Application of plant-derived miRNA in anti-aging

Abstract

The invention provides application of plant-derived miRNA in anti-aging, and belongs to the technical field of biological medicine and functional nucleic acid molecules. The miRNA disclosed by the invention is mul-miRNA-n16 (hereinafter referred to as mmn16) from mulberries, and the nucleotide sequence of the miRNA is shown as SEQ ID No: 1; experiments prove that the mmn16 and the simulant thereof can remarkably reduce the SA-beta-Gal positive proportion, inhibit expression of senescence-related genes such as p16, p21 and p53 and remarkably improve proliferation and migration capabilities of senescence cells in senescence models constructed by HFF-1 and 3T6, so that the mmn16 has a good anti-cell senescence effect; besides, in an animal model, the mmn16 can promote wound healing of skin tissues in the animal model, which prompts that the mmn16 also has anti-aging and functional recovery potentials on the tissue level; the invention fills the technical blank that mmn16 has no application in cell aging resistance, provides a new thought and method for developing plant-derived anti-aging miRNA, and has important medical and social values for the research of intervening the cell aging process.

Description

Technical Field

[0001] This invention relates to the application of plant-derived miRNA in anti-aging, belonging to the fields of biomedicine and functional nucleic acid molecular technology. Background Technology

[0002] Aging is an inevitable natural physiological process for the human body and a major public health challenge facing the world today. Cellular senescence is considered a key contributing factor to many age-related diseases, including cardiovascular disease, Alzheimer's disease, and cancer. Its characteristics include cell cycle arrest, activation of the senescence-associated secretory phenotype (SASP), mitochondrial dysfunction, and elevated levels of oxidative stress. Therefore, developing effective interventions in the cellular senescence process has significant medical and social value.

[0003] MicroRNAs (miRNAs) are a class of small, non-coding RNAs, approximately 18–24 nt in length, widely found in plants and animals. They play a crucial role in regulating mRNA expression and participating in cell proliferation, differentiation, apoptosis, and the aging process. In recent years, the role of miRNAs in aging regulation has received considerable attention, particularly their important role in regulating key aging signaling pathways such as the p53 / p21 pathway, the FOXO family, and the mTOR pathway. However, current anti-aging research primarily focuses on endogenous miRNAs, while research on exogenous miRNAs, especially plant-derived miRNAs, in anti-aging applications remains in its early stages.

[0004] Plant-derived miRNAs possess unique structural stability, low immunogenicity, and good bioavailability, and have been proven to enter mammals and exert biological functions through dietary intake or delivery systems via vectors. Exogenous plant-derived miRNAs, due to their safety and availability, have become an emerging direction in anti-aging research.

[0005] mul-miRNA-n16 is a newly discovered plant-derived miRNA derived from mulberry (Morus alba) tissue. Currently, no published literature reports on the anti-aging function of this miRNA in animal cells, nor is there any data revealing its mechanism in regulating cellular senescence. Therefore, verifying the role of mul-miRNA-n16 in restoring cell viability and delaying the cellular senescence process is expected to fill the technological gap regarding the application of mul-miRNA-n16 in anti-cellular senescence. Summary of the Invention

[0006] To address some shortcomings in existing technologies, such as the lack of natural, safe, and effective exogenous miRNA-based anti-aging interventions, this invention aims to provide an application of plant-derived miRNAs in anti-aging. This invention is the first to discover that the small RNA molecule mul-miRNA-n16, derived from the plant *Morus alba*, can significantly reduce the expression of aging-related factors (such as β-galactosidase, p21, p53, etc.) at both cellular and animal levels, enhance the activity and migration ability of skin fibroblasts, restore their proliferation and repair functions, thereby effectively delaying the aging process and promoting the functional recovery of skin tissue. The mul-miRNA-n16 described in this invention includes the naturally modified single-stranded miRNA itself (SEQ ID No: 1) and an artificially synthesized form consistent with the natural modification site. Furthermore, this invention also includes mimics obtained by further introducing chemical modifications (such as cholesterol, locked nucleic acid (LNA), peptide nucleic acid (PNA), methoxy, thio, phosphate backbone modifications, etc.) into mul-miRNA-n16 to enhance its stability, bioavailability, or tissue penetration ability.

[0007] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:

[0008] This invention first provides an application of an active ingredient in the preparation of anti-aging products; the active ingredient includes mul-miRNA-n16, mul-miRNA-n16 precursor, modified or unmodified mul-miRNA-n16 mimics; the nucleotide sequence of mul-miRNA-n16 is shown in SEQ ID No: 1; the mul-miRNA-n16 is derived from mulberry.

[0009] Furthermore, the nucleotide sequence of the mul-miRNA-n16 precursor is shown in SEQ ID No: 2.

[0010] The mimic of mul-miRNA-n16 comprises a sense strand and an antisense strand, the nucleotide sequence of which is shown in SEQ ID No: 3 and the nucleotide sequence of which is shown in SEQ ID No: 4.

[0011] The modifications include one or more of the following: methylation modification, cholesterol modification, phosphate backbone thiolation modification, peptide nucleic acid modification, or locked nucleic acid modification.

[0012] The methylation modification includes modification using 2'-O-methyl groups.

[0013] The anti-aging products include those that inhibit the cellular aging process, alleviate the aging of mammalian skin tissue, enhance the activity of skin fibroblasts, promote skin tissue repair, or improve the functional degeneration caused by aging.

[0014] The present invention also provides an anti-aging product comprising mul-miRNA-n16, mul-miRNA-n16 precursor, modified or unmodified mul-miRNA-n16 mimics; the nucleotide sequence of the mul-miRNA-n16 is shown in SEQ ID No: 1.

[0015] Furthermore, the products include both topical and oral products.

[0016] The products include pharmaceuticals, medical devices, biomaterials, tissue engineering products, cosmetics, or health products.

[0017] The present invention further provides a pre-miRNA construct or vector expressing mul-miRNA-n16 for subsequent cell transfection or in vivo delivery, which has advantages in intracellular processing and is suitable for nucleic acid drug development.

[0018] Compared with the prior art, the present invention has the following significant advantages:

[0019] (1) This invention first proposed that the miRNA molecule mul-miRNA-n16 derived from the plant mulberry (Morus alba) has significant anti-aging activity in mammalian cells. Through in vitro experiments, mul-miRNA-n16 (or its mimics) can significantly reduce the proportion of SA-β-Gal positive cells and inhibit the expression levels of aging-related factors p16, p21, and p53 in a human skin fibroblast (HFF-1) aging model. At the same time, mul-miRNA-n16 treatment significantly improves the proliferation and migration ability of senescent cells, suggesting that it can reverse some aging phenotypes and has potential cell remodeling and functional recovery effects.

[0020] (2) The mul-miRNA-n16 molecule provided by this invention is derived from edible plants (mulberry), has a small structure and a well-defined sequence, and possesses good biocompatibility and low immunogenicity, making it suitable for development into oral or topical formulations. mul-miRNA-n16 can be industrially produced through chemical synthesis or in vitro transcription, and is easily modified with cholesterol, LNA (locked nucleic acid), PNA (peptide nucleic acid), etc. The modification methods are mature and have good commercial development potential.

[0021] (3) This invention has verified the functional effects of mul-miRNA-n16 at the tissue level in animal experiments. In a mouse skin trauma model, treatment with mul-miRNA-n16 mimics significantly improved wound healing efficiency and shortened wound closure time. Considering that skin aging is usually accompanied by a decline in tissue regeneration capacity and delayed wound healing, this result can serve as indirect supporting evidence for the anti-aging effect of mul-miRNA-n16, further confirming its application prospects in the fields of skin aging intervention, tissue repair, and cosmetic treatment. Attached Figure Description

[0022] Figure 1 The changes in SA-β-galactosidase (SA-β-Gal) expression in HFF-1 cells of each group in the H2O2-induced aging model (left figure) and the natural aging model (right figure) in Example 2 are shown to verify the anti-aging effect (the data results were statistically tested, ns indicates no significant difference, and ** and ## indicate extremely significant differences and P < 0.01).

[0023] Figure 2 The results of the effect of mul-miRNA-n16 on the proliferation capacity of senescent cells in Example 3 (CCK-8 assay results) (the data results were statistically tested, ns indicates no significant difference, and ** and ## indicate extremely significant differences and P < 0.01).

[0024] Figure 3 These are representative images showing the effect of the mul-miRNA-n16 mimic on the healing of mouse skin wounds in Example 4.

[0025] Figure 4 The changes in expression levels of mul-miRNA-n16 in cells (left) and animal tissues (right) in Example 5 are shown in Figure 5. (Statistical analysis was performed on the data results. ns indicates no significant difference, * indicates a significant difference and P < 0.05, and ** indicates a highly significant difference and P < 0.01).

[0026] Figure 5 The results show the changes in the expression of aging markers such as p16, p21, and p53 in cells after treatment with mul-miRNA-n16 in Example 5 (the data results were statistically tested, ns indicates no significant difference, # indicates a significant difference and P < 0.05, and ** and ## indicate extremely significant differences and P < 0.01).

[0027] Figure 6 The results show the changes in cell migration ability after treatment with mul-miRNA-n16 in Example 5 (the data results were statistically tested, ns indicates no significant difference, and ** and ## indicate extremely significant differences with P < 0.01).

[0028] Figure 7 The results of SA-β-Gal staining are from the parallel validation experiment of the mul-miRNA-n16 mimic function in Example 5.

[0029] Figure 8 The results of CCK-8 proliferation in the parallel validation experiment of the mul-miRNA-n16 mimic function in Example 5 are shown (the data results were statistically tested, ns indicates no significant difference, and ** and ## indicate extremely significant differences and P < 0.01). Detailed Implementation

[0030] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be described in detail below with reference to specific embodiments. However, it should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention. The scope of protection defined in the claims should be the legal scope of protection of this invention.

[0031] Unless otherwise specified in the embodiments, the methods are all routine operations well known to those skilled in the art, such as miRNA transfection, qPCR detection, CCK-8 detection, SA-β-Gal staining, cell scratch assay, and establishment of animal trauma models, all of which can be performed in accordance with publicly available experimental procedures or commercial kit instructions.

[0032] The miRNA transfections described in the examples were all performed using conventional methods, and the transfection reagent used was Lipofectamine 3000.

[0033] miRNA source and literature support:

[0034] The mul-miRNA-n16 described in this invention is derived from deep sequencing data of miRNAs from the plant mulberry (Morus atropurpurea Roxb.). This miRNA was first reported as one of the plant endogenous miRNAs in the following published literature: "MicroRNA Profiling During Mulberry (Morus atropurpurea Roxb) Fruit Development and Regulatory Pathway of miR477 for Anthocyanin Accumulation" ([J]. Frontiers in Plant Science, 2021.).

[0035] In this invention, the artificially synthesized miRNA was used for the first time in mammalian cells and animal models. A series of experimental results verified its significant anti-aging and tissue repair functions, revealing for the first time the potential biological application value of this plant miRNA across species.

[0036] In this invention, the "U" included in the sequence information of miRNA is represented by "T" in the readable sequence listing.

[0037] The miRNA described in this invention may include the following different molecular forms:

[0038] 1. Mature form (body): A synthetically produced single-stranded miRNA with the sequence identical to SEQ ID No:1, featuring 3' end 2'-O-methylation modification to mimic the natural structure of plant miRNAs. The body form is used in the cell experiments of this invention, exhibiting good transfection efficiency and biological activity.

[0039] 2. Mimics: Based on the original RNA, full-strand 2'-O-methylation and multi-site cholesterol modification are introduced to construct double-stranded RNA, enhancing its in vivo stability and tissue penetration. This form was used in animal experiments of this invention, and cell experiments have confirmed its bioequivalence to the original RNA.

[0040] 3. Pre-miRNA Form: Because pre-miRNA can be processed into mature miRNA by Dicer enzymes in cells, it possesses natural delivery and expression advantages and has the potential to be a candidate form for nucleic acid drugs. It should be noted that the pre-miRNA form itself does not directly exert anti-aging effects, but rather serves as a precursor structure of mature mul-miRNA-n16, which is processed by the Dicer enzyme in cells to produce a functional mature chain. Since the mature mul-miRNA-n16 chain has already demonstrated its anti-aging effect through in vitro functional experiments in this invention, the pre-miRNA form can be considered another form of its expression and delivery, possessing the same functional basis, and is one of the common nucleic acid conformation choices in drug development. Existing research shows that the pre-miRNA expression system can efficiently generate mature miRNA in cells and exert its biological functions (Reference: Zeng & Cullen, RNA (2003), 9:112–123.).

[0041] Example 1: Artificially synthesized mul-miRNA-n16 and its mimics

[0042] miRNA molecule ontology: This invention aims to develop a structurally stable, persistently expressed miRNA molecule with anti-aging activity.

[0043] The miRNA molecule provided by this invention is mul-miRNA-n16, and its nucleotide sequence is: 5'-UUCCAAAUCCACCCAUGCCCAC-3' (SEQ ID No:1). It can be expressed as a mature strand or a precursor form, and is derived from mulberry tissue or obtained through artificial synthesis.

[0044] The mature nucleotide sequence of mul-miRNA-n16 is as follows:

[0045] 5'-UUCCAAAUCCACCCAUGCCCAC -3'

[0046] The nucleotide sequence of the mul-miRNA-n16 precursor (or simply pre-miR-n16) is as follows:

[0047] 5'-AUAUAUAUAUAUAUAUAUAUAUGACUUGACUGAGAUGAAUAAGGGAA

[0048] AGAGAGAAGCCUGAGGAAAUUGUGGGCAUGGGUGGAUUUGGAAGGAGAACUAAAUUAAAACAUACAAUUAUAAUAUCAAUUAAGUGAACAAAA-3' (SEQ ID No: 2)

[0049] The precursor sequence (pre-miRNA) of this precursor sequence is derived from the region of chromosome 14 of mulberry (Morus alba) (GenBank: CP050237.2: 6828074–6828215). This precursor sequence can form a typical stem-loop structure in RNAfold analysis, can be recognized and processed into mature miRNA by the intracellular Dicer enzyme, and has a typical stem-loop structure, making it suitable for the design of subsequent delivery and expression systems.

[0050] The sequence of the mimic of mul-miRNA-n16 (mul-miR-n16 mimic) described in this invention is as follows:

[0051] Justice Chain (guide strand): 5'- UUCCAAAUCCACCCAUGCCCAC -3' (SEQ ID No: 3, consistent with mature chain)

[0052] Passenger strand: 5'- GUGGGCAUGGGUGGAUUUGGAA -3' (SEQ ID No:4)

[0053] Note: Designed according to the principle of base complementarity, and two oxidative modified nucleosides (such as dTdT) can be added to the 5' or 3' end to improve stability.

[0054] This invention further chemically modifies the mul-miRNA-n16 mimic to improve its in vivo stability and cellular uptake efficiency. Modifications to the mimic include, but are not limited to, 2'-O-methyl modification (2'-OMe), 3'-terminal modification (including cholesterol modification), phosphate backbone thioate modification (PS), locked nucleic acid modification, or peptide nucleic acid modification. Specifically, the 2'-O-methyl modification (2'-OMe) modifies the ribosome positions (i.e., positions 1–22) of the entire 22 nt sequence to enhance the nucleic acid molecule's resistance to nuclease degradation; the 3' end modification (including cholesterol modification) involves attaching a methoxy (OCH3) or cholesterol (Cholesteryl) group to the 3' end at position 22 to improve membrane permeability and in vivo half-life; the phosphate backbone thioate modification (Phosphorothioate, PS) modifies the phosphodiester bond between positions 1–2 and 18–21, enhancing nucleic acid stability by replacing oxygen with sulfur; and the locked nucleic acid (LNA) or peptide nucleic acid (PNA) modification introduces locked nucleic acid (LNA) or peptide nucleic acid (PNA) units into certain bases (such as positions 10–12) or terminal sites to enhance targeting binding efficiency.

[0055] Preferably, the mimetic of mul-miRNA-n16 in this invention employs the following combination of modifications: full-chain 2'-O-methyl modification, thiomodification of the phosphate backbone at positions 1–2 and 18–21, and 3' terminal cholesterol modification.

[0056] The mul-miRNA-n16 used in the embodiments of the present invention is a plant miRNA derived from mulberry (Morus alba) tissue, which can be obtained through artificial synthesis or in vitro transcription.

[0057] (1) Artificial synthesis method: Based on the known mature chain sequence, the artificial chemical synthesis is carried out by a commercial synthesis company (such as GenePharma or a synthesis platform such as IDT) with a purity of ≥98% and purified by HPLC.

[0058] (2) In vitro transcription method: an expression vector containing the mul-miRNA-n16 precursor sequence was constructed, and in vitro transcription was performed using T7 RNA polymerase. The RNA was then purified by RNA gel electrophoresis and column chromatography (such as DEAE column).

[0059] All mul-miRNA-n16 used in this invention were obtained artificially and were used in functional verification experiments.

[0060] Example 2: Overexpression of mul-miRNA-n16 alleviates phenotypic changes in senescent cells

[0061] The miRNA used in this embodiment is mul-miRNA-n16, an artificially synthesized single-stranded RNA with natural 2'-O-methylation modification, mimicking the modification state of plant-derived miRNAs, i.e., the sequence shown in SEQ ID No: 1.

[0062] (1) Experimental methods

[0063] Human skin fibroblasts (HFF-1) were purchased from the Shanghai Cell Bank (Cat#SCSP-109), and mouse skin fibroblasts (3T6) were purchased from the Shanghai Cell Bank (Cat#GNM1). Cells were cultured in DMEM high-glucose medium (containing 10% FBS), 5% CO2, at 37°C before and during the experiments.

[0064] Model building:

[0065] Natural aging model: HFF-1 cells were continuously passaged to the P27 generation. The cells became larger and flatter, and the proliferation rate decreased significantly, which met the criteria for a natural aging model. Therefore, this model is considered a natural aging model. For details, see: Haga, M., Iida, K., & Okada, M. (2024). Positive and negative feedback regulation of the TGF-β1 explains two equilibrium states in skin aging. iScience, 27(5), 109708.

[0066] H2O2-induced senescence model: HFF-1 cells were used to establish a senescence model using the H2O2-induced method. HFF-1 cells were continuously passaged to P16 and then treated with 150 μM H2O2 for 2 hours to obtain the H2O2-induced senescence model. For details, please refer to: Dasari, A., Bartholomew, JN, Volonte, D., & Galbiati, F. (2006). Oxidative stress induces premature senescence by stimulating caveolin-1 gene transcription through p38 mitogen-activated protein kinase / Sp1-mediated activation of two GC-rich promoter elements. Cancer research, 66(22), 10805–10814.

[0067] Natural aging model grouping: young control group (P16) is HFF-1 cells passaged to the 16th generation; aging control group (P27-blank) is HFF-1 cells passaged to the 27th generation; aging mock treatment group (P27-mmNC) is the above-mentioned 27th generation HFF-1 cells transfected with negative control miRNA (mmNC). The transfected miRNA uses a commercially available universal negative control sequence (mmNC: 5'-UCACAACCUCCUAGAAAGAGUAGA-3' (SEQ ID No: 5)), which has been verified to have no biological activity, and has been methylated at the corresponding site to mimic endogenous plant miRNA; aging experimental group (P27-mmn16) is the above-mentioned 27th generation HFF-1 cells transfected with mul-miRNA-n16.

[0068] The H2O2-induced senescence model was divided into three groups: Blank control (untreated 16th generation HFF-1 cells), Model group (H2O2) (pretreated 16th generation HFF-1 cells with H2O2), Negative control group (mmNC) (pretreated 16th generation HFF-1 cells with H2O2 and transfected with negative miRNA (i.e., the miRNA transfected in the cells used a commercially available universal negative control sequence, which has been verified to have no biological activity and has been methylated at the corresponding site to simulate endogenous plant miRNA), and Experimental group (mmn16) (pretreated 16th generation HFF-1 cells with H2O2 and transfected with mul-miRNA-n16 (with 3' end 2'-O-methylation modification).

[0069] The miRNAs (including mul-miRNA-n16 and negative miRNAs) were mixed with the transfection reagent Lipofectamine 3000.

[0070] In both models, the mixed solution of the above miRNA and the transfection reagent Lipofectamine 3000 was added dropwise to the cells for transfection. The transfection time was 48 hours to ensure that the final concentration of miRNA in the cells was 50mM. The cells in the other groups were cultured for the same time. After the transfection, SA-β-Gal staining was performed to observe the proportion of blue positive cells.

[0071] (2) Experimental results

[0072] In the natural aging model and the H2O2-induced aging model, the P27-mmn16 group and the mmn16 group showed a significantly reduced proportion of blue-stained cells after SA-β-Gal staining compared to other groups. Figure 1 This suggests that the senescence phenotype of cells was alleviated in the P27-mmn16 group and the mmn16 group, meaning that mul-miRNA-n16 can inhibit the cellular senescence process.

[0073] Example 3: mul-miRNA-n16 promotes the recovery of proliferative capacity in senescent cells

[0074] This embodiment uses the H2O2-induced senescence model established in Example 2 to further evaluate the restorative effect of mul-miRNA-n16 on the proliferative capacity of cells after oxidative damage (i.e., senescence). The miRNA used is mul-miRNA-n16, an artificially synthesized single-stranded RNA with a 2'-O-methylation modification at the 3' end, mimicking the natural modification state of plant-derived miRNAs.

[0075] (1) Experimental methods

[0076] HFF-1 cells were purchased from the Shanghai Cell Bank (Cat# SCSP-109), Chinese Academy of Sciences, and cultured under the same conditions as in Example 2. The 16th generation HFF-1 cells were treated with 150 μM H2O2 for 2 hours to obtain an H2O2-induced senescence model; immediately after treatment, the culture medium was replaced with fresh medium, and the following experimental groups were set up:

[0077] Blank: Blank control group, 16th generation HFF-1 cells that were not treated with H2O2.

[0078] H2O2 group: Model group, 16th generation HFF-1 cells after H2O2 treatment.

[0079] mmNC group: negative control group, transfected with negative miRNA after H2O2 treatment.

[0080] mmn16 group: experimental group, transfected with mul-miRNA-n16 after H2O2 treatment.

[0081] Cells were transfected with mul-miRNA-n16 or negative miRNA (final concentration in cells: 50 nM) for 48 hours. All other groups were cultured for the same time. Cell viability was then assessed using a CCK-8 cell counting kit (Beyotime). Cells from each group were seeded in 96-well plates, with CCK-8 working solution added to each well. After incubation for 1 hour, absorbance (OD450) was measured at 450 nm, and a cell viability bar chart was plotted.

[0082] (2) Experimental results

[0083] like Figure 2 As shown, cell viability decreased significantly after H2O2 treatment, while the OD450 value of the experimental group (mmn16 group) was significantly higher than that of the model group (H2O2 group) and the negative control group (mmNC group), and close to the level of the blank control group, indicating that mul-miRNA-n16 has the effect of restoring the proliferative capacity of cells after oxidative stress damage (i.e., senescence).

[0084] Example 4: The effect of mul-miRNA-n16 on promoting wound repair in animal experiments

[0085] This embodiment aims to verify the repair ability of mul-miRNA-n16 at the skin tissue level and to preliminarily explore its application potential in the fields of skin aging intervention and tissue regeneration.

[0086] The mul-miRNA-n16 used in the animal experiments of this embodiment is a mimic, designed based on the mul-miRNA-n16 ontology (SEQ ID No:1). It features a full-chain 2'-O-methyl modification, a phosphate backbone thiomodification between positions 1-2 and 18-21, and a cholesterol group attached to the 3' end at position 22 to enhance its nuclease tolerance, tissue penetration, and in vivo stability. This mimic was custom-synthesized by GenScript, dissolved in RNase-free buffer at a storage concentration of 20 μM, and diluted to a working concentration of 10 μM with sterile physiological saline before use.

[0087] (1) Grouping information

[0088] The experimental animals were male BALB / c nude mice (6–8 weeks old, 18–20 g), purchased from Changzhou Cavens Laboratory Animal Co., Ltd. (License No.: SCXK(Su)2021-0013). Mice were acclimatized for 7 days prior to the experiment at an ambient temperature of 22±2℃ with a 12-hour light-dark cycle and free access to water and food. Under anesthesia (sodium pentobarbital, 50 mg / kg intraperitoneally), 6 mm full-thickness circular wounds were prepared on both sides of the midline of the mouse's back.

[0089] The random groups are as follows (n=8):

[0090] Control group (blank): Intraperitoneal injection of normal saline;

[0091] Experimental group (Mmn16): Intraperitoneal injection of mul-miRNA-n16 mimic solution.

[0092] (2) Administration method

[0093] The experimental group received an intraperitoneal injection of 200 μL of a 10 μM working concentration simulant solution every two days (days 1, 3, 5, and 7), for a total of four times. The control group received an intraperitoneal injection of the same volume of physiological saline.

[0094] (3) Wound monitoring and data collection

[0095] Wound images were taken on days 1, 3, 5, and 7. The wound area was measured using ImageJ software, and the healing rate was calculated as follows: Healing rate = ((Initial area - Area on day 7) / Initial area) × 100%

[0096] (4) Experimental results

[0097] The results are as follows Figure 3 As shown, Figure 3 The images show representative images of each group on days 1, 3, 5, and 7. As can be seen from the images, the average wound area of ​​the mice in the experimental group decreased by about 35% on day 7, while that in the control group decreased by only 18%. This shows that the healing in the experimental group was significantly better than that in the control group, suggesting that mul-miRNA-n16 has a good skin repair promoting effect.

[0098] Although the animal experiments used a mimic of mul-miRNA-n16 that underwent full-chain methylation and multi-site cholesterol modification, subsequent cell experiments validated the bioactivity of this mimic. The results showed that it exhibited the same functional performance as the native mul-miRNA-n16 in anti-aging and proliferative effects, constituting bioequivalence. Therefore, this mimic can serve as an equivalent implementation of the native mul-miRNA-n16 in vivo, demonstrating that mimics of mul-miRNA-n16 also possess anti-aging effects.

[0099] Example 5: Multidimensional verification experiment of the anti-aging effect of mul-miRNA-n16

[0100] To comprehensively evaluate the anti-aging effects and mechanisms of mul-miRNA-n16, the present invention conducted the following auxiliary experiments, covering aspects such as expression stability at the cellular and animal levels, expression of aging-related genes, and cell migration levels, to further support the feasibility and wide applicability of the technical solution.

[0101] (1) Stability assessment of mul-miRNA-n16 expression (qPCR detection)

[0102] HFF-1 cells were transfected with mul-miRNA-n16 (50 nM) (see Blank and mmn16 groups in Example 3). Total RNA was extracted on days 3, 6, and 9, and qPCR was performed using miRNA-specific primers (miRNA real-time PCR primer kit, purchased from BioMed Biotech, catalog number BK1010). U6 (purchased from BioMed Biotech) was used as the internal control. At the end of the experiment, mice in the experimental group of the animal model in Example 4 underwent tail amputation to collect blood, and total RNA was extracted and detected by qPCR using miRNA-specific primers. U6 was used as the internal control.

[0103] The primer nucleotide sequence for internal reference U6 is as follows:

[0104] U6-Forward-primer: 5'-TGGAACGCTTCACGATTTTGC-3' (SEQ ID No: 6)

[0105] U6-Reverse-primer: 5'-AGAAGATTAGCATGGCCCCTG-3' (SEQ ID No: 7)

[0106] The results are as follows Figure 4 As shown, from Figure 4 As shown in the left image, the intracellular abundance of mul-miRNA-n16 on day 9 after transfection remained above 55% of the intracellular abundance on day 3, indicating that mul-miRNA-n16 expression was stable at the cellular level; from Figure 4 As can be seen in the right image, a significant expression signal was detected in animal tissues on day 20, indicating that mul-miRNA-n16 has good biological stability.

[0107] (2) Analysis of aging-related gene expression (qPCR)

[0108] Total RNA was extracted from cells in each group of the H2O2-induced aging model described in Example 2 after 48 hours of culture. The mRNA expression levels of aging-related genes such as p16, p21, and p53 were detected using qPCR with GAPDH as an internal control.

[0109] The primer nucleotide sequences for GAPDH are as follows:

[0110] Forward-primer: 5'-TGACCTCAACTACATGGTCTACA-3' (SEQ ID No: 8)

[0111] Reverse Primer: 5'-CTTCCATTCTCGGCCTTG-3' (SEQ ID No: 9)

[0112] The results are as follows Figure 5 As shown in the figure, compared with the model group (H2O2), the expression levels of p16, p21 and p53 were significantly decreased in the experimental group cells transfected with mul-miRNA-n16; indicating that mul-miRNA-n16 transfection significantly inhibited the senescence process of cells.

[0113] (3) Cell migration ability detection (scratch test)

[0114] Scratching experiments were conducted in the H2O2-induced HFF-1 senescence model: Scratching experiments were performed on cells from each group in Example 3. Cells transfected / cultured for 48 hours were scratched with a sterile pipette tip, cultured in serum-free DMEM, and the scratch healing was photographed at 0h and 24h. The scratch closure area was measured using ImageJ.

[0115] The results are as follows Figure 6 As shown in the figure, the cells in the experimental group treated with mul-miRNA-n16 showed enhanced migration ability and significantly higher scratch closure area than the negative control group (mmNC) and the model group (H2O2). Compared with the negative control group, the 24-hour healing rate of the cells in the experimental group treated with mul-miRNA-n16 was increased by about 30%, indicating that mul-miRNA-n16 can promote the migration of damaged cells and has the potential for wound repair.

[0116] (3) miRNA morphology description and bioequivalence verification

[0117] The mul-miRNA-n16 used in the cell experiments described in Examples 1–3 of this invention is a synthetic single-stranded miRNA whose sequence is consistent with that of natural plant sources and has 3' end 2'-O-methylation modification.

[0118] The animal experiment (Example 4) used the mul-miRNA-n16 mimic, which is a double-stranded structure with full-chain 2'-O-methyl modification, thiomodification of the phosphate backbone at positions 1–2 and 18–21, and cholesterol modification at the 3' end, to enhance stability and in vivo bioavailability.

[0119] To verify whether the mul-miRNA-n16 mimic has the same anti-aging function as the original, this invention conducted a parallel functional verification experiment at the cellular level.

[0120] Specifically, following the methods described in Examples 2 and 3, a mimetic of mul-miRNA-n16 was transfected into human skin fibroblasts (HFF-1) cells, and the cells were stained using the SA-β-Gal staining method (…). Figure 7 HFF-1 cell senescence level was detected using the CCK-8 assay. Figure 8 Cell proliferation capacity was assessed, and the anti-aging function of the mul-miRNA-n16 mimic was evaluated. The results showed that, compared with the blank control group and the negative control group, the proportion of positive SA-β-Gal staining in cells transfected with the mimic was significantly decreased, and cell proliferation capacity was significantly enhanced. This trend is consistent with the results after transfection with the mul-miRNA-n16 prototype (see...). Figure 1 Right and Figure 2 The results showed a high degree of consistency with the original drug, with statistical significance (p < 0.05). These results indicate that the mimic of mul-miRNA-n16 is bioequivalent to the original drug in anti-aging function and can be used as a substitute for the original drug in subsequent in vivo applications, providing experimental evidence for its development as a functional nucleic acid drug or active ingredient.

[0121] The above experiments comprehensively validated the anti-aging and tissue repair potential of mul-miRNA-n16 from the perspectives of expression stability, gene level, cell behavior, and oxidative stress. All experiments were repeated three times, showing consistent results, and the technical solution has good feasibility and industrial application prospects.

[0122] In summary, different molecular forms of mul-miRNA-n16 can be flexibly selected according to the application scenario. The mature strand and the mimic have been experimentally verified in this invention to have anti-aging and tissue repair effects. The pre-miRNA form, as an extended implementation method, is also within the scope of protection of this invention.

Claims

1. Use of an active ingredient for the preparation of an anti-aging product, characterized in that, The active ingredient includes mul-miRNA-n16, mul-miRNA-n16 precursor, mimic of modified or unmodified mul-miRNA-n16; the nucleotide sequence of the mul-miRNA-n16 is shown as SEQ ID No:

1.

2. Use according to claim 1, characterized in that, The nucleotide sequence of the mul-miRNA-n16 precursor is shown as SEQ ID No:

2.

3. Use according to claim 1, characterized in that, The mimic of the mul-miRNA-n16 comprises a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown as SEQ ID No: 3, and the nucleotide sequence of the antisense strand is shown as SEQ ID No:

4.

4. Use according to claim 3, characterized in that, The modification includes one or more of methylation modification, cholesterol modification, phosphor backbone thio modification, peptide nucleic acid modification or locked nucleic acid modification.

5. Use according to claim 4, characterized in that, The methylation modification includes modification using 2'-O-methyl.

6. Use according to claim 1, characterized in that, The anti-aging product includes a product for inhibiting cell aging process, relieving aging of mammalian skin tissue, improving activity of skin fibroblast, promoting repair of skin tissue, or improving functional degradation state caused by aging.

7. An anti-aging product, characterized in that, The product includes mul-miRNA-n16, mul-miRNA-n16 precursor, mimic of modified or unmodified mul-miRNA-n16; the nucleotide sequence of the mul-miRNA-n16 is shown as SEQ ID No:

1.

8. The product of claim 7, wherein, The product includes an external use product and an internal use product.

9. The product of claim 8, wherein, The external use product includes a medical device, a biomaterial, a tissue engineering product or a cosmetic.

10. The product of claim 8, wherein, The internal use product includes a drug or a health product.

Images