Frozen soil mucor strain and application thereof in microbial insecticide

By isolating and identifying the frozen soil strain MG of Mucor for use as a microbial insecticide, the ecological safety problem of the larch looper pest, Yashtip yass, has been solved, and effective biological control of lepidopteran pests has been achieved. It has rapid pathogenicity and environmental adaptability, and is suitable for green control in cold and temperate forest areas.

CN121343779APending Publication Date: 2026-01-16INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511689664.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-18
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Existing technologies pose ecological safety issues in controlling the larch looper moth, the use of chemical pesticides leads to environmental pollution and pesticide resistance in target pests, and the potential of insect pathogenic fungal resources for the biocontrol of other groups is insufficient.

Method used

A strain of *Mucor* MG was isolated and identified for use in microbial insecticides. It was used to treat lepidopteran pests by spore spraying. Pathogenicity was determined by combining morphological and molecular biological methods, demonstrating its pathogenicity against beet armyworm larvae and larch looper moth.

Benefits of technology

The Mucor strain MG in frozen soil showed a significant lethal effect in indoor experiments, with a pathogenicity rate similar to that of nucleopolyhedrovirus, demonstrating good potential for biocontrol. It also maintains stable pathogenicity in natural environments, making it suitable for green control in cold-temperate forest areas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121343779A_ABST
    Figure CN121343779A_ABST
Patent Text Reader

Abstract

The invention discloses a tundra mucor strain and application thereof in a microbial insecticide, and relates to the technical field of tundra mucor strain and insecticide application, the tundra mucor strain is separated from naturally infected larch ascochis Djak, is preserved in China General Microbiological Culture Collection Center (CGMCC) on August 11, 2025, and has the preservation number of CGMCC NO.9687. The invention also discloses a preparation method of the tundra mucor strain and application of the tundra mucor strain in a microbial insecticide, and the preparation method of the tundra mucor strain and application of the tundra mucor strain in the microbial insecticide. The preservation number is CGMCC (China General Microbiological Culture Collection Center According to the permafrost mucor strain and the application thereof in the microbial insecticide, the permafrost mucor strain MG is separated from the bodies of the larch Ya's larva inchworm which is naturally dead in the field, and the permafrost mucor strain MG is identified by using systematic morphology and molecular biology methods. Before, domestic and foreign literatures do not systematically report the pathogenicity and prevention and control potential of the permafrost mucor on the forest pests, and the research fills the blank of related research in the field of forestry pathogenic fungi.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of frozen soil Mucor strains and pesticide application technology, and more specifically to a frozen soil Mucor strain and its application in microbial pesticides. Background Technology

[0002] Lepidoptera insects are among the most important pests in agricultural and forestry ecosystems, characterized by their diversity, wide distribution, and high reproductive capacity. Inchworms are one of the most destructive groups within Lepidoptera, posing a threat to the stability of forest ecosystems. Among them, the Yashtwig inchworm (Larix yakinieri) is a notable example. Erannis jacobsoni Djak is a major coniferous pest in the larch forests of the Mongolian Plateau, and its outbreaks have been continuous and rapidly expanding in recent years. Due to the suitable ecological conditions for its survival in the Greater Khingan Mountains of my country, this insect poses an extremely high risk of invasion and has become a key target for monitoring and control of invasive forest pests.

[0003] Currently, the control of the larch looper mainly relies on chemical pesticides, but this poses ecological safety issues, such as environmental pollution, damage to non-target organisms, and increased pesticide resistance in target pests. Insect pathogenic fungi, on the other hand, are a class of microbial resources with significant potential for biocontrol and are widely used in agricultural pest control. For example, *Beauveria bassiana* (… Beauveria bassiana ), Metarhizium anisopliae ( Metarhizium anisopliae These fungi, such as Deuteromycotina, have been widely used in the control of agricultural pests and diseases. However, most of these fungi originate from the Deuteromycotina subphylum, and their potential for biocontrol of other fungal groups remains largely untapped.

[0004] Mucor (Frozen soil) Mucor hiemalis It belongs to the phylum Mucoromycota, order Mucorales, and genus Mucomycetes. Mucor *[unclear text - likely a fungus name]* is a typical saprophytic or opportunistic pathogenic fungus widely distributed in nature. Studies have shown that it has some pathogenicity against certain Lepidoptera and Diptera insects, including the cabbage looper ([unclear text - likely a specific insect name]). Mamestra brassicae ), Fennel-winged moth ( Evergestis extimalis Mediterranean fruit fly ( ) Ceratitis capitata ) and leek-eye fungus ( Bradysia odoriphaga )wait.

[0005] However, to date, there have been no reports on the systematic application of *Mucor* strains in the control of inchworm pests, especially the *Larix yasne* inchworm. This study is the first to isolate a *Mucor* strain MG from naturally infected *Larix yasne* inchworm mummies in the larch forests of the Mongolian Plateau. The strain was systematically identified using morphological and molecular biological methods, and its infectivity was verified under natural conditions.

[0006] To evaluate the application potential of this strain in the development of biocontrol agents, this study used the beet armyworm (Spodoptera litura) as an example. Spodoptera exigua Second-instar larvae were used as an indoor experimental model for virulence testing, with beet armyworm nucleopolyhedrovirus (SeMNPV) as a control. The results showed that strain MG exhibited significant lethal effects on beet armyworm larvae under various concentration conditions, with pathogenicity and mortality rates similar to those of SeMNPV, demonstrating good potential and application prospects for biocontrol.

[0007] This invention represents the first systematic exploration of the application of *Mucor* fungi in the control of lepidopteran insects, enriching the resource map of insect pathogenic fungi and providing a potentially applicable new green control method for cold-temperate forest areas, with good prospects for promotion and application. Summary of the Invention

[0008] The purpose of this invention is to address the problems mentioned in the background section by providing a frozen soil Mucor strain and its application in microbial insecticides.

[0009] To achieve the above objectives, the present invention specifically adopts the following technical solution: A strain of *Mucorhiemalis* and its application in microbial insecticides, comprising the strain being *Mucorhiemalis*, isolated from naturally infected *Erannis jacobsoni* Djak, and deposited on August 11, 2025 at the China General Microbiological Culture Collection Center, with accession number CGMCCNo.42160.

[0010] As with the same inventive concept as the above-mentioned technical solution, the present invention also claims protection for the application of a microbial insecticide, using the aforementioned frozen soil Mucor strain, and the lepidopteran pests being the larch looper and the beet armyworm (Spodoptera exigua).

[0011] Preferably, the spore concentration in the microbial insecticide is 1×10⁻⁶. 7 Up to 1×10 8 Spores / mL, containing 0.05% Tween 80 as a dispersant.

[0012] As the same inventive concept as the above technical solution, the application also claims a detection method of the frozen soil mold strain, which comprises the following steps of: S1. Isolation and purification of pathogenic fungi: pathogenic fungi are isolated from the dead body of Euhrydria aurantiaca, the surface of the body is sterilized, and then inoculated on a PDA culture medium plate and cultured at 25 DEG C for 5 days, after which the colonies are white to grayish white and appear black spore sacs; S2. Molecular biology identification of pathogenic fungi: genomic DNA of a single strain is extracted, and universal fungal ribosomal internal transcribed spacer primers ITS1 and ITS4 are used for PCR amplification, and after the PCR product is sequenced, sequence comparison and analysis are performed with the GenBank database sequence; S3. Pathogenicity determination of pathogenic fungi: the purified frozen soil mold strain MG is inoculated on a PDA culture medium and cultured at 25 DEG C for 5 days, after which spores are eluted with sterile water containing 0.05% Tween 80, the mycelium is removed by filtration, and the spore concentration is adjusted to 1×10 8 Spores / mL as an original spore suspension, the spore suspension is sprayed on 2nd instar beet armyworm larvae, the mortality and survival time of each treatment group are recorded, the frozen soil mold spore suspension is sprayed in a Mongolian Larix gmelinii forest, and after 7 days, the naturally dead Euhrydria aurantiaca larvae are recovered, and the pathogenic fungi are isolated and cultured, and the isolated fungi are morphologically and molecularly identified with the initial frozen soil mold strain MG.

[0013] Preferably, in the pathogenicity determination of pathogenic fungi, gradient dilution method is used to prepare spore suspensions with different concentrations, such as 1×10 8 Spores / mL, 1×10 7 Spores / mL, 1×10 6 Spores / mL, and 1×10 5 Spores / mL.

[0014] Compared with the prior art, the application has the following beneficial effects: 1. The frozen soil mold strain MG is isolated from the naturally dead body of Euhrydria aurantiaca in the field, and systematic morphological and molecular biological methods are used for identification. Prior to this, no domestic or foreign literature has systematically reported the pathogenicity and control potential of the frozen soil mold against the forest pest, which fills the research gap in the field of forestry pathogenic fungi.

[0015] 2. In the indoor pathogenicity experiment, the strain MG exhibits excellent virulence against the lepidopteran pest beet armyworm, and the half lethal time (LT 7 50) of the beet armyworm at a concentration of 1×10 50) was 5.13 days, which indicated that the strain had a faster pathogenic rate and a good biological control potential. Meanwhile, the strain could be repeatedly isolated from the dead larvae of the larch caterpillar under the natural conditions of the Mongolian larch forest area after inoculation, which confirmed that it still had stable pathogenic ability and environmental adaptability in the low-temperature and high-humidity environment, and was an effective natural pathogen of the larch caterpillar.

[0016] 3. The strain of M. psychrotolerans MG is derived from fungal resources in the natural environment, and has good ecological safety. The strain has no toxic effects on humans and livestock, has less impact on non-target insects, can effectively reduce the use frequency of traditional chemical pesticides, avoid pesticide residues and drug resistance risks, and meets the policy requirements of current green prevention and control of forest pests and ecological forestry construction.

[0017] 4. The strain shows rapid growth, strong adaptability, and high spore yield, and can be produced on a large scale by means of liquid fermentation or solid fermentation. It has the technical conditions to develop into a biological pesticide preparation (such as freeze-dried powder, wettable powder, granules or spray, etc.), and is suitable for rapid emergency prevention and control and daily monitoring intervention during the occurrence period of Lepidoptera pests, and has a wide application prospect and significant economic and ecological value. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Molecular biological identification of the larch caterpillar cadaver and the pathogenic fungus; Figure 2 Colony morphology of the strain on PDA medium and microscopic characteristics of spores and mycelium thereof; Figure 3 Pathogenicity of different concentrations of spore suspension of M. psychrotolerans MG to 2nd instar larvae of Spodoptera exigua; Figure 4 Pathogenicity of different concentrations of nucleopolyhedrovirus to 2nd instar larvae of Spodoptera exigua; Figure 5 Repeated isolation and identification of the pathogenic fungus from the cadaver after applying M. psychrotolerans in the forest land. DETAILED DESCRIPTION

[0019] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0020] The materials and instruments used in the following examples are commercially available.

[0021] APPENDIX Figure 1Molecular biological identification of *Larix yasne* looper moth and its pathogenic fungus. A. *Larix yasne* looper moths collected in the field; B. Genomic DNA extraction from the isolated strain; C. PCR amplification results of the strain's ITS sequence.

[0022] Appendix Figure 2 : Colony morphology of the strain on PDA medium and the microscopic characteristics of its spores and hyphae. A. Front morphology of *Mucor* strain colony on PDA medium; B. Back morphology of the same colony; C. Spore morphology of *Mucor* strain observed under an optical microscope; D. Hyphae and spore structure observed under an optical microscope.

[0023] Appendix Figure 3 The pathogenicity of different concentrations of Mucor MG spore suspensions in frozen soil to second-instar beet armyworm larvae.

[0024] Appendix Figure 4 The pathogenicity of different concentrations of nucleopolyhedrovirus (SeMNPV) to second-instar beet armyworm larvae.

[0025] Appendix Figure 5 Repeated isolation and identification of pathogenic fungi from *Mucor hygrophorus* moths after application of *Mucor hygrophorus* to forests. A. *Mucor hygrophorus* moths recovered after application in the forest; B. Culture of *Mucor hygrophorus* moths inoculated on PDA medium; C. Pure cultures of single-colony fungi obtained from isolation.

[0026] Example 1: Isolation and purification of *Mucor* strains from frozen soil: In June 2024, naturally deceased larch looper moths (L. yaksha) were collected from a larch forest in Tsenkher Soum, Arkhangai Province, Mongolia (altitude 1850 meters, geographical coordinates 47°20′24″N, 101°38′58″E). Erannis jacobsoniDjak) larvae samples. After collection, the samples were brought back to the laboratory for pathogenic fungi isolation. The cadavers were sequentially treated with 75% ethanol for 30 seconds, 0.1% sodium hypochlorite solution for 30 seconds, followed by three rinses with sterile distilled water and dried with sterile filter paper. The cadavers were cut into small pieces with sterile scissors and inoculated on PDA medium plates. The PDA medium was prepared as follows: 200 g of peeled potatoes were boiled in about 500 mL of distilled water for 30 minutes, the juice was filtered and the distilled water was made up to 1000 mL; 20 g of glucose and 20 g of agar were added, and the mixture was stirred until homogeneous and autoclaved at 121 °C for 15 minutes. After cooling to an appropriate temperature, an appropriate amount of antibiotic was added to inhibit bacterial contamination. The inoculated plates were incubated in a 25 °C incubator. After the appearance of mycelial growth around the cadavers, fresh mycelium from the edge of the colonies was picked with a sterile inoculation loop and streaked on new PDA plates. After 1 day of incubation, the mycelium from the single colonies that grew was again picked and transferred. This operation was repeated 3 times to obtain a pure single fungal strain. The pure strain obtained was inoculated on PDA slant medium and stored at 4 °C for short-term preservation; at the same time, the conidia and mycelium of the strain were stored in sterile preservation tubes containing 20% glycerol at -80 °C for long-term preservation and subsequent experiments.

[0027] Example II. Morphological observation and molecular biology identification: The pure strain obtained in Example I was inoculated on PDA medium plates and incubated at 25 °C for 5 days. During incubation, the colonies initially appeared as white cottony, then expanded to grayish white, and a large number of black spore sacs were observed at the late stage of incubation. This isolated strain was named Mucor hiemalis strain MG. The morphological characteristics of the strain were observed using an optical microscope, and the results showed that the mycelium was non-septate with well-developed branches; the spore morphology was mainly oval and spherical, arranged tightly and uniformly in size.

[0028] Freshly frozen soil Mucor MG mycelium cultured for 5 days was selected, placed in a sterile mortar, and added with liquid nitrogen to grind into fine powder. About 50 mg of mycelium powder was transferred to a 2 mL sterile centrifuge tube, and genomic DNA was extracted using a fungal genomic DNA extraction kit (Fungal DNA Mini Kit, Omega Bio-Tek, USA, item number: D3390-02) according to the operation steps of the instruction manual. The ribosomal internal transcribed spacer (ITS) was amplified using universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'). The primers were synthesized by Tsingke Biotechnology Co., Ltd., China. The PCR reaction system (50 μL) included: 5×TransStart FastPfu Buffer (containing Mg²⁺) 10 μL, 2.5 mM dNTP mixture 4 μL, ITS1 and ITS4 primers 1 μL each (10 μmol / L), template DNA 1 μL, TransStart® FastPfu DNA polymerase (TransGen Biotech, China, item number: AP221-02) 1 μL, and ddH2O supplemented to 50 μL. The PCR amplification program was as follows: 95°C pre-denaturation for 2 min; followed by 30 cycles, each cycle including 95°C denaturation for 20 s, 55°C annealing for 30 s, and 72°C extension for 30 s; finally 72°C extension for 5 min, and 4°C storage. The amplified product was verified for band size and purity by 1% agarose gel electrophoresis, and the amplified product was sent to Tsingke Biotechnology Co., Ltd., Beijing for sequencing analysis. The obtained 640 bp ITS sequence was analyzed by BLAST, and the reference sequence similarity with the Mucor perglidis (KF944455.1) in the NCBI database reached 100%, confirming that the strain was Mucor perglidis. The sequencing sequence is shown as SEQ ID NO. 1. Mucor hiemalis

[0029] SEQ ID NO: 1: ​GGGACCTGCGGAAGGATCATTAAATAATTTAGATGGCCTTTGCTAGTTTTCTAGCGAATGGTTCATTCTTTTTTACTGTGAACTGTTTTAATTTTTCAGCGTCTGAGGAATGTCTTTTAGCCATAGGGATAGGCTACTAGAATGTTAACCGAGCTGAAAG TCAGGCTTAGGCCTGGTATCCTATTAATTATTTACCAAAAGAATTCAGTATTATAATTGTAACATAAGCGTAAAAAAACTTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATT GCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCAATGGTATTCCATTGAGCACGCCTGTTTCAGTATCAAAAACACCCCACATTCATAATTTTGTTGTGAATGGAAATGAGAGTTTCGGCTTTATTGCTGAATTCTTTAAAATTATTAG GCCTGAACTATTGTTCTTTCTGCCTGAACATTTTTTTAATATAAAGGAATGCTCTAGTAAAAAGACTATCTCTGGGGCCTCCCAAATAAATCATTCTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Example 3: Pathogenicity determination of indoor pathogenic fungi and viruses: This embodiment aims to evaluate *Mucor* (a type of mold found in frozen soil). Mucor hiemalis MG strain against beet armyworm ( Spodoptera exigua Pathogenicity of second instar larvae, and its relationship with beet armyworm nucleopolyhedrovirus (BET). Spodoptera exigua A comparative analysis was conducted on multiple nucleopolyhedrovirus (SeMNPV).

[0030] After culturing *Mucor MG* strain on PDA plates at 25°C for 5 days, the spores were washed away with sterile water containing 0.05% Tween 80, mycelia were removed by double-layer gauze filtration, and the spore concentration was adjusted to 10 using a hemocytometer. 5 10 6 10 7 and 10 8spores / mL. 2nd instar healthy larvae of H. armigera were used, 30 per group, and 4 treatment groups and 1 Tween water blank control group were set. The test insects were placed in plastic culture dishes and evenly sprayed with spore suspension using a handheld sprayer. After treatment, the insect bodies were naturally air-dried, transferred to clean feeding dishes, and observed under greenhouse conditions (temperature 25 ± 1°C, relative humidity 80%, photoperiod 16L:8D). The cumulative mortality rates on the 3rd, 5th, 7th, and 9th days were continuously recorded, and the lethal time (LT 50 ).

[0031] The SeMNPV virus used was a purified strain stored for a long time in the laboratory, with a clear source and stable pathogenicity. After preliminary purification and quantification, the virus stock was prepared at 1 × 10 8 OBs / mL, and gradient dilution was performed using sterile water to obtain virus suspensions at 10 5 , 10 6 , and 10 7 OBs / mL, with sterile water as a blank control. Each concentration of virus liquid was evenly coated on the surface of 1 cm × 1 cm non-toxic artificial feed blocks, and 2nd instar H. armigera larvae were fed after air-drying, 30 per group, with 3 replicates. Fresh feed was replaced every day, and the feeding conditions were the same as above, and the mortality rates on the 3rd, 5th, 7th, and 9th days were continuously observed and recorded.

[0032] The results showed that both the frozen soil Mucor MG strain and SeMNPV exhibited a significant dose-dependent lethal effect, and the cumulative mortality rate significantly increased with increasing concentration, and the LT 50 was significantly shortened. After 9 days of treatment at high concentration (10 8 spores / mL or OBs / mL), the cumulative mortality rates reached 80.21% and 94.21%, respectively, and the LT 50 was 4.03 days and 3.30 days, respectively. The low concentration group (10 5 spores / mL or OBs / mL) was slower to kill, with a mortality rate of less than 60% within 9 days, and the LT 50 was significantly prolonged. The control group always maintained a low mortality rate (<10%), indicating that the test conditions were stable and natural death had little effect.

[0033] In summary, SeMNPV is superior to the frozen soil Mucor fungus in terms of lethal speed and final mortality rate, but the latter, as a non-specific fungus, still shows strong biocontrol potential. There are significant differences in the mechanisms of action between the two, with the former relying on oral infection and virus replication, and the latter relying on spore invasion and mycelial expansion to kill, with complementary advantages and the possibility of joint application.

[0034] Example Four, Field Verification Experiment: To verify the biocontrol effect of the frozen soil Mucor fungus (M. pruinosa) and SeMNPV in the field, the two were applied to the same field of H. armigera in the same way as in the laboratory experiment, and the cumulative mortality rates on the 3rd, 5th, 7th, and 9th days were continuously recorded. Mucor hiemalisThe pathogenicity and transmission ability of MG strain in natural environment were studied by in situ plot experiment in typical Larix gmelinii forest. The experimental site was selected in the area with clear background of insect infestation and moderate population density of L. gmelinii looper. Three replicates of treatment and control plots were set up, each with an area of 100 m², uniformly distributed in space to avoid cross interference.

[0035] The treatment plots were sprayed with spore suspension of M. psychrotolerans MG strain using a backpack electric sprayer, with a concentration of 1×10 7 spores / mL. The control plots were sprayed with the same amount of 0.05% Tween 80 sterile water. The spraying time was selected in the morning on sunny and windless days to ensure the efficiency of spore settlement and adhesion. After treatment, the natural forest environment was maintained without further interference.

[0036] On the 7th day after treatment, systematic sampling was conducted in each plot. Dead 2nd instar looper larvae were recovered from the ground and branches and leaves in the treatment plots. All diseased individuals were cultured under sterile conditions, the obtained colonies were purified on PDA medium, and genomic DNA was extracted, and the ribosomal internal transcribed spacer (ITS) was amplified and sequenced using ITS1 / ITS4 universal primers.

[0037] Sequence alignment results showed that the fungal strains repeatedly isolated from the recovered insect bodies in the treatment plots were completely consistent with the ITS sequence of M. psychrotolerans MG strain used in the experiment, with a sequence similarity of 100%, and no other species matched in GenBank comparison.

[0038] This result clearly shows that M. psychrotolerans MG strain has the ability to infect and cause death of L. gmelinii looper in the natural environment of forest. Moreover, its spores can survive in the external environment and can be transmitted by insects to achieve reinfection, with certain diffusion ability and ecological adaptability in forest. This characteristic provides a theoretical basis and practical support for its application as a biological control agent.

Claims

1. A strain of Geomyces pannorum, characterized in that, The strain is Mucor hiemalis, isolated from naturally infected Erannis jacobsoni Djak, and preserved in China General Microbiological Culture Collection Center on August 11, 2025, with a preservation number of CGMCC No. 42160.

2. Use of a microbial insecticide, characterized in that, The lepidopteran pest is Erannis jacobsoni and Spodoptera exigua.

3. The use of a microbial insecticide according to claim 2, characterized in that, The concentration of spores in the microbial insecticide is 1 x 10 7 to 1 x 10 8 spores / mL with 0.05% Tween 80 as dispersing agent.

4. A method for detecting a strain of Geomyces virens, characterized by, The detection of the Mucor hiemalis strain of claim 1 comprises the following steps: S1. Isolation and purification of the pathogenic fungus: the pathogenic fungus is obtained by isolation from the Erannis jacobsoni mummy, the surface of the mummy is subjected to disinfection treatment, and then inoculated on a PDA culture medium plate and cultured at 25 DEG C; after 5 days of culture, the colony is white to grayish white cottony, and black spore sacs appear; S2. Molecular biology identification of the pathogenic fungus: the genomic DNA of a single strain is extracted, universal fungal ribosomal internal transcribed spacer primers ITS1 and ITS4 are used for PCR amplification, and after the PCR product is sequenced, sequence comparison analysis is performed with the GenBank database sequence. S3. Pathogenicity determination of pathogenic fungi: purified M. glacialis strain MG was inoculated in PDA medium and cultured at 25℃ for 5 days. After the end of the culture, spores were eluted with sterile water containing 0.05% Tween 80, mycelium was removed by filtration, and the spore concentration was adjusted to 1 x 10 8 Spores / mL as the original spore suspension. The 2nd instar larvae of Spodoptera exigua were treated with spore suspension by spraying, and the mortality and survival time of each treatment group were recorded. M. glacialis spore suspension was sprayed in Mongolian Larix gmelinii forest land, and naturally dead L. gmelinii caterpillars were recovered after 7 days. Pathogenic fungi were isolated and cultured, and the isolated fungi were morphologically and molecularly identified with the initial M. glacialis strain MG.

5. The method of claim 4, wherein the Mucor hiemalis strain is characterized by, In the pathogenicity determination of the S3 pathogenic fungi, gradient dilution method was used to prepare spore suspensions with different concentrations, with the concentration being one of 1 x 10 8 spores / mL, 1 x 10 7 spores / mL, 1 x 10 6 spores / mL, 1 x 10 5 spores / mL.