Construction method for antibacterial peptide CLP1 saccharomyces cerevisiae surface display

Abstract

The invention discloses a construction method of antibacterial peptide CLP1 saccharomyces cerevisiae surface display, which comprises the following steps: step 1, modifying saccharomyces cerevisiae CENPK2, inserting and integrating a Gal1p-AGA1-CYC1t-URA3 expression cassette at a saccharomyces cerevisiae AGA1 gene through homologous double exchange, and constructing a surface display host CENPK2-AGA1-URA3; step 2, constructing an antibacterial peptide CLP1 expression plasmid CLP1 in pYD1 with EK containing an EK cutting site, and constructing an expression plasmid CLP1 in pYD1 with EK containing the EK cutting site; step 3, transferring the expression plasmid into a surface display host CENPK2-AGA1-URA3 through an electric conversion method, so as to obtain a saccharomyces cerevisiae surface display strain of the antibacterial peptide CLP1; a saccharomyces cerevisiae surface display host is accurately constructed through a homologous double exchange technology, multi-fragment efficient seamless cloning is realized, and an antibacterial peptide CLP1 yeast surface display system containing an EK cleavage site is realized.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, and particularly relates to a construction method of surface display of an antibacterial peptide CLP1 in Saccharomyces cerevisiae. BACKGROUND

[0002] Antibacterial peptides are a class of small molecular polypeptides with broad-spectrum antibacterial activity, which show unique advantages in the field of anti-infection treatment. Compared with traditional antibiotics, they have diverse targets, are not prone to drug resistance, have strong penetration of biofilms, and can quickly kill pathogenic microorganisms. Some antibacterial peptides also have immunomodulatory functions. These characteristics make antibacterial peptides a potential substitute for antibiotics. Among them, antibacterial peptide CLP1, as a derivative peptide of CLP, is composed of 27 amino acids and has a molecular weight of 3.6 kDa. It shows antibacterial activity against both gram-negative bacteria and gram-positive bacteria.

[0003] However, the clinical application of antibacterial peptides still faces many challenges, including high production cost, poor stability, and potential cytotoxicity. In view of these problems, the yeast surface display technology provides a new strategy for the research and application of antibacterial peptides. The core of this technology is to anchor the target protein on the surface of yeast cells. Its unique advantages include: the eukaryotic expression system of yeast can support the correct folding and necessary post-translational modification of antibacterial peptides; the natural barrier formed by the yeast cell wall can effectively protect the displayed antibacterial peptides from protease degradation; it can improve the stability and specificity of the target protein, and also simplifies the traditional purification process and reduces the production cost. At present, Saccharomyces cerevisiae has become the most commonly used host for surface display of antibacterial peptides due to its mature genetic manipulation system and excellent expression performance.

[0004] Therefore, the present application modifies Saccharomyces cerevisiae CENPK2, introduces the galactose-induced alpha agglutinin AGA1 subunit gene, obtains the surface display host CENPK2-AGA1-URA3, co-expresses the antibacterial peptide CLP1 with the alpha agglutinin AGA2 subunit, and then realizes the CLP1 on the surface of the expression host. This expression form enhances the stability of the antibacterial peptide and also has the biological activity of inhibiting Escherichia coli and Staphylococcus aureus. Therefore, the present application proposes a construction method of surface display of antibacterial peptide CLP1 in Saccharomyces cerevisiae to solve the problems in the prior art. SUMMARY

[0005] In view of the above problems, the purpose of the present application is to provide a construction method of Saccharomyces cerevisiae surface display of antibacterial peptide CLP1, which precisely constructs a Saccharomyces cerevisiae surface display host through homologous double exchange technology, realizes efficient seamless cloning of multiple fragments through Gibson assembly, successfully develops a Saccharomyces cerevisiae surface display system of antibacterial peptide CLP1 containing EK cleavage site, realizes controllable induction expression of target protein through Gal1 strong promoter, improves the display efficiency and stability of foreign proteins through the natural anchoring mechanism of alpha agglutinin AGA1 / AGA2, guarantees the high success rate of host modification and integration of foreign genes through double screening markers and double vector strategy, and provides convenience for subsequent functional verification and purification by introducing EK protease cleavage site.

[0006] To achieve the purpose of the present application, the present application realizes the following technical scheme: a construction method of Saccharomyces cerevisiae surface display of antibacterial peptide CLP1, comprising the following steps: Step one, the Saccharomyces cerevisiae CENPK2 is modified, and a Gal1p-AGA1-CYC1t-URA3 expression cassette is inserted and integrated at the AGA1 gene of the Saccharomyces cerevisiae CENPK2 through homologous double exchange, to construct a surface display host CENPK2-AGA1-URA3. Step two, an antibacterial peptide CLP1 expression plasmid CLP1 in pYD1 with EK containing EK cleavage site is constructed. Step three, the expression plasmid is transformed into the new surface display host CENPK2-AGA1-URA3 through electroporation, to obtain a Saccharomyces cerevisiae surface display strain of antibacterial peptide CLP1.

[0007] Further improvement lies in that the Gal1p-AGA1-CYC1t-URA3 expression cassette in step one is a plasmid pESC-URA3 as a backbone, an AGA1 gene fragment amplified from the Saccharomyces cerevisiae CENPK2 genome is inserted through Gibson assembly to form a recombinant plasmid pESC-URA3-AGA1, pUC57 is used as a carrier, AGA1 left homologous arm, Gal1p-AGA1-CYC1t-URA3 fragment, URA3 gene and AGA1 right homologous arm are integrated through Gibson assembly to form a recombinant plasmid pUC57-left-AGA1-URA3-right.

[0008] Further improvement lies in that the amplification primers of the AGA1 left homologous arm in step one are Primer 5 and Primer 6, and the amplification primers of the AGA1 right homologous arm are Primer 11 and Primer 12.

[0009] Further improvement lies in that the construction of the expression plasmid CLP1 in pYD1 with EK in step two is to use the synthetic plasmid pPICZaA-HSAD2-D3-CLP1 as a template, use primer Primer 15 and Primer 16 to amplify the CLP1 fragment containing the EK cleavage site, and then insert the CLP1 fragment into the vector pYD1 after double enzyme digestion of Acc65I / PmeI.

[0010] Further improvement lies in that the CLP1 fragment contains an Xpress™ tag and a codon-optimized sequence.

[0011] Further improvement lies in that the specific steps of the electroporation method in step three are as follows: first, prepare the Saccharomyces cerevisiae CENPK2-AGA1-URA3 competent cell, then mix the expression plasmid, the MightyPrep reagent for DNA and the competent cell for culture, and then plate, use a 1M sorbitol solution for cell recovery after transformation, and verify the transformation result through colony PCR.

[0012] Further improvement lies in that the surface display in step three depends on the combination of the AGA1 and AGA2 subunits of the alpha agglutinin AGA1 and AGA2 through a disulfide bond to anchor the CLP1 on the surface of the yeast cell.

[0013] Further improvement lies in that the starting vector of the expression plasmid in step three is the yeast expression display system vector pYD1, which contains a selection marker TRP1, a promoter Gal1, a multiple cloning site and an E. coli selection tag ampR gene element.

[0014] The beneficial effects of the present application are as follows: the present application precisely constructs a Saccharomyces cerevisiae surface display host through homologous double crossover technology, realizes efficient seamless cloning of multiple fragments through Gibson assembly, successfully develops an EK cleavage site-containing antibacterial peptide CLP1 yeast surface display system, realizes controllable induction expression of the target protein through the use of a Gal1 strong promoter, improves the display efficiency and stability of the exogenous protein through the natural anchoring mechanism of the alpha agglutinin AGA1 / AGA2, guarantees a high success rate of host modification and integration of the exogenous gene through a double selection marker and a double vector strategy, and provides convenience for subsequent functional verification and purification through the introduction of the EK protease cleavage site. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The figure is a step flow chart of the present application. Figure 2 The figure is a recombinant plasmid construction diagram of the modified Saccharomyces cerevisiae CENPK2 of the present application. Figure 3 The figure is a colony PCR verification diagram of the modified Saccharomyces cerevisiae CENPK2-AGA1-URA3 of the present application. Figure 4Construction diagram of expression plasmid CLP1 in pYD1 with EK for the present application; Figure 5 Colony PCR verification diagram of expression plasmid CLP1 in pYD1 with EK being introduced into Saccharomyces cerevisiae CENPK2-AGA1-URA3 for the present application; Figure 6 Morphology characterization of Escherichia coli after being treated by CLP1 in pYD1 with EK for the present application; Figure 7 Morphology characterization of Staphylococcus aureus after being treated by CLP1 in pYD1 with EK for the present application. DETAILED DESCRIPTION

[0016] In order to deepen the understanding of the present application, the present application will be further described in detail below in combination with examples, and the present examples are only used to explain the present application and do not constitute a limitation on the protection scope of the present application. EMBODIMENT

[0017] According to Figure 2 , Figure 3 , Figure 4 , Figure 5 , the present embodiment provides a construction method of Saccharomyces cerevisiae surface display of antibacterial peptide CLP1, comprising the following steps: Step one, the Saccharomyces cerevisiae CENPK2 is modified, and a Gal1p-AGA1-CYC1t-URA3 expression cassette is inserted and integrated at the AGA1 gene of the Saccharomyces cerevisiae CENPK2 genome through homologous double crossing over, to construct a surface display host CENPK2-AGA1-URA3. The Gal1p-AGA1-CYC1t-URA3 expression cassette is a recombinant plasmid pESC-URA3-AGA1 formed by Gibson assembly of the AGA1 gene fragment amplified from the Saccharomyces cerevisiae CENPK2 genome, with the plasmid pESC-URA3 as the backbone, and a recombinant plasmid pUC57-left-AGA1-URA3-right formed by Gibson assembly of the AGA1 left homologous arm, Gal1p-AGA1-CYC1t-URA3 fragment, URA3 gene and AGA1 right homologous arm, with pUC57 as the carrier.

[0018] The recombinant plasmid pESC-URA3-AGA1 was constructed using the Saccharomyces cerevisiae CENPK2 genome as a template. Primers Primer1 and Primer2 were designed to amplify the plasmid, obtaining a nucleic acid fragment containing AGA1. Primers were then designed for PCR verification and sequencing of the recombinant plasmid. Specifically, Primer pair Primer1 and Primer2 were used to amplify the 2224 bp length of the Saccharomyces cerevisiae CENPK2 genome and for PCR verification of the recombinant plasmid. The nucleotide sequences are as follows: Primer1, AGA1 in ESC-F (Gib), forward primer, nucleotide sequence: GTCAAGGAGAAAAAACCCCGAAAACAATGACATTATCTTTCGCTCATTTTAC; Primer2, AGA1 in ESC-R (Gib), reverse primer, nucleotide sequence: ATCTTAGCTAGCCGCGGTACTTAACTGAAAATTACATTGCAAGCAAC.

[0019] The primer pair used for sequencing the recombinant plasmid pESC-URA3-AGA1 is Primer3 and Primer4, with the following nucleotide sequences: Primer3 (Gal1-seq, forward primer, nucleotide sequence as shown in SED ID NO.4) AATATACCTCTATACTTTAACGTC; Primer4 (CYC1-seq, reverse primer, nucleotide sequence as shown in SED ID NO.5) GGGACCTAGACTTCAGGTTG.

[0020] The recombinant plasmid pESC-URA3-AGA1 was constructed using the *Saccharomyces cerevisiae* CENPK2 genome as a template. PCR amplification was performed using primers Primer1 and Primer2 and KOD One™ PCR Master Mix. The amplification conditions were: 98℃ for 10 seconds, annealing at 54℃ for 5 seconds, and 68℃ for 13 seconds for 10 cycles; followed by 98℃ for 10 seconds, annealing at 66℃ for 5 seconds, and 68℃ for 13 seconds for 35 cycles. After the reaction, the PCR products were detected by 2% agarose gel electrophoresis. The expected specific band appeared at 2224 bp. The target band was excised and recovered from the gel for vector construction.

[0021] The specific construction method of the pESC-URA3-AGA1 recombinant plasmid is as follows: The plasmid pESC-URA3 was double-digested with BamHI and KpnI. The digestion products were recovered by gel electrophoresis, and the recovered products were assembled with the amplified fragment using the Uniclone One Step Seamless Cloning Kit via Gibson assembly. The ligation product was transformed into *E. coli* Top10 competent cells and cultured overnight at 37°C on LB agar plates containing 100 mg / mL ampicillin. White single colonies were picked, and the correctness of plasmid construction was verified using primers Primer1 and Primer2. The resulting plasmid was named pESC-URA3-AGA1.

[0022] The amplification primers for the left homologous arm of AGA1 are Primer5 and Primer6, and the amplification primers for the right homologous arm are Primer11 and Primer12. The nucleotide sequences are as follows: Primer 5 (AGA1-LF(Gib), forward primer, nucleotide sequence as shown in SED ID NO. 6) TTGTAAAACGACGGCCAGTGGCAAAAGGATGTTGCCAGAG; Primer 6 (AGA1-LR(Gib), reverse primer, nucleotide sequence as shown in SED ID NO. 7) TAATCCGTACGCGCTTATATACGTTTTAATTGCTTG; Primer 11 (AGA1-RF(Gib), forward primer, nucleotide sequence as shown in SED ID NO. 12) TGTGGTATGGCAGAACAATTTAATTCATTTATATAAACATATAC; Primer 12 (AGA1-RR(Gib), reverse primer, nucleotide sequence as shown in SED ID NO. 13) CTATGACCATGATTACGCCAGTTTCGCCAGGCTCACCTGTG.

[0023] The recombinant plasmid pUC57-left-AGA1-URA3-right was constructed using the *Saccharomyces cerevisiae* CENPK2 genome, pESC-URA3-AGA1, and pESC-URA3 as templates. Four primer pairs were designed to amplify the plasmids, yielding nucleic acid fragments containing the AGA1-left arm, GAL1,10 promoter, and AGA1, URA3, and AGA1-right arm, respectively. Primers were then designed for PCR verification and sequencing of the recombinant plasmid. Primer pairs Primer5 and Primer6 were used to amplify the 635 bp *Saccharomyces cerevisiae* CENPK2 genome. The nucleotide sequence is as follows: Primer5 (AGA1-LF(Gib), forward primer, nucleotide sequence as shown in SED ID NO.6) TTGTAAAACGACGGCCAGTGGCAAAAGGATGTTGCCAGAG; Primer6 (AGA1-LR(Gib), reverse primer, nucleotide sequence as shown in SED ID NO.7) TAATCCGTACGCGCTTATATACGTTTTAATTGCTTG.

[0024] Primer pairs Primer7 and Primer8 were used to amplify the 2788 bp pESC-URA3-AGA1 fragment. The nucleotide sequences are as follows: Primer7 (AGA1 in 57-F(Gib), forward primer, nucleotide sequence as shown in SED ID NO.8) ATATAAGCGCGTACGGATTAGAAGCCGCCG; Primer8 (AGA1 in 57-R(Gib), reverse primer, nucleotide sequence as shown in SED ID NO.9) AGAAAAAAAAGAAAAATTTGAAATATAAAT.

[0025] Primer pairs Primer9 and Primer10 were used to amplify the 1189 bp pESC-URA3 fragment. The nucleotide sequences are as follows: Primer9 (URA3AGA1-F(Gib), forward primer, nucleotide sequence as shown in SED ID NO.10) GATCCAGCTGCCTGATGCGGTATTTTCTCC; Primer10 (URA3AGA1-R(Gib), reverse primer, nucleotide sequence as shown in SED ID NO.11) AATTGTTCTGCCATACCACAGCTTTTCAATTC.

[0026] Primer pairs Primer11 and Primer12 were used to amplify the 635 bp Saccharomyces cerevisiae CENPK2 genome. The nucleotide sequences are as follows: Primer11 (AGA1-RF(Gib), forward primer, nucleotide sequence as shown in SED ID NO.12) TGTGGTATGGCAGAACAATTTAATTCATTTATATAAACATATAC; Primer12 (AGA1-RR(Gib), reverse primer, nucleotide sequence as shown in SED ID NO.13) CTATGACCATGATTACGCCAGTTTCGCCAGGCTCACCTGTG.

[0027] The primer pair used for sequencing the recombinant plasmid pUC57-left-AGA1-URA3-right was Primer13 and Primer14, with the following nucleotide sequences: Primer13 (M13-M4 long, forward primer, nucleotide sequence as shown in SED ID NO.14) GTTTTCCCAGTCACGACGTTG; Primer14 (M13-RV long, reverse primer, nucleotide sequence as shown in SED ID NO.15) CAGGAAACAGCTATGACCATG.

[0028] The recombinant plasmid pUC57-left-AGA1-URA3-right was constructed using the Saccharomyces cerevisiae CENPK2 genome as a template. PCR amplification was performed using primers Primer5 and Primer6 and KOD One™ PCR Master Mix. The amplification conditions were: 98℃ for 10 seconds, annealing at 55℃ for 5 seconds, and 68℃ for 1 second for a total of 10 cycles; then 98℃ for 10 seconds, annealing at 62℃ for 5 seconds, and 68℃ for 1 second for a total of 35 cycles.

[0029] Using pESC-URA3-AGA1 as a template, PCR amplification was performed using primers Primer7 and Primer8 and KOD One™ PCRMaster Mix. The amplification conditions were: 98℃ for 10 seconds, annealing at 59℃ for 5 seconds, and 68℃ for 15 seconds for a total of 10 cycles; then 98℃ for 10 seconds, annealing at 67℃ for 5 seconds, and 68℃ for 15 seconds for a total of 35 cycles.

[0030] Using pESC-URA3 as a template, PCR amplification was performed using primers Primer9 and Primer10 and KOD One™ PCR MasterMix. The amplification conditions were as follows: 98℃ for 10 seconds, annealing at 53℃ for 5 seconds, and 68℃ for 6 seconds for a total of 10 cycles; then 98℃ for 10 seconds, annealing at 62℃ for 5 seconds, and 68℃ for 6 seconds for a total of 35 cycles.

[0031] Using the CENPK2 genome of Saccharomyces cerevisiae as a template, PCR amplification was performed using primers Primer11 and Primer12 and KOD One™ PCR Master Mix. The amplification conditions were as follows: 98℃ for 10 seconds, annealing at 57℃ for 5 seconds, and 68℃ for 1 second for a total of 10 cycles; then 98℃ for 10 seconds, annealing at 62℃ for 5 seconds, and 68℃ for 1 second for a total of 35 cycles.

[0032] After the reaction, the PCR products were detected by 2% agarose gel electrophoresis. The expected specific bands appeared at 635 bp, 2788 bp, 1189 bp and 635 bp, respectively. The four target bands were cut out and recovered by gel electrophoresis for vector construction.

[0033] The specific method for constructing the recombinant plasmid pUC57-left-AGA1-URA3-right is as follows: Plasmid pUC57 was double-digested with EcoRI and HindIII. The digestion products were recovered by gel electrophoresis and then assembled with the amplified fragment using Gibson technology. The ligation product was transformed into *E. coli* Top10 competent cells and cultured overnight at 37°C on LB agar plates containing 100 mg / mL ampicillin. White single colonies were picked, and the plasmid construction was verified using primers Primer5 and Primer12. The resulting plasmid was named pUC57-left-AGA1-URA3-right.

[0034] Step 2: Construct the antimicrobial peptide CLP1 expression plasmid CLP1 in pYD1 with EK containing the EK cleavage site; The expression plasmid CLP1 in pYD1 with EK was constructed by using the synthetic plasmid pPICZaA-HSAD2-D3-CLP1 as a template, amplifying the CLP1 fragment containing the EK cleavage site using primers Primer15 and Primer16, and then inserting it into the vector pYD1 after double digestion with Acc65I / PmeI.

[0035] The CLP1 fragment contains an Xpress™ tag and codon-optimized sequences: Primer 15 (CLP1 in YD1+EK-F(Gib), forward primer, nucleotide sequence as shown in SED ID NO.16) TGTACGACGATGACGATAAGAGGTGGAAGATTTTCAAGAAG, and Primer 16 (CLP1 in YD1-R(Gib), reverse primer, nucleotide sequence as shown in SED ID NO.17) GTTATCAGATCAGCGGGTTTTTACCAGACTTGCAATCTATTTC.

[0036] The sequencing primer used for expressing plasmid CLP1 in pYD1 with EK was Primer17, with the nucleotide sequence: Primer 17 (YD1-seq2, unidirectional sequencing, nucleotide sequence as shown in SED ID NO.18) CGAGCTAAAAGTACAGTGGG. Using pPICZaA-HSAD2-D3-CLP1 as a template, PCR amplification was performed using primers Primer15 and Primer16 with KOD One™ PCR Master Mix. The amplification conditions were: 98℃ for 10 seconds, annealing at 52℃ for 5 seconds, and 68℃ for 2 seconds, for a total of 10 cycles; then 98℃ for 10 seconds, annealing at 65℃ for 5 seconds, and 68℃ for 2 seconds, for a total of 35 cycles. After the reaction, the PCR products were detected by 2% agarose gel electrophoresis. The expected specific band appeared at 124 bp. The target band was excised and recovered from the gel for vector construction.

[0037] The specific method for expressing the plasmid CLP1 in pYD1 with EK is as follows: the plasmid pYD1 was double-digested with restriction endonucleases Acc65 I and Pme I, and then recovered by gel extraction. The plasmid was then assembled with the amplified fragment using Gibson ligation. The ligation product was transformed into E. coli Top10 competent cells, plated on LB agar plates containing 100 mg / mL ampicillin, and incubated at 37°C for 12-16 h. Colony PCR was performed using primers Primer15 and Primer16 to verify the colony. The correct plasmid was named CLP1 in pYD1 with EK.

[0038] Step 3: The expression plasmid was transferred into the new surface display host CENPK2-AGA1-URA3 by electroporation to obtain the Saccharomyces cerevisiae surface display strain of the antimicrobial peptide CLP1.

[0039] The specific steps of the electroporation method are as follows: First, prepare competent cells of Saccharomyces cerevisiae CENPK2-AGA1-URA3. Then, mix the expression plasmid, MightyPrep reagent for DNA and competent cells, culture them together, plate them, revive the cells with a solution containing 1M sorbitol after transformation, and verify the transformation results by colony PCR.

[0040] Surface display depends on the binding of the α-lectin AGA1 and AGA2 subunits via disulfide bonds to anchor CLP1 to the surface of yeast cells.

[0041] The starting vector for the expression plasmid is the yeast expression display system vector pYD1, which contains the selection marker TRP1, the promoter Gal1, the multiple cloning site, and the E. coli selection tag ampR gene element.

[0042] Application examples according toFigure 6 , Figure 7 As shown, surface morphology analysis of Escherichia coli and Staphylococcus aureus based on scanning electron microscopy (SEM) 1. Bacterial cell treatment The surface-displaying genetically engineered bacterial suspensions induced for 12 h and 24 h were centrifuged at 4000 rpm for 10 min, and the bacterial pellet was collected. The pellet was washed twice with PBS buffer, and finally resuspended in PBS. The starting strain CENPK2 was treated in the same way and used as a reference for subsequent experiments.

[0043] 2. Co-culture experiment Escherichia coli and Staphylococcus aureus were used as test bacteria. 500 μL of E. coli and Staphylococcus aureus cultures with an OD600 of approximately 0.2 were centrifuged at 4000 rpm for 5 min, and the bacterial pellet was collected. The bacterial pellet was mixed with 500 μL of the starting bacterial culture and the surface-display genetically engineered bacterial suspension, respectively, and incubated at 30℃, 220 rpm, with shaking for 12 h and 24 h. Co-culture of E. coli with liquid LB and co-culture of Staphylococcus aureus with liquid YPD were set up as negative controls.

[0044] 3. Sample post-processing After co-culturing, the cells were centrifuged at 5000 rpm for 10 min, and the bacterial pellet was retained. The pellet was washed twice with PBS and fixed overnight at 4°C with 1 mL of 2.5% glutaraldehyde. The cells were then dehydrated using a gradient of 30%, 50%, 70%, 85%, 95%, and 100% ethanol, pre-cooled at -80°C, and then freeze-dried. Cell morphology was observed under a scanning electron microscope (15000× and 30000×). (Instructions attached) Figure 5 This is a morphological characterization of *E. coli* treated with CLP1 in pYD1 with EK. Figure 6 This is a morphological characterization of Staphylococcus aureus after treatment with CLP1 in pYD1 with EK.

[0045] Application examples As shown in Table 1, the viable cell count method was used to assess antimicrobial activity. 1. Preparation of test bacterial suspension Using Escherichia coli as the test bacterium, inoculate E. coli into 6 mL of LB liquid medium and incubate at 37°C and 220 rpm for 12–16 h. Substitute at 0.1% and incubate until the logarithmic growth phase, i.e., OD600 of 0.6–0.8.

[0046] 2. Preparation of surface-displaying genetically engineered bacterial suspension Take 10 mL of the engineered bacterial solution CENPK2-EK after induction, centrifuge at 4500 g for 10 min, wash twice with an equal volume of liquid LB, then resuspend in liquid LB, and measure and record OD600. Using the engineered bacterial solution with the lowest OD600 as a template, dilute other solutions to the same OD value, and take 200 μL for later use, with CENPK2 as a negative control.

[0047] 3. Co-culture experiment Two μL of Escherichia coli suspension was mixed with 200 μL of engineered bacterial solution and co-cultured at 37℃ for 2 h. The mixture was then spread onto LB agar plates containing actinomycin D. The control group was not included in the engineered bacterial solution. Three replicates were set up and incubated at 37℃ for 12 h. Colony growth was observed and counted. The results are shown in Table 1.

[0048]

[0049] As shown in Table 1, when the mixture of Escherichia coli and engineered bacteria solution was spread on LB agar containing actinomycete ketone, almost no yeast colonies formed on the agar because actinomycete ketone can inhibit yeast growth. This indicates that the surface-displaying genetically engineered bacteria have a significant inhibitory effect on the growth of Escherichia coli under co-culture conditions.

[0050] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for constructing a Saccharomyces cerevisiae surface display of an antimicrobial peptide CLP1, comprising the following steps: Step one, transforming Saccharomyces cerevisiae CENPK2 by inserting a Gal1p-AGA1-CYC1t-URA3 expression cassette into the AGA1 gene of Saccharomyces cerevisiae CENPK2 through homologous double crossing over to construct a surface display host CENPK2-AGA1-URA3; Step two, constructing an expression plasmid CLP1 in pYD1 with EK containing an EK cleavage site of the antimicrobial peptide CLP1; Step three, transforming the expression plasmid into the new surface display host CENPK2-AGA1-URA3 by electroporation to obtain a Saccharomyces cerevisiae surface display strain of the antimicrobial peptide CLP1.

2. The method for constructing the surface display of the anti-microbial peptide CLP1 of Saccharomyces cerevisiae according to claim 1, characterized in that: The Gal1p-AGA1-CYC1t-URA3 expression cassette in the step one is a recombinant plasmid pUC57-left-AGA1-URA3-right formed by Gibson assembly of the AGA1 left homologous arm, the Gal1p-AGA1-CYC1t-URA3 fragment, the URA3 gene and the AGA1 right homologous arm with pUC57 as the carrier, and the AGA1 gene fragment amplified from the genome of Saccharomyces cerevisiae CENPK2 is inserted into the backbone of the plasmid pESC-URA3 through Gibson assembly.

3. The method for constructing the surface display of the anti-microbial peptide CLP1 of Saccharomyces cerevisiae according to claim 1, characterized in that: The AGA1 left homologous arm amplification primers in the step one are Primer 5 and Primer 6, and the right homologous arm amplification primers are Primer 11 and Primer 12.

4. The method for constructing the surface display of the anti-microbial peptide CLP1 of Saccharomyces cerevisiae according to claim 1, characterized in that: The construction of the expression plasmid CLP1 in pYD1 with EK in the step two is to use the synthetic plasmid pPICZaA-HSAD2-D3-CLP1 as the template, use the primers Primer 15 and Primer 16 to amplify the CLP1 fragment containing the EK cleavage site, and then insert the vector pYD1 after double enzyme digestion of Acc65I / PmeI.

5. The method for constructing the surface display of the anti-microbial peptide CLP1 of Saccharomyces cerevisiae according to claim 4, characterized in that: The CLP1 fragment contains an Xpress™ tag and a codon-optimized sequence.

6. The method for constructing the surface display of the anti-microbial peptide CLP1 of Saccharomyces cerevisiae according to claim 1, characterized in that: The specific steps of the electroporation method in the step three are: first, prepare the Saccharomyces cerevisiae CENPK2-AGA1-URA3 competent cells, then mix the expression plasmid, the MightyPrep reagent for DNA and the competent cells for culture and plating, use a 1M sorbitol solution to recover the cells after transformation, and verify the transformation results by colony PCR.

7. The method for constructing the surface display of the anti-microbial peptide CLP1 of Saccharomyces cerevisiae according to claim 1, characterized in that: The surface display in the step three relies on the combination of the α-agglutinin AGA1 and the AGA2 subunit through disulfide bond to anchor CLP1 on the surface of the yeast cells.

8. The method for constructing the surface display of the anti-microbial peptide CLP1 of Saccharomyces cerevisiae according to claim 1, characterized in that: The starting vector of the expression plasmid in the step three is the yeast expression display system vector pYD1, which contains the selection marker TRP1, the promoter Gal1, the multiple cloning site and the E. coli selection tag ampR gene element.

Images