SNP (Single Nucleotide Polymorphism) molecular marker related to egg quality characters of green-shell eggs, primer group and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to egg quality characters of green-shell eggs, a primer group and application, and belongs to the technical field of molecular marker assisted breeding. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1. According to the invention, two new SNP sites g.239Tgt are screened in the research process of the egg quality characters of the green-shell eggs; c and g.293 Tgt; c, the variation is detected and verified at the same time, and the result shows that g.239Tgt; c and g.293 Tgt; the C mutation site has significant correlation with egg quality characters such as egg weight, yolk weight and eggshell strength of the green-shell laying hen, and is easy to detect. On the basis, the molecular marker related to the green-shell egg quality character is successfully excavated, a reference basis is provided for auxiliary selection of the green-shell egg quality character, and a reference is provided for molecular breeding of green-shell laying hens.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular marker assisted breeding, in particular to a SNP molecular marker related to egg quality traits of green-shelled egg chicken, primer set and application. BACKGROUND

[0002] Eggs are one of the important food sources in people's daily life. As a large country of egg production and consumption, improving egg quality and chicken breeding efficiency has always been the focus of research. As an important means of modern chicken breeding, molecular marker assisted selection can effectively avoid the disadvantages of traditional breeding based on phenotype selection method, shorten the genetic interval period and improve the selection accuracy. The prerequisite for molecular marker assisted selection is to determine the candidate gene related to the desired phenotypic traits.

[0003] The OATP1B3 protein encoded by the SLCO1B3 gene acts as a transmembrane transporter and can mediate the transcellular transport of lipid-soluble substances such as bile acids and thyroid hormones. In poultry, the SLCO1B3 gene is specifically highly expressed in the epithelial cells of the isthmus of the oviduct of laying hens, and its single nucleotide polymorphism is significantly related to the absorption efficiency of yolk precursor substances. The eggshell color of green-shelled egg chicken is mainly derived from the deposition of biliverdin, and the organic anion transporter OATP1B3 encoded by the SLCO1B3 gene is the main transport channel for the transmembrane transport of biliverdin into the shell gland lumen, which determines whether biliverdin can effectively participate in the eggshell dyeing process.

[0004] However, so far, there has been no report on the research of SLCO1B3 gene on egg quality such as egg weight, egg yolk weight and eggshell strength of laying hens, and there has been no research on SLCO1B3 gene of laying hens as a molecular marker of egg quality traits of laying hens. SUMMARY

[0005] The purpose of the present application is to provide a SNP molecular marker related to egg quality traits of green-shelled egg chicken, primer set and application, to solve the problems existing in the prior art. The present application identifies the SNP sites g.239T>C and g.293T>C significantly associated with egg quality traits of green-shelled egg chicken through resequencing analysis, which provides a reference for the assisted selection of egg quality traits of laying hens.

[0006] To achieve the above purpose, the present application provides the following scheme:

[0007] In a first aspect, the present application provides a SNP molecular marker related to egg quality traits of green-shelled egg chicken, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1; the site of the molecular marker is at least one of g.239T>C and g.293T>C;

[0008] the g.239T>C is a T / C mutation at 239th base in the nucleotide sequence of SEQ ID NO. 1;

[0009] the g.293T>C is a T / C mutation at 293th base in the nucleotide sequence of SEQ ID NO. 1.

[0010] Preferably, the genotype of the g.239T>C molecular marker site is CC, TT or CT; and the genotype of the g.293T>C molecular marker site is CC or CT.

[0011] Preferably, if the genotype of the g.239T>C molecular marker site is CC, the average values of egg weight, eggshell strength, eggshell weight and eggshell thickness of the green-shelled egg-laying chicken eggs are better;

[0012] if the genotype of the g.239T>C molecular marker site is CT or TT, the egg index and yolk weight of the green-shelled egg-laying chicken eggs are better;

[0013] if the genotype of the g.293T>C molecular marker site is CT, the egg weight and yolk weight of the green-shelled egg-laying chicken eggs are better.

[0014] In a second aspect, the present application further provides a primer set for detecting the molecular marker, which comprises an upstream primer sequence as shown in SEQ ID NO. 2 and a downstream primer sequence as shown in SEQ ID NO. 3.

[0015] In a third aspect, the present application further provides an application of the SNP molecular marker or the primer set in any of the following aspects:

[0016] (1) identifying the egg quality-related traits of green-shelled egg-laying chicken;

[0017] (2) breeding green-shelled egg-laying chicken varieties with high egg weight, eggshell strength, yolk weight and eggshell weight;

[0018] (3) breeding green-shelled egg-laying chicken varieties with high egg index;

[0019] (4) screening green-shelled egg-laying chicken varieties related to egg quality traits of green-shelled egg-laying chicken.

[0020] In a fourth aspect, the present application further provides a product for identifying the egg quality traits of green-shelled egg-laying chicken, comprising the primer set.

[0021] In a fifth aspect, the present application further provides an application of the product in any of the following aspects:

[0022] (1) identifying the egg quality-related traits of green-shelled egg-laying chicken;

[0023] (2) breeding green-shelled egg chicken breeds with high egg weight, eggshell strength, egg yolk weight and eggshell weight;

[0024] (3) breeding green-shelled egg chicken breeds with high egg shape index;

[0025] (4) screening green-shelled egg chicken breeds related to egg quality traits of green-shelled egg chicken.

[0026] In a sixth aspect, the present application further provides a breeding method related to egg quality traits of green-shelled egg chicken, comprising the following steps:

[0027] The genomic DNA of the chicken to be tested is used as a template, and the primer set is used for PCR amplification; the obtained amplification product is sequenced, and the genotype of the SNP site is used to determine the egg quality traits of green-shelled egg chicken;

[0028] If the genotype of the g.239T>C molecular marker site is CC, the average values of egg weight, eggshell strength, eggshell weight and eggshell thickness of green-shelled egg chicken are better;

[0029] If the genotype of the g.239T>C molecular marker site is CT or TT, the egg shape index and egg yolk weight of green-shelled egg chicken are better;

[0030] If the genotype of the g.293T>C molecular marker site is CT, the egg weight and egg yolk weight of green-shelled egg chicken are better.

[0031] Preferably, the PCR amplification reaction system is: 2×Taq Master Mix 30μL, DNA 1.5μL, 10μM upstream primer 0.9μL, 10μM downstream primer 0.9μL, ddH2O 26.7μL.

[0032] Preferably, the PCR amplification reaction program is: 95℃ pre-denaturation for 10min; 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 15s, cycle 39 times; finally, 72℃ extension for 5min

[0033] The present application discloses the following technical effects:

[0034] The application detects two new molecular markers on the SLCO1B3 gene in the process of green shell egg chicken egg quality trait research, obtains the nucleotide sequence corresponding to the molecular marker as shown in SEQ ID NO. 1, the SNP sites of the two molecular markers are g.239T>C and g.293T>C, and the variation is detected and verified, and the results show that: the g.239T>C and g.293T>C mutation sites have significant correlation with the egg quality traits of green shell egg chicken such as egg weight, egg yolk weight and egg shell strength, and are easy to detect. Based on this, the application successfully mines the SNP molecular markers related to the egg quality traits of green shell egg chicken, provides a reference for the assisted selection of egg quality traits of egg chicken, and provides a reference for the molecular breeding of green shell egg chicken. BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0036] Figure 1 The amplification electrophoretogram is shown in the figure; wherein M is Marker, 1-3 is the corresponding amplification electrophoretogram of Jingmen green shell egg chicken, 4-6 is the corresponding amplification electrophoretogram of Wuhan green shell egg chicken, and 7-8 is the corresponding amplification electrophoretogram of Xiaogan Shendan No. 6 egg chicken;

[0037] Figure 2 The gene peak diagram under different SNP sites is shown in the figure. DETAILED DESCRIPTION

[0038] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0039] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the range, and any other stated value or intermediate value in the range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0040] Unless otherwise indicated, all technical and scientific terms have the same meaning as those one of ordinary skill in the art of the application would attribute to such terms. Although preferred methods and materials are described, any method and material similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned in this specification are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the present specification and any document incorporated herein by reference, the present specification will control.

[0041] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0042] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having" and the like are open-ended terms that are intended to mean including, but not limited to.

[0043] The nucleotide sequence of the molecular marker screened by the present application is shown as SEQ ID NO. 1. In the nucleotide sequence, there is a T / C base mutation at the 239th position and a T / C base mutation at the 293rd position.

[0044] SEQ ID NO. 1: GTTACTGCTGAAATTCAACCACTGTACAAATATAGCTATTTCAGCAAATTAAGTGTGGGAAGTTCCACCTTCTCAATTAACTTGGTTCTGTTTCGTTTGATTCTAGGAAAAATTGCTATCACTCCACAGGACTCTCGCTGGGTGGGTGCCTGGTGGCTTGGTTTTTTAATAGCTGGAGTGATCAGTTTCCTAGCTGCTATTCCATTTTGCTTCCTGCCAAAGAGTCTGAAAAAGCCCCYGAAAGCCAATAAGGACAAAACTTCACCTGGTCTCCTGGAAAATATGGGAGCCAYGAGGAAGACACTTCCTTCTGTAAAATCTAAGCCAGCAAAGTGGTCAACAATGCTGAAAGGCAAGTGTTTTGTGTGTCAGGTAATTATGGAAAGCAAACGTACAGTAAAAATGTGATACTTCAGCAGAACATTTTATATCCCCTACACTTAAATGAGTAAATATACACTTAAGTACACTTAAATGAATAAATGAGTTAGCTATCCCCAGGAAAGGAGTTATCCAATAAATATTATGAGCAGTCAAAGAGCTTCTTCTAGACTGTGAGGTTCTGCATGTATGATTACCTTTATGGCA;

[0045] Note: The bolded bases in the sequence shown in SEQ ID NO. 1 are mutation sites, and Y is C or T.

[0046] Example 1: Screening of shape-related molecular markers of green-shelled egg chicken egg quality

[0047] Blood samples of 150 different strains (50 Jingmen green-shelled egg chickens, 50 Xiaogan Shendan No. 6 green-shelled egg chickens, and 50 Wuhan green-shelled egg chickens) and egg quality determination records were collected from a farm in Jingzhou, Hubei Province, and the whole genome DNA of the 150 chickens was extracted using a kit.

[0048] DNA resequencing was performed on 150 green-shelled laying hens, and the sequencing data was aligned with the reference genome of Bailaihang GRCg6a. The results showed that all green-shelled laying hens had a T>C mutation at position 239bp in the nucleotide sequence shown as SEQ ID NO. 1 taken from the SLCO1B3 gene, and some green-shelled laying hens had a T>C mutation at position 293bp, which were named g.239T>C and g.293T>C, respectively.

[0049] Application of g.239T>C and g.293T>C molecular markers

[0050] The whole genome DNA extracted in Example 1 was used as experimental material for PCR amplification. The primers were designed according to the sequence information of SEQ ID NO. 1, and the primer information is as follows:

[0051] Forward primer F1: GTTACTGCTGAAATTCAACCAC (SEQ ID NO. 2);

[0052] Reverse primer R1: TGCCATAAAGGTAATCATACATGC (SEQ ID NO. 3).

[0053] The PCR reaction system was as follows: 2x Taq Master Mix 30 μL, DNA 1.5 μL, 10 μM upstream primer 0.9 μL, 10 μM downstream primer 0.9 μL, ddH2O 26.7 μL. The PCR amplification reaction program was as follows: 95°C pre-denaturation for 10 min; 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 15 s, 39 cycles; finally 72°C extension for 5 min, 12°C storage of the amplification product.

[0054] 4 μL of PCR product in each tube was subjected to agarose gel electrophoresis, and the results are shown in Figure 1 The PCR product obtained above was sent to Shanghai Bioengineering Company for sequencing. After sequencing the genomic PCR amplification product, the sequencing results were aligned and analyzed using DNA Star software, the sequencing results were homologously aligned with the corresponding fragment sequence of the known SLCO1B3 gene in the GenBank database, potential mutation sites were screened, and their distribution in different individuals or breeds was analyzed. Through alignment and analysis, the variation characteristics of the SLCO1B3 gene can be determined, and the alignment results of the related mutation sites are shown in Figure 2 .

[0055] Example 3: Detection of polymorphism distribution of molecular markers in laying hens

[0056] The polymorphism distribution of the molecular marker screened by the application in the laying hens was detected, and the genotype frequency, allele frequency and distribution of the g.239T>C and g.293T>C mutation sites are shown in Table 1.

[0057] Table 1 Genotype frequency and allele frequency

[0058]

[0059] Example 4 Correlation analysis of molecular markers and egg quality traits

[0060] In order to establish the relationship between the above molecular markers and the egg quality traits, 150 chickens of different strains (50 Jingmen green-shelled egg chickens, 50 Xiaogan Shendan No. 6 green-shelled egg chickens and 50 Wuhan green-shelled egg chickens) were selected as experimental materials, and the egg weight, egg yolk weight and egg shell strength of the 150 chickens of different strains were determined, and the results are shown in Tables 2-5.

[0061] Table 2 Correlation analysis of g.239T>C and g.293T>C sites and green-shelled egg chicken egg quality

[0062]

[0063] Note: Different letters represent significant differences (p<0.05) between different genotypes at the same site (the same below).

[0064] As shown in Table 2, in the egg weight trait, in the g.239T>C site, the egg weight of the CC genotype was 50.78g, the egg weight of the TT genotype was 47.73g, and the egg weight of the CT genotype was 48.76g, the egg weight of the CC genotype was higher than that of the TT genotype and the CT genotype, and there was a significant difference (p<0.05). In the g.293T>C site, the average egg weight of the CT genotype was 51.73g, which was higher than that of the CC genotype (47.96g), and there was a significant difference (p<0.05).

[0065] Table 3 Correlation analysis of g.239T>C site and Jingmen green-shelled egg chicken egg quality

[0066]

[0067] From table 3, in Jingmen green shell laying hen g.239T>C site, the average egg weight of CC genotype is the highest, which is 52.23g, higher than TT (49.10g) and CT (49.07g) genotypes, showing significant difference (p<0.05); the average eggshell strength of CC genotype is 52.92N, significantly higher than TT (41.92N) and CT (42.43N) genotypes, showing significant difference (p<0.05); the average egg yolk weight of CT genotype is 16.83g, significantly higher than TT (15.85g) and CC (15.99g) genotypes, and the difference is significant, indicating that CT genotype may increase the egg yolk weight of laying hen. In Jingmen green shell laying hen g.293T>C site, there is no mutation.

[0068] Table 4 g.239T>C site and Wuhan green shell laying hen egg quality correlation analysis

[0069]

[0070] From table 4, in Wuhan green shell laying hen g.239T>C, the average egg weight of CC genotype is 46.78g, that of TT genotype is 44.50g, and that of CT genotype is 44.57g, showing no significant difference (p>0.05), indicating that different genotypes of the site have no obvious effect on egg weight; the egg shape index of CT genotype is 74.54, that of TT genotype is 76.52, and that of CC genotype is 65.12, and there is significant difference in egg shape index between CT / TT genotype and CC genotype (p<0.05). In Wuhan green shell laying hen g.293T>C, there is no mutation.

[0071] Table 5 g.239T>C and g.293T>C site and Xiaogan Shidan No.6 laying hen egg quality correlation analysis

[0072]

[0073] From table 5, in Xiaogan Shidan No.6 laying hen g.239T>C, the average egg weight of CC genotype is 49.10g, that of TT genotype is 51.03g, and that of CT genotype is 50.30g, showing no significant difference (p>0.05). In Xiaogan Shidan No.6 laying hen g.293T>C, the egg yolk weight of CT genotype is 18.25g, and that of CC genotype is 17.23g, showing significant difference (p<0.05).

[0074] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements of the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope determined by the claims of the present application.

Claims

1. A SNP molecular marker associated with the quality trait of green-shelled eggs, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the site of the SNP molecular marker is at least one of g.239T>C and g.293T>C; The g.239T>C sequence contains a T / C mutation at the 239th base in the nucleotide sequence shown in SEQ ID NO.

1. The g.293T>C sequence contains a T / C mutation at the 293rd bp base in the nucleotide sequence shown in SEQ ID NO.

1.

2. The SNP molecular marker according to claim 1, characterized in that, The genotype of the g.239T>C molecular marker site is CC, TT, or CT; the genotype of the g.293T>C molecular marker site is CC or CT.

3. The SNP molecular marker according to claim 1, characterized in that, If the genotype of the g.239T>C molecular marker site is CC, then the average values ​​of egg weight, eggshell strength, eggshell weight and eggshell thickness of green-shelled chickens are better. If the genotype of the g.239T>C molecular marker site is CT or TT, then the egg shape index and yolk weight of green-shelled chicken eggs are better. If the genotype of the g.293T>C molecular marker site is CT, then the egg weight and yolk weight of green-shelled chickens are superior.

4. A primer set for detecting the molecular marker as described in claim 1, characterized in that, The primer set includes an upstream primer sequence as shown in SEQ ID NO.2 and a downstream primer sequence as shown in SEQ ID NO.

3.

5. The use of an SNP molecular marker as described in any one of claims 1-3 or a primer set as described in claim 4 in any one of the following: (1) Identify the quality-related traits of green-shelled eggs; (2) Breed green-shelled chicken breeds with high egg weight, eggshell strength, yolk weight and eggshell weight; (3) Breed green-shelled chicken breeds with high egg shape index; (4) Screening green-shelled chicken breeds that are related to the quality traits of green-shelled eggs.

6. A product for identifying the quality characteristics of green-shelled eggs, characterized in that, Includes the primer set as described in claim 4.

7. The use of the product as described in claim 6 in any of the following: (1) Identify the quality-related traits of green-shelled eggs; (2) Breed green-shelled chicken breeds with high egg weight, eggshell strength, yolk weight and eggshell weight; (3) Breed green-shelled chicken breeds with high egg shape index; (4) Screening green-shelled chicken breeds that are related to the quality traits of green-shelled eggs.

8. A breeding method related to the quality traits of green-shelled eggs, characterized in that, Includes the following steps: Using the genomic DNA of the chicken to be tested as a template, PCR amplification was performed using the primer set described in claim 4; the obtained amplification products were sequenced, and the quality traits of green-shelled eggs were determined based on the genotype of the SNP sites. If the genotype of the g.239T>C molecular marker site is CC, then the average values ​​of egg weight, eggshell strength, eggshell weight and eggshell thickness of green-shelled chickens are better. If the genotype of the g.239T>C molecular marker site is CT or TT, then the egg shape index and yolk weight of green-shelled chicken eggs are better. If the genotype of the g.293T>C molecular marker site is CT, then the egg weight and yolk weight of green-shelled chickens are superior.

9. The breeding method according to claim 8, characterized in that, The PCR amplification reaction system consisted of: 30 μL of 2×TaqMaster Mix, 1.5 μL of DNA, 0.9 μL of 10 μM upstream primer, 0.9 μL of 10 μM downstream primer, and 26.7 μL of ddH2O.

10. The breeding method according to claim 8, characterized in that, The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 15 s, for 39 cycles; and finally 72℃ extension for 5 min.

Images