Method for rapidly identifying male and female cannabis sativa plants based on specific DNA (deoxyribonucleic acid) sequence

Abstract

The invention discloses a method for rapidly identifying male and female cannabis sativa plants based on a specific DNA (Deoxyribose Nucleic Acid) sequence. Based on high-quality haplotype genome data of the cannabis sativa, population genetic differentiation indexes and allele frequency difference analysis are adopted, the fact that the cannabis sativa belongs to an XX / XY type sex determination system is determined, the sex chromosome of the cannabis sativa is positioned to be a 10 # chromosome, and a specific linkage region on a Y chromosome is positioned in a 28.17-118.28 Mb region. A Y specific gene sequence is identified, a specific PCR primer is further designed, and a rapid PCR amplification system is established. Compared with a traditional phenotype-dependent identification method, the method can simply, efficiently, accurately and rapidly screen the plants with the target gender in the seedling stage, remarkably saves field planting space and management cost, and is suitable for accurate screening of cannabis sativa with different purposes. The method can improve the breeding efficiency and economic benefits of the cannabis industry, provides technical support for sex control production of the cannabis, and has industrial application prospects.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology, bioinformatics and molecular breeding, and specifically relates to a method for DNA sequence markers of male hemp plants and rapid identification of male and female hemp plants. Technical Background

[0002] Currently, researchers commonly use morphological observation, physiological index comparison, organic solvent staining, and SNP typing to identify plant sex. However, there are few reports on methods for sex identification in hemp. Therefore, it is of great significance to develop a rapid and accurate method for sex identification in hemp. Summary of the Invention

[0003] This invention identifies the sex of hemp at the molecular level. Based on genome assembly, it identifies the male-specific region of the male heterogametic sex determination system in hemp, namely the Y chromosome sex-linked region. Based on the male-specific sequence, it develops male-specific DNA sequence markers and primers to efficiently, rapidly, and accurately distinguish between male and female hemp plants.

[0004] The purpose of this invention is to mine the male-specific sequence of hemp and develop specific primers for the male-specific sequence, and to test the correctness of the primers using plants of known sex. This invention can quickly and efficiently screen plants of the target sex in the seedling stage of hemp, which is beneficial for the targeted breeding of hemp and significantly reduces planting costs. To achieve the above objectives, this invention adopts the following technical solution:

[0005] The haplotype genome of male hemp plants (XX / XY sex determination system) was assembled. High-quality SNPs were obtained by resequencing 15 female and 15 male individuals. The X and Y chromosomes of the assembled male hemp genome were accurately identified using the chromosome quotient (CQ) method. The population differentiation index Fst among male individuals was used to determine that the 28.17–118.28 Mb region is a Y-chromosome sex-linked region (Y-SLR), and the 27.10–87.82 Mb region is an X-chromosome sex-linked region (X-SLR). The protein sequences of Y-SLR-specific genes were compared with the whole genome sequence of male plants using BLASTN. Based on the exon sequence information from the comparison results, Y-specific exon sequences were determined. These sequences were then compared again with the whole genome sequence using BLASTN, ultimately confirming them as male-specific sequences in hemp.

[0006] This invention provides a male-specific sequence molecular marker for hemp, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention further provides the application of the aforementioned molecular sequence in identifying male and female hemp plants.

[0008] Specifically, the presence of the specific DNA sequence marker is determined by PCR amplification of the genomic DNA of the plant to be tested, or by hybridization of the probe with the genomic DNA nucleic acid of the plant to be tested, or by sequencing the genomic DNA of the plant to be tested. If the sequence marker is present, the plant is male; otherwise, it is female.

[0009] The present invention correspondingly provides specific PCR primers for identifying male and female hemp plants based on the aforementioned molecular markers.

[0010] Preferably, the specific primers are as follows: the forward primer is shown in SEQ ID NO.2, and the reverse primer is shown in SEQ ID NO.3.

[0011] This invention provides a method for identifying male and female hemp plants. The method utilizes the DNA molecular sequence to develop male-specific PCR primers for hemp and performs PCR amplification on the genome template of the plant to be tested. If a band of 110 bp in length is found in the amplification product, the sample is a male plant. If no obvious band is obtained, the sample is a female plant.

[0012] Preferably, the PCR primers are:

[0013] The forward primer is shown in SEQ ID NO.2, and the reverse primer is shown in SEQ ID NO.3.

[0014] Specifically, the PCR amplification system used is as follows:

[0015]

[0016] The PCR amplification conditions are as follows:

[0017]

[0018] Specifically, during primer amplification, if a corresponding amplification-specific bright band of 110 bp is obtained, it indicates that the sample is male; if no obvious band is obtained, it indicates that the sample is female.

[0019] In a specific implementation, the PCR amplification products are detected by agarose gel electrophoresis.

[0020] The advantages of this invention are as follows: by screening for specific DNA sequences linked to the sex of hemp, a male-specific DNA molecular sequence of hemp is obtained; primers for detecting the specificity of this sequence are designed; and the specificity and accuracy of these primers are tested using hemp plants of known sex. This invention relates to a rapid method for sex identification of hemp plants, which can effectively solve the problem of early sex identification in hemp breeding. Compared with existing technologies, this method has the following outstanding advantages: it breaks through the technical bottleneck of traditional sex identification relying on flowering time, and can distinguish between male and female plants at any stage of plant growth and development; it is easy to operate, and the accuracy is significantly improved, making it particularly suitable for breeding screening; it significantly reduces field management and production costs, improves breeding efficiency, and has important industrial application value. This method provides a new technical means for targeted breeding of hemp and can be widely applied to the hemp cultivation industry. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the identification of sex-specific sequences in hemp in Example 1, where (a) is the F chromosome of the hemp Y chromosome. st And the CQ results diagram, (b) is the F chromosome of the hemp X chromosome. st And CQ results chart.

[0022] Figure 2 The images show the male and female inflorescences of the hemp plant samples collected in Example 3, where (a) is the inflorescence of the male plant and (b) is the inflorescence of the female plant.

[0023] Figure 3 This is a diagram showing the results of identifying samples of known sex of hemp seeds using molecular marker primers in Example 3. Detailed Implementation

[0024] The following examples illustrate the research and discovery process and results of the hemp male-specific DNA molecular sequence and detection primers of the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the invention without departing from the spirit and substance of the invention are within the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the reagents or materials are from commercial or publicly available sources.

[0025] Example 1: Genome sequencing analysis of hemp and development of male-specific DNA molecular sequences

[0026] First, the haplotype genome of male hemp plants using the XY sex determination system was assembled. This included using hifisam to combine PacBio HiFi reads with Hi-C reads to complete contig assembly, followed by Hi-C-assisted manual correction and backbone construction using Juicer and 3d-DNApipeline, and then fine-tuning using Juicebox to finally construct the chromosome framework model. Subsequently, 15 individuals each of female and male hemp plants were collected for resequencing. After obtaining high-quality SNPs, CQ-calculate.pl was used to align the sequencing reads of all hemp samples to a 50 kb non-overlapping sliding window on the genome, and the coverage of each window was calculated. In the XY sex determination system, when the X chromosome is used as a reference, the CQ value of the X chromosome is expected to be approximately 2, the CQ value of the Y chromosome is expected to be approximately 0, and the CQ value of autosomes or pseudoautosomes is expected to be approximately 1. The X and Y chromosomes of the assembled male hemp genome were identified. Figure 1 As shown in (a). Given the significant differences in sex linkage regions between X and Y, the inter-individual population differentiation index F was calculated for each haplotype dataset, specifically for both males and females. st Calculate and use the changepoint procedure to detect F. st Areas with significant value changes are identified to precisely pinpoint potential gender linkage zones, ultimately through the integration of CQ and F... st To jointly determine the final sex linkage boundaries of the two species, such as Figure 1 As shown in Figure (b), the sex-linked region of the Y chromosome ranges from 28.17 to 118.28 Mb, and the sex-linked region of the X chromosome ranges from 27.10 to 87.82 Mb.

[0027] To identify Y-SLR-specific genes, bidirectional BLASTP analysis was performed on protein-coding genes within both Y-SLR and X-SLR. Y-protein-coding genes that did not align with X-SLR protein-coding genes were identified as Y-SLR-specific genes. To identify Y-specific sequences, BLASTN alignment analysis was performed on the exon sequences of Y-SLR-specific genes against the whole genome sequence of male hemp plants. Based on the exon positions identified in the alignment, Y-specific exon sequences were determined. Finally, these sequences were aligned again with the whole genome sequence, and sequences with unique alignment results within the hemp genome were identified as Y-specific sequences.

[0028] SEQ ID NO.1:

[0029] AACTTCAGTTTTGGACGTGTTCTCTTGTGCTCGAACGGTGGTTCATCGTAGTGACTCATCTGGACTTATGGCTTCTACATATTCTCTGCCTCATTCTTTGCCAGTGGTCTCGGTTGCTAATGGAGGTGGTTCTAACCTTCCTCTTCCCAGTCTAGTTCGTGG CCCGAGACGAGTGATGATGGTGACTTCTCAGAGACCTGTTTTGACTCCCAGAACCAGGCATGTCTCGCGTGAGTTGGCCTTTACCTCTCTTCGTATTACTGTTGTGTTTGTTGTTTTTGAGGTGAGAAAGTTTCCTAAAAATTTCCTATTTTTGAGGAAATG.

[0030] Example 2: Primer design for detecting the male-specific DNA sequence of hemp seed.

[0031] Based on the nucleotide sequence of the male-specific DNA molecule obtained in Example 1, the sequence was imported into Geneious Primer Version 2023.2.1 software. Specific primers for this sequence were designed, with primer lengths set to 18-22 bp, GC content of 45%-55%, Tm value of 50±5℃, and product length greater than 100 bp. The selected primers were then compared with the whole genome of *Hemp japonicus* using BLASTP to detect primer specificity. The final developed male-specific DNA molecule sequence primers are shown below for their forward and reverse primer sequences:

[0032] Forward primer F: 5' TCTCTTGTGCTCGAACGGTG 3' (SEQ ID NO.2)

[0033] Reverse primer R: 5' ACCACCTCCATTAGCAACCG 3' (SEQ ID NO.3).

[0034] Example 3: Identification of male and female hemp plants

[0035] 1. Extraction of hemp genomic DNA

[0036] according to Figure 2The inflorescence shown indicates the sex of the hemp plants (a is a male plant, b is a female plant). During the flowering period, 16 young leaves of hemp plants with known sex were collected, of which 8 were female and 8 were male. Genomic DNA was extracted from the above samples using a plant DNA extraction kit. The DNA concentration was detected using a Nano Drop micro spectrophotometer. The DNA template solution was diluted with sterile water to a concentration of 20 ng / µl for later use.

[0037] 2. PCR amplification reaction

[0038] The PCR amplification system used is as follows:

[0039]

[0040] The PCR amplification conditions are as follows:

[0041]

[0042] Using the extracted DNA as a template, and employing the specific primers designed in Example 2, PCR amplification was performed on 16 hemp seeds of known sex according to the above amplification system and procedure. The obtained PCR products were detected by 2.0% agarose gel electrophoresis, and the electrophoresis results are as follows. Figure 3 As shown. According to Figure 3 The results showed that the primers had good specificity and met expectations, namely, the PCR product of male plants showed a bright band of 110 bp, while female plants showed no obvious band. The results indicate that the specific primer amplification method for identifying male and female plants is consistent with the inflorescence identification method, and the detection method is accurate and reliable.

[0043] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent application of the present invention shall fall within the scope of the present invention.

Claims

1. An isolated specific DNA molecule for identifying the sex of a Cannabis sativa plant, characterized in that, The nucleotide sequence is SEQ ID NO.

1.

2. The use of the specific DNA molecule in claim 1 in identifying the male and female plants of Cannabis sativa L.

3. Use according to claim 2, wherein the compound is ###0002### The specific DNA molecule is determined by PCR amplification of the genomic DNA of the plant to be tested to determine whether the specific DNA molecule exists, or by hybridization of the probe with the genomic DNA of the plant to be tested to determine whether the specific DNA molecule exists, or by sequencing the genomic DNA of the plant to be tested to determine whether the specific DNA molecule exists, if the sequence marker exists, it is a male plant, otherwise it is a female plant.

4. A specific PCR primer or probe for identifying the male and female plants of Cannabis sativa L. based on the DNA molecule in claim 1.

5. The PCR primer or probe of claim 4, wherein, The forward primer of the PCR primer is shown in SEQ ID NO. 2, and the reverse primer is shown in SEQ ID NO.

3.

6. A method of identifying female and male plants of Cannabis sativa L. characterized by, The PCR primer is used in claim 4 or 5, and the genomic template of the plant to be tested is subjected to PCR amplification, and if there is a band in the amplification product, it indicates that the sample is a male plant, and if no band is obtained, it indicates that the sample is a female plant.

7. The method of claim 6, wherein, The PCR amplification system is based on 12.5 μl system as follows: 。 8. The method of claim 7, wherein, The PCR amplification conditions are as follows: 。 9. The method of claim 6, wherein, When the primer is amplified, if there is a corresponding specific bright band of 110 bp, it indicates that the sample is male, and if no obvious band is obtained, it indicates that the sample is female.

10. The method of claim 9, wherein, The PCR amplification product is detected by agarose gel electrophoresis.

Images