology

[0002] Preeclampsia (PE) is a multisystemic pregnancy disorder affecting approximately 3% to 8% of pregnant women worldwide, and is a leading cause of maternal and fetal morbidity and mortality. The pathogenesis of PE is complex, involving multiple factors such as placental ischemia, endothelial cell damage, and immune response disorders. Clinically, it manifests as new-onset hypertension after 20 weeks of gestation, accompanied by proteinuria or other end-organ dysfunction.

[0003] Kidney injury is one of the most common target organ manifestations of preeclampsia (PE), primarily characterized by decreased glomerular filtration function and increased proteinuria. Studies have shown that glomerular podocytes play a crucial role in maintaining the integrity of the filtration barrier, and their dysfunction and structural damage are important mechanisms underlying PE-related proteinuria. However, the specific mechanisms of podocyte injury in preeclampsia remain unclear.

[0004] Therefore, identifying proteins related to podocyte injury in preeclampsia and using them as targets for diagnosing and treating podocyte injury in preeclampsia patients is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides the application of TMEM106A as a target in the preparation of diagnostic kits and targeted therapeutic drugs. The present invention found that TMEM106A expression is significantly downregulated in the urine of patients with preeclampsia, and its expression level is positively correlated with podocyte marker proteins nephrin and PCX, and negatively correlated with inflammatory factors IL-1β and TNF-α. Further, it was found that knocking down podocyte TMEM106A expression can induce podocyte cytoskeleton rearrangement and the release of inflammatory factors, thereby inducing podocyte damage. Therefore, the present invention proposes for the first time that TMEM106A be used as a novel target for the diagnosis and treatment of preeclampsia-related podocyte damage, providing a theoretical basis and technical solution for early clinical identification and intervention of PE podocyte damage, and for the preparation of drugs that alleviate preeclampsia-related podocyte damage and inflammation by using it as an intervention target.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: Application of TMEM106A as a target in the preparation of diagnostic kits and targeted therapeutic drugs.

[0007] In one or more embodiments: the primers for amplifying TMEM106A are: TMEM106A-F: 5'-GACCTGTTCATACCTGAGCCA-3', as shown in SEQ ID NO.1; TMEM106A-R: 5'-GATGCGTTTCCTCGGCAGTC-3', as shown in SEQ ID NO.2.

[0008] This invention also provides the application of substances that knock down TMEM106A expression in the preparation of podocyte injury models.

[0009] In one or more embodiments: the substance is TMEM106A siRNA: 5'-GCAGUUGGUGGCUCUCAUUTT-3', the sequence of which is shown in SEQ ID NO.15.

[0010] This invention also provides a diagnostic kit for eclampsia-related podocyte injury, comprising primers for amplifying TMEM106A: TMEM106A-F: 5'-GACCTGTTCATACCTGAGCCA-3',SEQ ID NO.1; TMEM106A-R: 5'-GATGCGTTTCCTCGGCAGTC-3', SEQ ID NO.2.

[0011] This invention also provides the application of substances overexpressing TMEM106A in the preparation of drugs for treating preeclampsia-related podocyte injury.

[0012] In one or more implementations: the use of AAV9 adeno-associated virus is included.

[0013] As can be seen from the above technical solution, compared with the prior art, this invention discloses the application of TMEM106A as a target in the preparation of diagnostic kits and targeted therapeutic drugs, and the achieved technical effect is to reveal the key role of TMEM106A in preeclampsia-related podocyte injury. TMEM106A is significantly downregulated in the urine of PE patients and is closely related to podocyte injury and inflammatory response, and can serve as an early non-invasive diagnostic biomarker. Simultaneously, targeting podocytes to upregulate TMEM106A has significant anti-inflammatory and renal protective effects, providing a theoretical basis and practical feasibility for targeted therapy of PE-related podocyte injury. This invention provides a new approach for early and precise diagnosis and intervention strategies for PE, and has broad clinical application prospects. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Figure 1 The attached figures show the detection results and analysis graphs provided by this invention. Figure A shows the real-time quantitative PCR results of TMEM106A mRNA expression in the urine of PE patients and healthy pregnant controls, n = 20; Figure B shows the ELISA results of nephrin and podocalyxin (PCX) protein concentrations in the urine of PE patients and controls, n = 20; Figure C shows the qPCR results of IL-1β and TNF-α mRNA expression and IL-6 protein concentration (ELISA) in urine, n = 20; Figure D shows the Pearson correlation analysis graph between TMEM106A and nephrin, PCX, IL-1β, and TNF-α. P <0.05、** P <0.01、*** P <0.001.

[0016] Figure 2 The attached figures are Western blot and fluorescence microscopy images provided by this invention. Figure A shows the Western blot results of CD63 and calnexin protein expression in plasma exosomes (EVs); Figure B shows the Western blot results of TMEM106A protein expression levels in EVs from preeclampsia patients and control groups; Figure C shows the fluorescence microscopy observation of PKH26-labeled PE-EV distribution in podocytes; Figure D shows the Western blot results of TMEM106A protein expression after EV treatment of podocytes; Figure E shows the Western blot results of IL-1β, IL-6, and TNF-α protein expression levels after EV treatment of podocytes. P <0.05、** P <0.01、*** P <0.001.

[0017] Figure 3The attached figures show the results of various PCR detections, Western blot detections and quantitative analyses, mRNA expression levels, immunofluorescence staining, and ELISA detections provided by this invention. Specifically, Figure A shows the results of quantitative PCR detection of TMEM106Am mRNA expression levels in human podocytes transfected with siRNA; Figure B shows the Western blot detection and quantitative analysis of TMEM106A protein expression levels; Figure C shows the quantitative PCR detection of synaptopodin and ZO-1 mRNA expression levels; Figure D shows the detection of mRNA expression levels of IL-1β, IL-6, and TNF-α; Figure E shows the Western blot detection and quantitative analysis of ZO-1, synaptopodin, and podocin protein expression levels; and Figure F shows the Western blot detection of IL-1β, IL-6, and TNF-α protein expression levels. Blot analysis and quantitative analysis; in the attached figure, G is the immunofluorescence staining image of F-actin in the podocyte cytoskeleton (green), and the nuclear staining image of DAPI (blue), with the combined image showing cell morphology; in the attached figure, H is the ELISA result of IL-6 protein concentration in the podocyte supernatant. P <0.05、** P <0.01、*** P <0.001.

[0018] Figure 4 The attached figures illustrate the experimental procedures, immunofluorescence, measurement curves, quantitative detection, fetal and placental images, HE staining, and Western blot diagrams provided by this invention. Specifically, Figure A shows a schematic diagram of the experimental procedure for the L-NAME-induced preeclampsia mouse model and AAV9-TMEM106A overexpression intervention; Figure B shows an immunofluorescence double staining image of TMEM106A and the podocyte marker protein synaptopodin in kidney tissue, with DAPI staining of the nucleus; Figure C shows the measurement curves of systolic blood pressure (SBP) at various time points during pregnancy for different treatment groups (n = 6); Figure D shows the quantitative detection diagram of protein concentration in 24-hour urine (n = 6); Figure E shows images of the fetus and placenta, and a statistical analysis diagram of fetal and placental wet weight (n = 6); Figure F shows an HE-stained image of kidney tissue, used to observe the glomerular structure and morphology of each group; Figure G shows an immunofluorescence staining image of synaptopodin and ZO-1 in kidney tissue, used to assess the expression distribution of podocyte structural proteins; Figure H shows a Western blot diagram. Blot images showing the expression levels of TNF-α and IL-1β proteins in kidney tissue; in the attached figure, I is an F4 / 80 immunofluorescence staining image used to observe macrophage infiltration in kidney tissue, scale bar is 50 μm. P <0.05、** P<0.01、*** P <0.001. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] This invention discloses the application of TMEM106A as a target in the preparation of diagnostic kits and targeted therapeutic drugs. Example 1

[0021] Expression of TMEM106A in the urine of patients with preeclampsia and its correlation with podocyte injury and inflammatory markers Design the primer sequences for the target gene and internal reference gene: The target gene reference is TMEM106A (NCBI Reference Sequence is NM_145041.4). F 5'-GACCTGTTCATACCTGAGCCA-3',SEQ ID NO.1; R 5'-GATGCGTTTCCTCGGCAGTC-3', SEQ ID NO.2; β-Actin F 5'-CATGTACGTTGCTATCCAGGC-3', SEQ ID NO.3; R 5'-CTCCTTAATGTCACGCACGAT-3', SEQ ID NO.4; IL-1β F 5'- CAACAAGTGGTGTTCTCCATGTC- 3', SEQ ID NO.5; R 5'-ACACGCAGGACAGGTACAGA- 3', SEQ ID NO. 6; TNF-α F 5'- GAGGCCAAGCCCTGGTATG- 3', SEQ ID NO.7; R 5'-CGGGCCGATTGATCTCAGC-3', SEQ ID NO. 8.

[0022] Sample collection and processing In this study, urine samples were collected from 20 patients undergoing delivery at the Department of Obstetrics, Second Affiliated Hospital of Shandong University, and 20 gestationally matched healthy pregnant women. The urine supernatant was collected after centrifugation at 2000 rpm for 15 minutes at 4°C and stored at -80°C for later use. Informed consent was obtained from all patients or their guardians before sample collection, and the relevant research content was approved by the Ethics Committee of the Second Affiliated Hospital of Shandong University.

[0023] Total RNA was extracted from the supernatant using an adsorption column. The expression levels of TMEM106A, IL-1β, and TNF-α mRNA were detected by real-time quantitative PCR using the SYBR Green method. Meanwhile, the protein concentrations of nephrin, podocalyxin (PCX), and IL-6 in urine were detected by enzyme-linked immunosorbent assay (ELISA).

[0024] The specific steps are as follows: real-time PCR (1) RNA extraction Total RNA was extracted from urine using the BIOG RNA Urine Kit (Bio-Gene Biotechnology, China). The steps are as follows: ① Take 5 mL of urine and place it in a 10 mL RNase-free centrifuge tube. Centrifuge at 5000 rpm for 5 minutes and carefully discard the supernatant. Add 0.1 mL of physiological saline, vortex to mix, and transfer this suspension to a 1.5 mL centrifuge tube.

[0025] ② Add 200 μL of lysis buffer, 3 μL of RNA conc., and 20 μL of digestion solution, vortex to mix, and incubate at 56°C for 10 minutes. ③ Add 500 μL of precipitate and gently invert to mix.

[0026] ④ Place the adsorption column into the collection tube, transfer the above solution into the adsorption column, centrifuge at 12,000 rpm at 4℃ for 1 min, and discard the waste liquid in the collection tube.

[0027] ⑤ Place the adsorption column back into the collection tube, add 500 μL of washing solution into the adsorption column, let stand for 2 min, centrifuge at 12,000 rpm at 4℃ for 1 min, and discard the waste liquid in the collection tube.

[0028] ⑥ Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm at 4℃ for 2 min, and remove the residual washing solution. During this time, take 40 μL of the eluent for each sample and place it in a sterile 1.5 mL RNase-free centrifuge tube, preheat at 56℃ for 2 min.

[0029] ⑦ Remove the adsorption column and place it into a new 1.5 mL RNase-free centrifuge tube. Add 40 μL of preheated elution buffer, let stand for 2 min, centrifuge at 12,000 rpm at 4℃ for 2 min, and collect the RNA solution. This RNA can be used directly for the next experiment or stored at -80℃.

[0030] (2) Reverse transcription The purity of the extracted RNA was determined using a NanoDrop-2000 spectrophotometer. 1 μg of total RNA was reverse transcribed into cDNA using the Evo M-MLV reverse transcription kit (Aikerui Biotechnology, China) according to the manufacturer's instructions. The cDNA samples can be used directly for real-time PCR detection or stored at -20°C.

[0031] The reverse transcription reaction system is shown in Table 1; Table 1

[0032] (3) Real-time PCR analysis Boshan Biotechnology is responsible for synthesizing the primers used in Real-time PCR. Before use, the primer lyophilized powder needs to be centrifuged at 4℃ and 12000rpm for 2min, and then an appropriate amount of DEPC water should be added to completely dissolve the lyophilized powder to a final concentration of 10μM.

[0033] The PCR reaction system was prepared on ice according to the manufacturer's instructions using the SYBR Green Pro Taq HS premixed qPCR kit (Aikerui Biotechnology, China). The reaction mixture was added to 96-well plates and sealed. The plates were centrifuged at 3000 rpm for 2 min at room temperature. The quantitative expression level of the target gene was detected by qPCR using a Roche 480 PCR instrument. Gene expression levels were normalized to β-actin and analyzed using the 2−ΔΔCt method.

[0034] The qPCR reaction system is shown in Table 2; Table 2

[0035] ELISA (1) According to the instructions of the human IL-6 (Jianglai Biotechnology, JL14113), nephrin (Jianglai Biotechnology, JL15363), and podocalyxin ELISA (Jianglai Biotechnology, JL20100) assay kits, the previously collected human urine was centrifuged at 2000 rpm and 4℃ for 15 min, and the supernatant was collected for later use.

[0036] (2) Reagent preparation: After removing the kit and allowing it to warm, dilute the concentrated wash buffer with double-distilled water at a ratio of 1:24. Dilute the lyophilized standard with 1 mL of standard diluent to obtain a 1000 pg / mL standard working solution. Dilute the 100× concentrated biotinylated antibody with biotinylated antibody diluent to a 1× working concentration. Dilute the 100× concentrated HRP enzyme conjugate with enzyme conjugate diluent to a 1× working concentration.

[0037] (3) Add 100 μL of standard working solution or sample to the corresponding well plate and incubate at 37°C for 90 min.

[0038] (4) After discarding the liquid in the well, wash three times with washing buffer for 30 seconds each time. Add 100 μL of biotinylated detection antibody working solution and incubate at 37°C for 60 min.

[0039] (5) After discarding the liquid in the well, wash three times with washing solution for 30 seconds each time. Add 100 μL of HRP coupling working solution and incubate at 37°C for 30 min.

[0040] (6) After discarding the liquid in the well, wash three times with washing solution for 30 seconds each time. Add 100 μL of substrate reagent and incubate at 37°C in the dark for 15 min.

[0041] (7) Add 50 μL of stop solution and read the data at 450 nm wavelength using an enzyme-linked immunosorbent assay (ELISA) reader within 5 minutes.

[0042] The results showed that, compared with the healthy pregnancy control group, the urinary TMEM106A mRNA level was significantly lower in patients with preeclampsia. P < 0.001); the concentrations of podocyte proteins nephrin and PCX in urine were significantly increased ( P < 0.001); meanwhile, the levels of IL-1β and TNF-α mRNA in urine were significantly elevated ( P < 0.001), IL-6 protein levels increased ( P < 0.01), Pearson correlation analysis revealed that TMEM106A expression was positively correlated with nephrin and PCX, and negatively correlated with IL-1β and TNF-α. Figure 1 ).

[0043] Example 2 The role of TMEM106A in podocyte injury Primer sequences for target gene and internal reference gene: The TMEM106A, β-Actin, IL-1β, and TNF-α primers are the same as those shown in Example 1; in addition, the following are provided: IL-6 F 5'- CAATGAGGAGACTTGGCCTGGT-3',SEQ ID NO. R 5'- GCAGGAACTGGATCAGGACT-3',SEQ ID NO. Synaptopodin F 5′-CGCTCACCACACCAACTTCT-3′, SEQ ID NO.11; R 5′- TGCTAGAAAGTGGCAGGCTC-3′, SEQ ID NO.12; ZO-1 F 5'- CCCCCAACTCAAACCGAAGA -3',SEQ ID NO. R 5'- AGATGCTACTTCTGGAGGCTTA -3',SEQ ID NO.

[0044] Western blot analysis: CD63 (Abcam, ab134045), calnexin (Proteintech, 10427-2-AP),TMEM106A(NOVUS,NBP2-41165),Synaptopodin(Protein ch,21064-1-AP),ZO-1(Proteintech,21773-1-Ap),Podocin(absin,abs 126305),IL-1β(Immunoway,yt5201),IL-6(Proteintech,66146-1-Ig) TNF-α(ProteinTech,60291-1-Ig),β-actin(ProteinTech,66009-1-Ig).

[0045] To investigate the role of TMEM106A in podocyte injury, exosomes (EVs) were isolated and extracted from plasma samples of PE patients and healthy controls, and their purity was verified and their function analyzed. EVs were extracted using ultracentrifugation combined with membrane filtration. Western blot was used to detect the EV marker CD63 and the endoplasmic reticulum contamination marker calnexin in EVs to confirm EV purity. Western blot was further used to detect the protein expression level of TMEM106A in PE-EVs and control EVs. PE-EVs were labeled with PKH26 and co-incubated with human podocytes (conditionally immortalized human podocytes (HPCs) were kindly provided by Dr. Peter Mundel of Albert Einstein College of Medicine, Bronx, New York; the establishment and identification of the relevant cell lines can be found in the literature (Saleem et al., 2002, DOI: 10.1681 / ASN.V133630)) for 24–48 hours to observe their uptake capacity. In functional experiments, after podocytes took up PE-EVs, Western blot was used to detect changes in endogenous TMEM106A protein levels and the expression levels of IL-1β, IL-6 and TNF-α in the cells.

[0046] Furthermore, an siRNA interference experiment was designed: a TMEM106A knockdown vector was constructed, and after transfection into podocytes, the knockdown efficiency of TMEM106A was detected by real-time PCR and Western Blot.

[0047] The specific steps for constructing the TMEM106A knockdown vector are as follows: 1. Design: TMEM106A small interference sequence: TMEM106A siRNA: 5'-GCAGUUGGGGCUCUCAUUUU-3', SEQ ID NO.15; NC siRNA: 5'-UUCUCCGAACGUGUCACGUUU-3', SEQ ID NO. 16.

[0048] 2. Single-stranded synthesis: Nucleotides are added stepwise via chemical reactions on a solid support (synthesized from the 3'→5' direction) to obtain a single-stranded RNA product. 3. Deprotection and cleavage: After synthesis, the protecting group is removed, and the single-stranded RNA is cleaved from the solid-phase carrier to release it.

[0049] 4. Purification: Remove truncated products by HPLC or electrophoresis.

[0050] 5. Annealing: Mix the sense and antisense strands in equal molar ratios, heat to 95°C, and then slowly cool to form double-stranded siRNA.

[0051] 6. Freeze-dry: Prepare as powder.

[0052] After transfecting podocytes with TMEM106A small interference, the mRNA expression of Podocin, synaptopodin, ZO-1, IL-1β, IL-6 and TNF-α was detected by real-time PCR; the expression changes of the above proteins were detected by Western blot; at the same time, the changes of the podocyte cytoskeleton were observed by fluorescent staining, and the concentration of IL-6 protein in the culture supernatant was further detected by ELISA.

[0053] The specific operation steps involved in the above embodiments are as follows: Plasma exosome extraction: Collect 5 mL of peripheral blood using a vacuum blood collection tube (Vacutainer, BD, USA) containing an anticoagulant (sodium citrate). Immediately invert the tube 5-8 times to mix and prevent clotting.

[0054] Centrifuge at 3000×g for 10 minutes (4°C) in a 15 mL sterile polypropylene centrifuge tube and collect the supernatant plasma for later use.

[0055] Transfer the clarified plasma to a 50 mL sterile polypropylene centrifuge tube (Corning, USA), incubate at 2000×g for 10 minutes (4°C) to remove cell debris.

[0056] The supernatant was centrifuged again at 10,000×g for 30 minutes (4°C) to further remove large particles.

[0057] The final supernatant was collected and slowly filtered using a 0.22 μm PES low protein adsorption membrane filter (Millipore, SLGP033RB) to remove non-vesicular particles.

[0058] The filtered supernatant was aliquoted into 38.5 mL ultracentrifuge tubes (Beckman, #355630) and centrifuged at 120,000×g for 120 minutes (4°C) using a HITACHI Himac CP100WX with an SW41Ti rotor. Carefully discard the supernatant, resuspend the precipitate in 1 mL of sterile PBS (Gibco, 10010023), and gently pipette to mix. Transfer the suspension back to the same type of centrifuge tube and centrifuge again at 120,000×g for 120 minutes (4°C) to wash and concentrate the exosomes; After discarding the supernatant, the final precipitate was resuspended in 50 μL of sterile PBS to obtain purified EVs.

[0059] Plasma exosome markers (PKH26-labeled PE-EVs): Take an exosome sample (50 μL), resuspend it thoroughly in an equal volume of sterile PBS, and gently pipette to mix.

[0060] Preparation of PKH26 dye working solution (Beyotime, C2071S): Add 10 μL of PKH26 dye stock solution to 1 mL of Diluent C diluent, mix well, store away from light, and use immediately after preparation.

[0061] Take 50 μL of exosome suspension, add an equal volume of 50 μL of freshly prepared PKH26 dye working solution, mix gently, and react at room temperature in the dark for 5 minutes.

[0062] After the reaction is complete, immediately add 200 μL of 1% BSA solution, mix thoroughly, and let stand at room temperature for 1 minute to terminate the staining.

[0063] Transfer the staining reaction solution to a 100 kDa ultrafiltration tube, add 1 mL of PBS, centrifuge at 10,000×g for 10 minutes, discard the filtrate, and repeat the washing with PBS 3-5 times to completely remove the free dye.

[0064] After washing, the PKH26-labeled exosomes in the ultrafiltration tube were recovered with 50 μL PBS, and gently mixed by pipetting to obtain purified PKH26-labeled exosomes.

[0065] Cell transfection: Take the lyophilized TMEM106A-siRNA powder, dissolve it thoroughly in enzyme-free water according to the instructions, prepare a 20 μM storage solution, aliquot it and store it in a -20℃ refrigerator for later use.

[0066] The day before transfection, podocytes were seeded at an appropriate density in 6-well plates to maintain a cell density of 30% to 50% at the time of transfection.

[0067] On the day of transfection, prepare two 1.5 mL sterile EP tubes. Add 250 μL of Opti-MEM® serum-free medium and 5 μL of siRNA (final concentration 50 nM) to the first EP tube and gently pipette to mix. Add an equal volume of Opti-MEM® medium to the second EP tube, then precisely add 10 μL of RFect transfection reagent and gently mix.

[0068] Combine equal volumes of siRNA working solution and transfection reagent mixture, gently mix by pipetting, incubate at room temperature for 5 min, and then let stand for 15 min.

[0069] Discard the old culture medium in the 6-well plate and replace it with fresh complete culture medium. Add the mixed transfection solution dropwise to the corresponding wells and gently shake to distribute it evenly.

[0070] Incubate the cells at 37°C in a 5% CO2 incubator for 24-48 hours.

[0071] Cells were collected according to the experimental design, and RNA and protein were extracted and subjected to real-time PCR and Western blot, respectively.

[0072] Western blot: (1) Extraction of total cell protein: ① Aspirate the culture medium from a six-well plate with a cell confluence of 80% or more, and rinse the cells twice with PBS buffer.

[0073] ② Remove the PBS wash buffer, add 100 μl of protein lysis buffer (prepared according to the ratio of protein lysis buffer: protease inhibitor: phosphatase inhibitor = 100:1:1) to each well, gently shake the six-well plate to evenly cover the cell surface with the protein lysis buffer solution, and place the six-well plate on ice for lysis for 30 min.

[0074] ③ Scrape the lysed cells and transfer them to RNase-free EP tubes, then centrifuge at 4°C and 12,000 rpm for 30 min.

[0075] ④ Transfer the supernatant to a new RNase-free EP tube.

[0076] (2) Protein concentration determination ① Prepare the BCA working solution according to BCA reagent A:B = 50:1, and ensure that the two are fully mixed.

[0077] ② Add 0-20 μl of protein standard solution and the sample solution to be tested to the standard wells respectively, and then use PBS buffer to make up the volume of each well to 20 μl to ensure that the total liquid volume of each well is consistent.

[0078] ③ Add 200 μl of BCA working solution to all wells, and then incubate the entire plate in a 37°C incubator for 20-30 min.

[0079] ④ Use an ELISA reader to measure the absorbance of each well at wavelength A562.

[0080] ⑤ Plot a standard curve based on the measured absorbance values, and calculate the protein concentration of each sample based on this curve.

[0081] ⑥ Mix the protein supernatant with 4×SDS-PAGE loading buffer at a ratio of 3:1, and thoroughly mix by pipetting. Then heat in a 95°C metal bath for 10 minutes to allow the protein to denature completely.

[0082] (3) Immunoblotting Protein samples were separated using 10% or 12.5% ​​SDS-PAGE, transferred to a PVDF membrane (Millipore, USA), blocked with rapid blocking buffer for 10-15 min, and incubated overnight with primary antibody at 4°C. The next day, the membrane was washed with TBS-T and incubated with the corresponding secondary antibody at room temperature for 1-2 h. Protein bands were visualized using ECL chemiluminescence buffer and imaged using an Amersham Imager 680 (GE, USA). Quantification was performed using ImageJ.

[0083] Immunofluorescence staining: (1) Bake the slices at 65℃ for 60-90 minutes.

[0084] (2) Dewaxing and hydration: The paraffin slices were transferred to a copper rack and passed through the vat in sequence, namely, dewaxing agent I for 15 min, dewaxing agent II for 15 min, anhydrous ethanol I for 8 min, anhydrous ethanol II for 8 min, 95% ethanol for 5 min, 85% ethanol for 5 min, and 70% ethanol for 5 min.

[0085] (3) Washing: Soak in distilled water 3 times, 5 min each time; soak in PBS once, 5 min each time.

[0086] (4) Washing: Soak in distilled water 3 times, 5 min each time; soak in PBS once, 5 min each time.

[0087] (5) Antigen retrieval: Prepare antigen retrieval solution and perform high-pressure heat retrieval for 3 minutes.

[0088] (6) Washing: After the repair solution has returned to room temperature, soak the tissue sections in PBS 3 times, 5 minutes each time.

[0089] (7) Permeability: Permeate with 0.5% Triton for 5 min, then soak in PBS 3 times for 5 min each time.

[0090] (8) Blocking: Add 5% BSA blocking solution to the tissue section and incubate at 37°C for 30 min.

[0091] (9) Incubate primary antibody: Discard the blocking solution, add the working solution of primary antibody, and incubate overnight at 4°C.

[0092] (10) Rewarming: Same as above.

[0093] (11) Washing: Soak in PBS 3 times, 5 min each time.

[0094] (12) Incubation of secondary antibodies: Protect from light, add appropriate concentrations of Alexa Fluor® 594-conjugated donkey anti-rabbit IgG (ab150076, abcam) and Alexa Fluor® 488-conjugated goat anti-mouse IgG (ab150113, abcam) working solutions, and incubate at 37°C for 60 min.

[0095] (13) Washing: Protect from light, soak in PBS 3 times, 5 min each time.

[0096] (14) Protect from light, add DAPI to the tissue section and incubate for 10 min.

[0097] (15) Washing: Protect from light, soak in PBS 3 times, 5 min each time.

[0098] (16) Mounting: After mounting with light-proof, anti-fluorescence quenching mounting medium, observe under a fluorescence microscope.

[0099] Real-time PCR and ELISA were performed as described in Example 1.

[0100] Depend on Figure 2 , 3 The results showed that the exosome marker protein CD63 was significantly expressed in the extracted Normal-EV and PE-EV samples, while the organelle marker protein Calnexin was not detected, indicating that the exosomes were of high purity and could be used for subsequent experimental analysis. Compared with the healthy control group, the TMEM106A protein level in PE-EVs from preeclampsia patients was significantly reduced (P < 0.01); PKH26 labeling experiments showed that EVs could be taken up by podocytes, and the red fluorescence signal was significantly enhanced after 24–48 hours. After podocytes took up PE-EVs, their own TMEM106A protein level was significantly downregulated (P < 0.01); at the same time, the expression of IL-1β, TNF-α, and IL-6 proteins in the cells was upregulated, indicating the activation of the inflammatory response.

[0101] In the siRNA interference experiment, the mRNA and protein expression of synaptopodin, ZO-1, and podocin in si-TMEM106A-treated podocytes were significantly decreased (P < 0.01); the mRNA and protein expression of IL-1β, IL-6, and TNF-α were significantly upregulated (P < 0.001), and ELISA showed an increased IL-6 protein concentration (P < 0.01). Immunofluorescence staining showed that the podocyte skeletal structure of the si-TMEM106A group was disordered, and F-actin staining was broken and disorganized.

[0102] Example 3 The role of TMEM106A in kidney injury and inflammatory response in L-NAME (MeilunBion, MB3015)-induced PE mice.

[0103] C57BL / 6 mice were provided by the Laboratory Animal Center of Shandong First Medical University. All animal studies were reviewed and approved by the Laboratory Animal Ethics Committee of Shandong Provincial Hospital affiliated to Shandong First Medical University.

[0104] Eight-week-old C57BL / 6 pregnant mice were randomly divided into four groups: 1. Con+AAV-NC group; 2..Con+AAV9-TMEM106A group; 3. L-NAME+AAV-NC group; 4.L-NAME+AAV9-TMEM106A group.

[0105] (1) Construct AAV9-TMEM106A overexpression virus (AAV9-TMEM106A) and empty vector control virus (AAV9-NC).

[0106] The specific steps for constructing the AAV9-TMEM106A overexpression viral vector are as follows: Step 1: Design plasmids; Step 2: Lentiviral packaging, purification, and concentration of plasmids.

[0107] The specific steps for designing plasmids in step 1 are as follows: (a1) The mouse TMEM106A gene was synthesized in its entirety, and its sequence is as follows: GCGATCGCCACCATGGGTAAGGCAGTCTCCCAGCTCACCTCTCGGAAGGATGAGGACAAGCCTATCCTACCTGATAACCCAGCCATGGCCAGCCAGGCTGCCAACTACTTCAGCACTGGTAGCAGCAAGCCAGCACACTCCTGTATGCCTTATGAAAAGGCTGCTAGTTCCAGCTTTGTGACTTGTCCTACCTGCCAAGGCAATGGGGAGATCCCCCAAGAGCAAGAGAAGCAGCTGGTTGCTCTCATCCCTTATGGAGACCAAAGGCTGAAGCCCAGACGCACGAAGCTCTTTGTGTTCCTGTCGGTGGCCATCTGCCTGCTGATTTTCTCCCTCACCATCTTTTTCCTGTATCCCCGGCCCATTGCTGTGCGTCCTGTCGGCCTCAACTCTTCCACAGTAACCTTTGAAGACGCTCACGTACAGCTCAACACGACGAATGTCCTGAACATCTTCAACAGCAACTTCTATCCCATCACAGTGACACAGCTGACGGCCGAGGTGCTCCACCAGGCCTCTGTGGTAGGCCAGGTCACCAGCAGCCTCCGCCTGCACATCGGCCCATTGGCCAGTGAGCAGATGCCTTACGAAGTTGCCAGCAGGATTTTGGATGAAAACACATACAAAATCTGTACATGGCCGAAAATCAGAGTCCACCATATTCTTTTGAATATCCAGGGTTCTCTGACCTGCTCCTTCCTAAGCCATCCGCAACAGCTGCCCTTCGAGAGCTTTGAATATGTAGACTGCAGAGAAAACATGTCCCTGCCCCACCTGGAGCTGCCCCGCCCAGCCACGCGT, such as that shown in SEQ ID NO. 17.

[0108] (b1) Digestion: Digest the synthesized fragment and the vector pAV-NPHS1-P2A-GFP. The digestion system is shown in Table 3 below: Table 3

[0109] After adding and mixing the samples, the mixture was placed at 37˚C for 2 hours for enzyme digestion. After the DNA fragment reaction was completed, the size of the target band was detected by 1% agarose gel electrophoresis, and the target fragment was recovered using a gel recovery kit. 1 μL of FastAP was added to the vector pAV-NPHS1-P2A-GFP 1.8 hours after enzyme digestion. After the reaction was completed, the vector was recovered using a product purification kit.

[0110] (c1) Connection: The connection system is shown in Table 4 below: Table 4

[0111] After mixing, centrifuge briefly and connect at 22˚C for 2 hours.

[0112] (d1) Transformation: The ligation product was transformed into E. coli Stable competent cells and plated on LB plates with the corresponding resistance for screening; The specific steps of the transformation: ① Remove the pre-prepared Stable competent cells from -80℃ and place them in an ice bath; ②After the Stable competent cells thaw, take 1 μL of the ligation product into 20 μL of Stable competent cells, mix thoroughly, and let stand in an ice bath for 30 minutes.

[0113] ③ Place the centrifuge tube in a 42℃ water bath for 40 seconds (do not shake the centrifuge tube during this time), then quickly transfer it to an ice bath and let it stand for 2 minutes.

[0114] ④ Add 200 μL of sterile LB medium (without antibiotics) to a centrifuge tube, mix well, and place in a shaker at 37°C and 200 rpm for 1 hour. The purpose is to express the relevant resistance marker gene on the plasmid and revive the bacteria.

[0115] ⑤ Spread onto a petri dish containing the corresponding resistant solid culture medium.

[0116] ⑥ Incubate overnight in a 37℃ incubator.

[0117] (e1) Sequencing: After selecting single colonies for culture, plasmids were extracted and enzyme digestion was performed to identify positive clones. Sequencing was then used to verify the results, and the TMEM106A overexpression viral vector was obtained.

[0118] The specific steps for lentivirus packaging, purification, and concentration of the plasmid in step 2 are as follows: (a2) Preparation of HEK 293T cells: Separate HEK 293T cells one day in advance. When packaging, the cell density should be 85%-90% and the cells should be evenly distributed and in good condition.

[0119] (b2) Packaging virus ① Change the medium for the cells one to two hours before transfection, replacing it with serum-free DMEM medium (1% HEPES and 1% P / S).

[0120] ② Transfection: Prepare the packaging mix according to the mass ratio of transfection reagent: packaging plasmid: vector plasmid: helper plasmid = 786:76:66:120, and let it stand at room temperature for 30 min.

[0121] ③ Add the liquid that has been allowed to stand to the HEK293T cells and shake to mix.

[0122] ④ Collect the virus after culturing the cells in a 37℃, 5% CO2 incubator for 72 hours.

[0123] (c2) Collect the toxin, observe the cell state and take pictures. ① Blow up the cells and collect them together with the culture medium into a 50ml centrifuge tube. Centrifuge to separate the cell pellet and supernatant.

[0124] ② Transfer the culture medium supernatant to a new tube, precipitate with PGE8000 for 2 hours, centrifuge at 3500g and 4℃ for 30 minutes, remove the supernatant, and resuspend with PBS + 0.001% PF68.

[0125] ③ Resuspend the cell pellet in PBS + 0.001% PF68, freeze and thaw once, then add 5M NaCl and vortex to mix.

[0126] ④ Mix the resuspended solution from ② with the resuspended solution from ③, shake to mix thoroughly, and then sonicate until it is no longer viscous.

[0127] ⑤ Centrifuge 3500g of the sonicated liquid for 30min and collect the supernatant.

[0128] Purification: Iodixanol density gradient centrifugation ① Prepare different concentrations of iodixanol.

[0129] ② Take a supernatant tube and add different concentrations of iodixanol layer by layer.

[0130] ③ Add the prepared virus solution to the top layer.

[0131] ④ Purify the virus by ultracentrifugation.

[0132] (d2) Concentration ① After centrifugation, collect the virus.

[0133] ② The collected liquid is placed in an ultrafiltration tube to concentrate the virus.

[0134] ③ After repeatedly blowing and aspirating the remaining liquid in the ultrafiltration tube into the virus storage tube, replenish it to 100 μl with virus storage solution, and label it with the name and date.

[0135] ④ Take 5 μl of virus solution for titer detection.

[0136] (2) Construction of AAV overexpression model: On day 10.5 of pregnancy (E10.5), pregnant mice in the Con+ AAV9-TMEM106A group and the L-NAME + AAV9-TMEM106A group were injected with the corresponding viral solution via the tail vein, while the Con+ AAV-NC group and the L-NAME+ AAV-NC group were injected with the same volume of PBS at the same time.

[0137] (3) Induction of preeclampsia model: From day 10.5 to day 17.5 of pregnancy, pregnant mice in the L-NAME + AAV9-NC group and the L-NAME + AAV9-TMEM106A group were injected intraperitoneally with L-NAME (100 mg / kg) daily to induce the preeclampsia model.

[0138] Both the Con+AAV-NC group and the Con+AAV-TMEM106A group received an equal volume of PBS via intraperitoneal injection during the same period.

[0139] During the experiment, the systolic blood pressure (SBP) of pregnant mice was recorded. Mice were sacrificed at E17.5 for tissue collection, including urine, fetal and placental tissues, and kidney tissue. ① Blood pressure and urine protein detection: The systolic blood pressure (SBP) of pregnant mice was measured using the non-invasive tail cuff method to assess blood pressure changes in the PE model; 24-hour urine was collected using metabolic cages, and urine protein concentration was detected using the BCA protein quantification method.

[0140] ② Assessment of fetal and placental development: Fetal mice and placenta were removed by cesarean section, and their wet weight was measured to assess the impact of the PE model on placental function and fetal growth and development.

[0141] ③ Histological observation: HE staining was used to assess the structural integrity of glomeruli in the kidney tissue.

[0142] ④ Immunofluorescence analysis: The expression and localization of podocyte-associated proteins synaptopodin and ZO-1 in kidney tissue were detected by double-label immunofluorescence.

[0143] ⑤ Western blot protein detection: Glomeruli were isolated and the expression levels of proteins such as IL-1β and TNF-α were detected by Western blot.

[0144] ⑥ Analysis of inflammatory cell infiltration: The number and distribution of macrophages in kidney tissue were detected by F4 / 80 immunofluorescence staining.

[0145] Furthermore, the specific operational steps involved above are as follows: Blood pressure testing, urine protein testing, and fetal placental development assessment are routine procedures, as documented in document identification code PMID:33707686.

[0146] Separating the glomeruli: Mouse kidney cortex was cut into small pieces and digested at 37°C for 15 minutes with a digestive solution containing collagenase and streptoprotein E. The digestion was accelerated by shaking, and then complete culture medium was added to stop the digestion. The digested tissue was then passed through 100μm and 70μm sieves sequentially to collect glomeruli.

[0147] HE staining: (1) Dewaxing: The paraffin slices were placed in a 65°C constant temperature oven and baked for 1 hour. After taking them out, they were placed in an environmentally friendly dewaxing transparent liquid for 15 minutes each time, for a total of 2 times.

[0148] (2) Hydration: The slices were placed in 100%, 95%, 85% and 75% ethanol in sequence, soaked for 3 minutes at each stage, and finally placed in distilled water for full hydration.

[0149] (3) Hematoxylin staining: Add hematoxylin solution (Modified Harris) to the tissue section to ensure complete coverage of the tissue, and stain at room temperature for 5–10 minutes; then rinse with tap water for several minutes to remove surface stain.

[0150] (4) Differentiation and blueing: Place the slices in 1% hydrochloric acid alcohol (1% HCl in 70% EtOH) for rapid differentiation for about 5–10 seconds, then immediately transfer them to distilled water and rinse twice for 5 minutes each time until the cell nuclei turn a clear blue color.

[0151] (5) Eosin staining: Add 0.5% eosin solution (Eosin Y) to the slide to completely cover the tissue, and stain at room temperature for 2 minutes.

[0152] (6) Dehydration and clearing: Dehydrate in 75%, 85%, 95% and 100% ethanol in sequence, 3 minutes for each stage; then clear in xylene twice, 3-5 minutes each time.

[0153] (7) Mounting: Take out the slide, add neutral resin to mount it, let it dry at room temperature, observe it under an optical microscope and take pictures to save the image.

[0154] Western blot and immunofluorescence staining were performed as in Example 2.

[0155] Depend on Figure 4 The results showed that compared with the normal control group, pregnant mice in the L-NAME group had significantly increased SBP and significantly increased urinary protein, and fetal and placental growth was restricted; in the AAV9-TMEM106A intervention group, SBP was significantly decreased.P < 0.001), decreased urinary protein excretion ( P < 0.01, improvement in fetal and placental growth restriction ( P < 0.05); HE staining showed that the glomerular structure of the AAV9-TMEM106A group was significantly restored compared with the L-NAME group; immunofluorescence showed that the expression levels of synaptopodin and ZO-1 were restored; Western blot analysis showed that the expression levels of IL-1β and TNF-α proteins were decreased in the TMEM106A overexpression group; F4 / 80 immunofluorescence staining showed reduced macrophage infiltration, indicating that the inflammatory state of the renal tissue was relieved.

[0156] In summary, the examples demonstrate that, compared with healthy pregnant controls, the expression of TMEM106A in the urine of patients with preeclampsia was significantly downregulated, and it was positively correlated with podocyte marker proteins nephrin and podocalyxin (PCX), and negatively correlated with the expression of inflammatory cytokines IL-1β and TNF-α. Compared with healthy pregnant controls, the expression of TMEM106A protein in plasma exosomes derived from PE patients was significantly reduced, and compared with controls, the expression of inflammatory cytokines IL-1β, IL-6, and TNF-α was significantly upregulated in podocytes exposed to plasma exosomes from PE patients. Furthermore, knockdown of podocyte TMEM106A significantly upregulated the levels of inflammatory cytokines IL-1β, IL-6, and TNF-α, accompanied by downregulation of podocyte-related proteins synaptopodin, podocin, and ZO-1, and cytoskeletal rearrangement, promoting podocyte injury.

[0157] TMEM106A expression was downregulated in podocytes of a L-NAME-induced preeclampsia mouse model, accompanied by increased proteinuria and placental and fetal growth restriction. Compared with the AAV-NC group, mice in the podocyte-specific TMEM106A overexpression adeno-associated virus (AAV-TMEM106A) group showed reduced blood pressure and proteinuria, improved placental and fetal growth restriction, and restored expression of podocyte-related proteins. Furthermore, TMEM106A overexpression significantly downregulated the expression of inflammatory cytokines IL-1β and TNF-α, and reduced F4 / 80⁺ macrophage infiltration in renal tissue.

[0158] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0159] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of TMEM106A as a target in the preparation of diagnostic kits and targeted therapeutic drugs.

2. The application as described in claim 1, characterized in that, The primers for amplifying TMEM106A are: TMEM106A-F: 5'-GACCTGTTCATACCTGAGCCA-3', as shown in SEQ ID NO.1; TMEM106A-R: 5'-GATGCGTTTCCTCGGCAGTC-3', as shown in SEQ ID NO.

2.

3. Application of substances with knockdown of TMEM106A expression in the preparation of podocyte injury models.

4. The application as described in claim 3, characterized in that, The substance is TMEM106A siRNA: 5'-GCAGUUGGUGGCUCUCAUUTT-3', with the sequence shown in SEQ ID NO.

15.

5. A diagnostic kit for eclampsia-related podocyte injury, characterized in that, Primers for amplifying TMEM106A: TMEM106A-F: 5'-GACCTGTTCATACCTGAGCCA-3',SEQ ID NO.1; TMEM106A-R: 5'-GATGCGTTTCCTCGGCAGTC-3', SEQ ID NO.

2.

6. Application of substances overexpressing TMEM106A in the preparation of drugs for treating preeclampsia-related podocyte injury. The application as described in claim 6, characterized in that, This includes the use of AAV9 adeno-associated virus.

Images