Method for improving lodging resistance of rape

Abstract

The invention discloses a method for improving lodging resistance of oilseed rape. A BnPIF5 gene in the oilseed rape is knocked out. The invention discloses that the protein coded by the BnPIF5 gene has a lodging promoting effect on rape seedlings for the first time, and the lodging ratio of homozygous mutant seedlings in a shaded environment is remarkably reduced due to mutation of the BnPIF5 gene. The invention provides new gene resources and theoretical guidance for deepening the function research of BnPIF5 and the research and application of lodging resistance and other characters of rape seedlings in a shading environment.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a method for improving the lodging resistance of rapeseed. BACKGROUND

[0002] At present, rapeseed (Brassica napus L.) planting in China mainly adopts two modes of seedbed seedling transplanting and direct sowing. The seedlings on the seedbed are densely planted and may be shaded during the seedling stage. In order to ensure the seedling rate, the sowing amount is generally too high when direct sowing is adopted, and a shaded environment is easily formed. However, the existing rapeseed varieties have low density tolerance, and the hypocotyl elongation and lodging caused by the shade avoidance response affect the yield and quality of rapeseed. Brassica napus Brassica napus It is found that the seedling stage traits of rapeseed, including the seedling stage lodging, are significantly related to a series of agronomic performance at the seedling stage (Korber N, Wittkop B, Bus A, Friedt W, Snowdon R J, and Stich B. Seedling development in a diversity set and its relationship to agronomic performance [J]. Theor Appl Genet, 2013, 125: 1275-1287.). Theoretical and Applied Genetics

[0003] In the actual production process, the hypocotyl elongation of rapeseed is related to the yield, biomass and plant height (Luo X, Xue Z, Ma C, Hu K, Zeng Z, Dou S, Tu J, Shen J, Yi B, and Fu T. Joint genome-wide association and transcriptome sequencing reveals a complex polygenic network underlying hypocotyl elongation in rapeseed (Brassica napus L.) [J]. BMC Plant Biol, 2017, 7: 41561.). Brassica napus Scientific Reports Therefore, analyzing the molecular mechanism of the shade avoidance response of rapeseed seedlings and cultivating rapeseed varieties with lodging resistance are effective methods for realizing the yield increase per unit area.

[0004] ​​​However, there are few reports on the molecular mechanism of rapeseed seedling shade avoidance response. Most of the researches are limited to phenotype statistics and population analysis, and there is little in-depth molecular analysis. The main reason is that the shading environment of rapeseed seedlings in the field is disturbed by external factors such as wind, rain, herbivorous animals and pathogenic bacteria. In addition, it is difficult to accurately control the changes of light quality. Studies have shown that the lodging traits of Brassica napus seedlings are significantly related to yield and plant height and other agronomic traits ([1] Korber N, Wittkop B, Bus A, Friedt W, Snowdon R J, and Stich B. Seedling development in a Brassica napus diversity set and its relationship to agronomic performance[J]. Theoretical and Applied Genetics , 2013, 125: 1275-1287. [2]Luo X, Xue Z, Ma C, Hu K, Zeng Z, Dou S, Tu J, Shen J, Yi B, and Fu T. Joint genome-wide association and transcriptome sequencing reveals a complex polygenic network underlying hypocotyl elongation in rapeseed ( Brassica napus L.) [J]. Scientific Reports , 2017, 7: 41561.)。

[0005] Therefore, studying the molecular mechanism of rapeseed seedling shade avoidance response and providing a theoretical basis for breeding rapeseed varieties with excellent traits such as shade tolerance and lodging resistance is of great and far-reaching significance for improving the yield per unit area of rapeseed.

[0006] The application of the gene in regulating the lodging resistance of rapeseed is disclosed in the application with the publication number CN117721140A. The gene includes the gene and the gene. The application method is to improve the lodging resistance of rapeseed by destroying the function of the gene. PRE1 PRE1 It is still of practical significance to study other genes related to the lodging resistance of rapeseed. PRE1.A07 PRE1.C06 SUMMARY PRE1

[0007]

[0008] ​​​​​This invention addresses the aforementioned shortcomings of existing technologies by providing a method to improve the lodging resistance of rapeseed. This invention utilizes gene-editing CRISPR-Cas9 technology to create a method for improving the lodging resistance of rapeseed. PIF5 The triple mutant of three homologous copies of the gene was found to be effective in regulating lodging resistance in seedlings of Brassica napus under shade stress. This triple mutant can be used to improve crop quality and provides new gene resources and theoretical guidance for further research and application of traits such as lodging resistance in seedlings of Brassica napus under shade stress.

[0009] This invention is disclosed for the first time. BnPIF5 The application of genes in regulating lodging resistance in rapeseed seedlings under shade stress, whereby the rapeseed phytochrome PIF5 has three homologous copies, namely the gene BnaC04G0280000WE / BnC04.PIF5 , BnaC08G0334300WE / BnC08.PIF5 and BnaA09G0508100WE / BnA09.PIF5 The BnC04.PIF5 , BnC08.PIF5 and BnA09.PIF5 The base sequence of the gene is shown in SEQ ID NO.1~3.

[0010] The nucleotide sequences shown in SEQ ID NO. 1~3 are as follows: BnPIF5 The full-length genome sequence of the gene has a length of 1036, 2618, or 2556 bp; the nucleotide sequences shown in SEQ ID NO. 4~6 are as follows: BnPIF5 The nucleotide sequences of the coding regions of different copies of the gene have lengths of 819bp, 1332bp, and 1329bp, respectively; the lengths of the encoded amino acid sequences are 272aa, 443aa, and 442aa, respectively.

[0011] This invention identified a gene that influences lodging resistance in rapeseed seedlings grown in shady environments through RNA-seq analysis, and named it... BnPRE1 Subsequently, through loss-of-function experiments, it was found that BnPIF5 lie in BnPRE1 Upstream, it is an important regulatory factor in controlling lodging resistance under shading stress in Brassica napus seedlings. Specifically, using CRISPR Cas9 technology, it was found that... (The sentence is incomplete and requires further context to be translated accurately.) BnPIF5 Gene, obtain a homozygous mutant with three copies of the gene missing function. Bnpif5t After growing under white light for 4 days, the mutant was transferred to simulated shade conditions and continued to grow for 2 days, compared to the wild type. Bnpif5t The proportion of mutants that collapsed decreased significantly. BnPIF5 The gene is a gene that regulates the lodging resistance of plants in shady environments, and it affects plant growth and development.

[0012] The above-mentioned gene can promote the lodging resistance of the oilseed rape seedling in the shaded environment, and the decrease of the expression amount of the gene will affect the elongation of the hypocotyl, thereby enhancing the lodging resistance of the plant in the shaded environment.

[0013] Brassica napus BnPIF5 The deletion of the gene causes the slow elongation of the hypocotyl in the shaded environment, thereby providing the improvement of the lodging resistance of the plant in the subsequent growth. BnPIF5 The gene knockout can change the wild type westar into a lodging-resistant mutant.

[0014] The present application first provides a method for improving the lodging resistance of the oilseed rape, and the method comprises the following steps: BnPIF5 Knocking out the gene.

[0015] Preferably, BnPIF5 The nucleotide sequence of the gene is shown in any one of SEQ ID NO. 1-6.

[0016] More preferably, the three homologous copies of the nucleotide sequence of the gene shown in SEQ ID NO. 1-3 are knocked out together. BnPIF5

[0017] Preferably, the oilseed rape is Brassica napus, Brassica rapa or Brassica juncea.

[0018] Preferably, the CRISPR / Cas9 gene editing technology is used to knockout the gene of the oilseed rape, and the Agrobacterium transformation and plant tissue culture technology are used to construct the homozygote of the gene mutation. BnPIF5 BnPIF5 Preferably, the sgRNA sequence corresponding to the coding sequence of the gene is cloned and constructed into the vector for CRISPR / Cas9 gene editing, so as to obtain the vector for transgenesis, and the Agrobacterium transformation is used to introduce the vector into the oilseed rape cells, so as to obtain the oilseed rape plant with the knockout of the gene.

[0019] More preferably, the sgRNA sequence corresponding to the coding sequence of the gene is cloned and constructed into the vector for CRISPR / Cas9 gene editing, so as to obtain the vector for transgenesis, and the Agrobacterium transformation is used to introduce the vector into the oilseed rape cells, so as to obtain the oilseed rape plant with the knockout of the gene. BnPIF5 BnPIF5 More preferably, the sgRNA sequence corresponding to the coding sequence of the gene is cloned and constructed into the vector for CRISPR / Cas9 gene editing, so as to obtain the vector for transgenesis, and the Agrobacterium transformation is used to introduce the vector into the oilseed rape cells, so as to obtain the oilseed rape plant with the knockout of the gene.

[0020] More preferably, the sgRNA sequence corresponding to the coding sequence of the gene is cloned and constructed into the vector for CRISPR / Cas9 gene editing, so as to obtain the vector for transgenesis, and the Agrobacterium transformation is used to introduce the vector into the oilseed rape cells, so as to obtain the oilseed rape plant with the knockout of the gene.

[0021] More preferably, the sgRNA sequence corresponding to the coding sequence of the gene is GCAACTCCAAGTGATGTGGA.

[0022] More preferably, the vector for CRISPR / Cas9 gene editing is pUBQ10:Cas9-P2A-GFP(Hyg) vector.

[0023] The present application further provides an oilseed rape plant with the knockout of the gene. BnPIF5 ​​​The vector used for gene knockout will carry the knockout gene. BnPIF5 The coding sequence corresponding to the sgRNA sequence of the gene was cloned and constructed into a CRISPR / Cas9 gene editing vector. The coding sequence corresponding to the sgRNA sequence is GCAACTCCAAGTGATGTGGA.

[0024] Preferably, the vector used for CRISPR / Cas9 gene editing is pUBQ10:Cas9-P2A-GFP(Hyg).

[0025] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention is disclosed for the first time. BnPIF5 The gene-encoded protein promotes lodging in rapeseed seedlings. BnPIF5 Gene mutations caused a significant decrease in the lodging rate of homozygous mutant seedlings under shaded conditions.

[0026] (2) This invention provides new gene resources and theoretical guidance for deepening the research on the function of BnPIF5 and the research and application of traits such as lodging resistance of rapeseed seedlings in shaded environments. Attached Figure Description

[0027] Figure 1 For rapeseed BnC04.PIF5 , BnC08.PIF5 and BnA09.PIF5 The alignment results of the coding gene sequence.

[0028] Figure 2 The results of the amino acid sequence alignment of BnC04.PIF5, BnC08.PIF5 and BnA09.PIF5 in rapeseed.

[0029] Figure 3 This is a structural diagram of the pAtU6-26-M gene editing vector.

[0030] Figure 4 This is a structural diagram of the pUBQ10:Cas9-P2A-GFP(Hyg) gene editing vector.

[0031] Figure 5 for Bnpif5t Mutation type of the mutant.

[0032] Figure 6 for Bnpif5t The amino acid changes in the mutant are shown, where r represents the reference amino acid sequence and m represents the mutant amino acid sequence. The amino acids marked in red indicate the differences between the reference and mutant amino acids.

[0033] Figure 7 for BnPIF5 Gene regulation in simulated shaded environments BnPRE1Gene expression was measured. WL represented 5 days of white light, while Shade represented 4 days of growth under white light followed by 1 day of growth under simulated shade conditions. Total RNA was extracted from the hypocotyl. Simulated shade conditions consisted of white light supplemented with a certain proportion of far-red light (PAR, 48 μmol•m). -2 •s -1 (R:FR=0.5). *Statistical chart p <0.05.

[0034] Figure 8 for Bnpif5t The mutant simulates a shaded environment to resist lodging. Among them, Figure 8 In this context, A represents Westar and [other components] under white light and simulated shaded conditions. Bnpif5t Representative image of mutant lodging; Figure 8 In this context, B represents Westar and [other components] under white light and simulated shaded conditions. Bnpif5t Statistical graph of mutant lodging, with 3 biological replicates. *** in the statistical graph. p <0.001; ns indicates p >0.5. Bar=5cm. Detailed Implementation

[0035] Brassica napus is an allotetraploid crop that encodes photochromic interaction factor 5. PIF5 The gene has three homologous copies. BnaC04G0280000WE (abbreviation) BnC04.PIF5 ), BnaC08G0334300WE (abbreviation) BnC08.PIF5 and BnaA09G0508100WE (abbreviation) BnA09.PIF5 ). BnC04.PIF5 The gene sequence is as shown in SEQ ID NO.1, and the corresponding amino acid sequence is as shown in SEQ ID NO.7. BnC08.PIF5 The gene sequence is shown in SEQ ID NO.2, and the corresponding amino acid sequence is shown in SEQ ID NO.8. BnA09.PIF5 The gene sequence is shown in SEQ ID NO.3, and the corresponding amino acid sequence is shown in SEQ ID NO.9. The sequence similarity of the coding sequences of the three homologous copies is 84%, 83.7%, and 84.2%, respectively, and the sequence similarity of the amino acid sequences is 82.2%, 78.9%, and 79.3%, respectively. Figure 1 Three of the rapeseed varieties PIF5 The alignment results of the coding gene sequence of the copy. Figure 2 The results show the amino acid sequence alignment of three PIF5 copies in rapeseed.

[0036] Example 1 Experimental materials and growth conditions: The rapeseed variety used in this experiment was Westar, which was one of 900 rapeseed varieties collected from around the world (Wu D, Liang Z, Yan T, Xu Y, Xuan L, Tang J, Zhou G, Lohwasser U, Hua S, Wang H, Chen X, Wang Q, Zhu L, Maodzeka A, Hussain N, Li Z, Li X, Shamsi IH, Jilani G, Wu L, Zheng H, Zhang G, Chalhoub B, Shen L, Yu H, and Jiang L. Whole-Genome Resequencing of a Worldwide Collection of Rapeseed Accessions Reveals the Genetic Basis of Ecotype Divergence[J]. Molecular Plant (2019, 12: 30-43.), The seeds were cultivated in the standard experimental field of Zhejiang University in Changxing County, Zhejiang Province, China in 2022. They were sown in the seedbed in late September 2021, and one-month-old rapeseed seedlings were transplanted into the soil in late October. The seeds were collected in May of the following year, and phenotypic observations were conducted using seeds collected in the same year.

[0037] Westar seeds were surface-sterilized with 10% (v / v) NaClO solution for 10 min, treated in darkness at 4°C for 2 days, and then inoculated into 1 / 2 MS medium and cultured under white light for 5 days as a control group. The treatment groups were first exposed to white light (WL, White Light; PAR, Photosynthetically Active Radiation; 48 μmol·m⁻¹). -2 ·s -1 After culturing for 4 days under white light, the samples were transferred to simulated shade conditions (with far-red light supplemented in white light, red light / far-red light ratio = 0.5 or 0.8, R:FR = 0.5 or 0.8; PAR; 48 μmol·m -2 ·s -1 Continue culturing for 1 day. Hypocotyls of three rapeseed seedlings were collected, total RNA was extracted, and 1 μg of RNA was reverse transcribed into cDNA as an RT-qPCR template. All RT-qPCR experiments were performed in triplicate.

[0038] Example 2 Construction of gene editing vectors: Using the Westar wild-type rapeseed whole genome as a reference genome, targetingPIF5 Three homologous copies of the gene were used to design sgRNAs on the CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / CRISPR / ).

[0039] The coding sequence corresponding to the sgRNA sequence used in this experiment is: sgRNA: GCAACTCCAAGTGATGTGGA (SEQ ID NO.10) This sgRNA sequence can simultaneously knock out PIF5 Three homologous copies of the gene were cloned, and the sgRNA sequence was constructed into the pAtU6-26-M vector. Figure 3 ), thus obtaining pAtU6-26-PIF5. Then, using Kpn I and Sal I enzymes, the sgRNA expression sequence structure was cloned into the pUBQ10:Cas9-P2A-GFP(Hyg) vector ( Figure 4 )middle.

[0040] The primers used to construct the vector are: BnPIF5-sgRNA-F: GATTGCAACTCCAAGTGATGTGGA (SEQ ID NO. 11); BnPIF5-sgRNA-R: AAACTCCACATCACTTGGAGTTGC (SEQ ID NO. 12).

[0041] First, primers BnPIF5-sgRNA-F and BnPIF5-sgRNA-R were mixed in equal volumes and annealed. Simultaneously, the pAtU6-26-M vector (…) was annealed using the BbsI restriction endonuclease. Figure 3 The sgRNA was digested with enzymes, purified by gel recovery, and then ligated with the annealed sgRNA oligo to construct the pAtU6-26-PIF5 vector.

[0042] Subsequently, the constructed pAtU6-26-sgRNA vector was digested with KpnI and SalI, and the AtU6-26-sgRNA fragment was recovered; simultaneously, the pUBQ10:Cas9-P2A-GFP(Hyg) vector was treated with the same enzyme digestion. Figure 4 The pAtU6-26-M vector was purified by gel extraction and then ligated with the AtU6-26-sgRNA fragment to obtain the final gene editing vector. Both the pAtU6-26-M and pUBQ10:Cas9-P2A-GFP(Hyg) vectors are described in Chinese patent application number 201911080944.3.

[0043] Example 3 Creating mutants using plant tissue culture techniques: (1) Seed disinfection: treat seeds with 75% ethanol for 1 min, 50% sodium hypochlorite solution for 10 min, and finally rinse with sterile ddH2O 3 times.

[0044] (2) Sowing and germination: Sow sterilized seeds in M0 medium (MS 4.4g / L, sucrose 10g / L, agar 8g / L), 20-30 seeds per box, and culture in the dark at 22℃ for 6 days.

[0045] (3) Agrobacterium culture: On the 4th day after sowing, select a single Agrobacterium clone containing the target vector and inoculate it into LB liquid medium containing the corresponding antibiotic. Incubate at 28°C and 220 rpm for at least 24 h with shaking. Then transfer it to fresh LB medium (containing antibiotic) at a ratio of 1:500 and continue to incubate at 28°C and 220 rpm for at least 16 h.

[0046] (4) Collection and resuspension of bacterial cells: Take 2 mL of bacterial solution, centrifuge at 6000 rpm for 10 min, and discard the supernatant; add 2 mL of DM infection solution to resuspend the bacterial cells, centrifuge again at 6000 rpm for 5 min, discard the supernatant and resuspend, and dilute with DM infection solution at a ratio of 1:10 to a total volume of 20 mL.

[0047] (5) Explant preparation and infection: In M1 liquid medium, rapeseed hypocotyls were cut into segments of about 1 cm using a sterile scalpel. The segments were immersed in the above infection solution for 15 min, and then removed and placed on sterile filter paper to remove excess bacterial solution.

[0048] (6) Co-culture: The infected explants were transferred to M1 solid medium (MS 4.4 g / L, sucrose 30 g / L, agar 8 g / L, AS 100 µM, 2,4-D 1 mg / L, Kinetin 0.3 mg / L) and co-cultured in the dark at 22°C for 2 days.

[0049] (7) Screening culture I: After co-culture, the explants were transferred to M2 solid medium (MS 4.4g / L, sucrose 30g / L, agar 8g / L, 2,4-D 1mg / L, Kinetin 0.3mg / L, STS 0.02mM, Timentin 300mg / L, Hygromycin 25mg / L) and cultured for 18 days at 22℃ with a photoperiod of 8h / 16h.

[0050] (8) Screening culture II: Transfer the explants to M3 solid medium (MS 4.4g / L, glucose 10g / L, agar 8g / L, Zeatin 2mg / L, IAA 0.1mg / L, Timentin 300mg / L, Hygromycin 25mg / L), and change the medium every 14 days until shoots are induced.

[0051] (9) Rooting culture: Transfer the well-grown buds with true leaves in M3 to M4 solid medium (MS 4.4 g / L, sucrose 10 g / L, agar 8 g / L) to induce rooting.

[0052] Example 4 Identification of mutant plants: Total DNA was extracted from the mutant plant, and a segment of the genome near the target site was amplified by PCR. After sequencing, the mutation status of the target site was identified by comparing it with the target sequence of the wild type.

[0053] BnC04.PIF5 , BnC08.PIF5 and BnA09.PIF5 The target site detection primers are: BnC04.PIF5-f:AATCCAGCCAACGGTCAGGA (SEQ ID NO.13), BnC04.PIF5-r:ACTAACCTGAGTAGTCGCGG (SEQ ID NO.14), BnC08.PIF5-f:AACATCAGTTAGTCTCGAGGTG (SEQ ID NO.15), BnC08.PIF5-r:GCAGCGGGTCGGTTCATAA (SEQ ID NO.16), BnA09.PIF5-f:GGTTTAGCAGCAACTCTTAATCTT (SEQ ID NO.17), BnA09.PIF5-r: CTAGCAAGCTGCTCCGACAA (SEQ ID NO. 18).

[0054] Plant DNA extraction: Place a small leaf fragment in a 2mL centrifuge tube and grind it into a fine powder using a grinder. Add 400μL Edwards buffer and incubate at 65°C for 10 minutes. Then centrifuge at 12,000rpm for 5 minutes. Transfer 300μL of the supernatant to a new 1.5mL centrifuge tube, add an equal volume of isopropanol, mix well, and let stand at room temperature for 10 minutes. Centrifuge at 12,000rpm for 5 minutes, discard the supernatant, wash the precipitate once with 75% ethanol, centrifuge again at 12,000rpm for 2 minutes, discard the ethanol, and finally dissolve the precipitate in 40μL TE buffer. (Edwards buffer formulation (100mL): 1M Tris-HCl (pH 7.5) 20mL; 5M NaCl 5mL; 0.5M EDTA (pH 8.0) 5mL; 10% SDS 5mL.) PCR identification: Amplification was performed using primer pairs BnC04.PIF5-f / r, BnC08.PIF5-f / r, and BnA09.PIF5-f / r, respectively. BnC04.PIF5 , BnC08.PIF5 and BnA09.PIF5 The sgRNA and its flanking sequences in the gene were analyzed. The PCR reaction system was as follows: 10 μL TaqMix, 0.5 μL each of forward and reverse primers (10 μM), 2 μL template DNA, and ddH2O to a final volume of 20 μL. The reaction program was: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 15 s, for a total of 38 cycles; 72℃ for 5 min; and stored at 4℃.

[0055] Mutant identification and analysis: The sequenced data was compared with the flanking sequences of the wild-type target site to analyze insertion / deletion mutations. Genotype was determined by sequencing peak patterns; if the entire sequence consisted of a single peak, it was identified as a homozygous mutant. Figure 5 Showing Bnpif5t Sequencing results of the mutant, Figure 6 This indicates the corresponding amino acid mutations.

[0056] Example 5 BnPIF5 regulation under simulated shade conditions BnPRE1 Expression: Westar and Bnpif5t After growing under white light for 4 days, the mutants were either transferred to simulated shade conditions for another day or grown under white light for another day. Simulated shade conditions consisted of white light supplemented with a certain proportion of far-red light (PAR, 48 μmol•m). -2 •s -1 (R:FR=0.5 or 0.8). Remove the hypocotyl and extract total RNA. ACT7As an internal control, it was detected using RT-qPCR. BnPRE1 The expression level. The results are as follows: Figure 7 As shown, the results indicate that, compared to the control Westar, under simulated shaded conditions... Bnpif5t The mutant cannot induce BnPRE1 Expression levels were significantly increased, indicating that BnPIF5 can regulate expression under shaded conditions. BnPRE1 The expression.

[0057] Example 6 Phenotypic observation of mutants: The samples obtained in Example 4 Bnpif5t Homozygous mutants and wild-type Westar seedlings were cultivated in soil, with two treatment groups: one group was continuously grown under white light for 6 days, and the other group was first grown under white light for 4 days, and then transferred to simulated shade conditions for 2 more days. The lodging of the hypocotyls of the seedlings was observed and counted (hypocotyl tilt angle ≥45° was considered lodging), and the lodging rate was calculated.

[0058] The results showed that, compared to wild-type Westar, Bnpif5t The proportion of lodging of mutants was significantly reduced after shading treatment. Figure 8 The result indicates that... BnPIF5 The gene plays a key role in the hypocotyl morphogenesis induced by shading signals, and its loss of function can significantly enhance the lodging resistance of rapeseed seedlings under low light conditions.

[0059] In conclusion, Bnpif5t The three-copy mutant exhibits excellent shade-tolerant and lodging-resistant phenotypes, showing significant application potential in agricultural production, especially in dense planting or intercropping systems. This material provides valuable genetic resources and a breeding foundation for developing new shade-tolerant and lodging-resistant rapeseed varieties.

Claims

1. A method of improving the resistance to lodging of oilseed rape, characterized in that, Genetic knockout in Brassica napus BnPIF5 Gene knockout.

2. The method for improving the lodging resistance of rapeseed according to claim 1, characterized in that, BnPIF5 The nucleotide sequence of the gene is shown in any one of SEQ ID NO. 1 to 6.

3. The method for improving the resistance to lodging of oilseed rape according to claim 1, characterized in that, The oilseed rape is Brassica napus, Brassica rapa or Brassica juncea.

4. The method for improving resistance to lodging of oilseed rape according to claim 1, characterized in that, Knocking out rapeseed by using CRISPR / Cas9 gene editing technology BnPIF5 gene, and using agrobacterium transformation and plant tissue culture technology to construct BnPIF5 gene mutation homozygote.

5. The method of claim 4, wherein the oilseed rape is selected from the group consisting of Brassica napus, Brassica rapa, Brassica carinata, and Brassica juncea. sgRNA sequence carrying knockout BnPIF5 The coding sequence corresponding to the sgRNA sequence carrying knockout BnPIF5 gene of rapeseed is cloned and constructed into a vector for CRISPR / Cas9 gene editing to obtain a vector for transgene, and is introduced into rapeseed cells by means of Agrobacterium transformation, and a rapeseed plant with knockout BnPIF5 gene is obtained by screening and culture.

6. The method of claim 5, wherein the oilseed rape is selected from the group consisting of Brassica napus, Brassica rapa, Brassica carinata, and Brassica juncea. When transformed by Agrobacterium, the seed is first sown and germinated, and then a section of hypocotyl is taken for Agrobacterium transformation.

7. The method of claim 5, wherein the oilseed rape is selected from the group consisting of Brassica napus, Brassica rapa, Brassica carinata, and Brassica juncea. The coding sequence corresponding to the sgRNA sequence is GCAACTCCAAGTGATGTGGA. ​ 8. The method of claim 5, wherein the oilseed rape is selected from the group consisting of Brassica napus, Brassica rapa, Brassica carinata, and Brassica juncea. The vector for CRISPR / Cas9 gene editing is pUBQ10:Cas9-P2A-GFP(Hyg) vector.

9. A method of increasing yield in Brassica napus plants comprising introducing into a Brassica napus plant a transgenic Brassica napus plant of claim 1. BnPIF5 A vector for gene knockout, characterized in that, sgRNA sequence corresponding to the gene carrying knockout BnPIF5 The coding sequence corresponding to the sgRNA sequence is cloned and constructed into a CRISPR / Cas9 gene editing vector, and the coding sequence corresponding to the sgRNA sequence is GCAACTCCAAGTGATGTGGA.

10. The use according to claim 9, wherein the Brassica plant is Brassica napus. BnPIF5 A vector for gene knockout, characterized in that, The vector for CRISPR / Cas9 gene editing is pUBQ10:Cas9-P2A-GFP(Hyg) vector.

Images