Application of pepper LOC107841648 gene in improving waterlogging tolerance of plants

Abstract

The invention provides an application of a pepper LOC107841648 gene in improving waterlogging tolerance of plants, and belongs to the technical field of gene engineering. The CDS sequence of the pepper LOC107841648 gene is as shown in SEQ ID NO. 2, and the CDS sequence is as shown in SEQ ID NO. A flooding stress experiment shows that compared with wild type arabidopsis thaliana, an arabidopsis thaliana plant with the transgenic LOC107841648 gene can reduce the relative conductivity after flooding stress and increase the relative chlorophyll content, which indicates that the over-expressed pepper LOC107841648 gene can obviously improve the waterlogging tolerance of the plant, and is an excellent gene for the waterlogging tolerance genetic engineering breeding of the plant.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to chili peppers. LOC107841648 Application of genes in improving plant waterlogging tolerance. Background Technology

[0002] chili( Capsicum annuum Capsicum annuum (L.) is a representative crop of the Solanaceae family and the Capsicum genus. It has become one of the most widely cultivated and consumed spicy crops in the world, occupying an irreplaceable position in agricultural economy and food industry. Its fruit is rich in vitamin C (up to 144.6mg per 100g of fresh pepper), carotenoids, capsaicin, and other nutrients and bioactive substances. It is not only a key ingredient in regulating the flavor of food, but also shows broad application prospects in health fields such as anti-oxidation, anti-inflammation, and metabolic regulation. At the same time, it supports the development of a diversified product system such as hot sauce and functional foods.

[0003] Chili peppers are not only a pillar of the local economy but also an important link connecting different culinary cultures. Their industrial development directly impacts regional agricultural efficiency and farmers' income. However, the inherent characteristics of chili peppers—shallow roots and limited root volume—make them a typical waterlogging-sensitive crop, and their intolerance to waterlogging has become a core bottleneck restricting their high-quality and high-yield production. Against the backdrop of global climate change, the annual frequency of rain and flooding in chili pepper producing areas has exceeded 30%. In some areas, heavy clay soils and salinization caused by continuous cropping further exacerbate the risk of waterlogging. Under waterlogging stress, the gaseous phase of the soil is replaced by the liquid phase, causing chili pepper roots to rapidly fall into a state of oxygen deficiency. This forces them to initiate anaerobic respiration, producing toxic substances such as ethanol, leading to root rot and wilting within hours, and in severe cases, widespread death.

[0004] Systematic research on the response characteristics of chili peppers to flooding stress, screening and cloning flood-tolerant genes and clarifying their mechanisms of action can not only improve the molecular theory of chili pepper stress resistance, but also provide key technical support for the breeding of new flood-tolerant chili pepper varieties, which is of great practical significance for promoting the upgrading of stress-resistant cultivation in the chili pepper industry. Summary of the Invention

[0005] The purpose of this invention is to provide chili peppers. LOC107841648 Application of genes in improving plant waterlogging tolerance.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides chili peppers LOC107841648 The application of genes in improving the waterlogging tolerance of plants, specifically the pepper. LOC107841648 The CDS sequence of the gene is shown in SEQ ID NO.2.

[0007] Preferably, the chili pepper LOC107841648The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

[0008] Preferably, the plants include Arabidopsis thaliana and Capsicum annuum.

[0009] The application provides a method for improving the waterlogging tolerance of plants, which comprises introducing a gene into Capsicum annuum. LOC107841648 The gene is introduced into target plants to obtain plants with improved waterlogging tolerance; the Capsicum annuum LOC107841648 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the CDS sequence is shown as SEQ ID NO. 2.

[0010] Preferably, the plants include Arabidopsis thaliana and Capsicum annuum.

[0011] Preferably, the gene is introduced into the target plants in the form of a plant overexpression vector of the Capsicum annuum. LOC107841648 The plant overexpression vector of the gene is introduced into target plants.

[0012] Preferably, the method for introducing is a flower dipping method.

[0013]

[0014] SEQ ID NO. 2: ATGGAAAGAAAAACAATGATCAGTACCAAGAAACTTATCAAAATGGCTAGGAGATGGCAGAAGTTTGCAGCCATGCAGAGGAAGAGGATCTCACTTACAAGAAATGGTAGTGATGCAGACAGTTGTAGTACGTCTTCACCCTCTATAGTCGGAAAAGGTCATTTTGTAGTATATACAATTGATCAAACACGCTTTGGGATTCCCTTGGAGTATCTTGAAAATGAGGTCATCAGGCAACTTCTAATCATATCCGAACAAGAGTTTGGCCTGTCAAGTGCTGGCCTCATTACATTACCCTGCGATTCATCCTTCATGGACTATATAATTTCACTTATCAAAAAAGGTGTAGCTGCAAGAGATCTTCACAAGGCGTTGCTCCTCTCAATTCCTTCATGTTGCTGTTCAATTTCTTCTTTGCAGCAAGAAAGTCAAAACCAGCAACTTCTTGTTTAT

[0015] Compared with the prior art, the present application has the following beneficial effects: Through the waterlogging stress experiment, it is found that the Arabidopsis thaliana plant with the overexpressed Capsicum annuum gene can reduce the relative conductivity and improve the relative chlorophyll content after waterlogging stress, which indicates that the overexpressed Capsicum annuum gene can obviously improve the waterlogging tolerance of the plant, and is an excellent gene for plant waterlogging tolerance genetic engineering breeding. LOC107841648 LOC107841648 BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced below. Obviously, the drawings in the following description are only embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of the provided drawings.

[0017] Figure 1 It is a structure map of the pEGOEPubi-H-LOC107841648-GFP vector. Figure 2 It is a restriction map of the pEGOEPubi-H-LOC107841648-GFP vector. ​​Figure 3 The expression amount detection results of LOC107841648 in wild type Arabidopsis and transgenic Arabidopsis L1, L2 and L3 plants; Figure 4 The state diagrams of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery; Figure 5 The relative electrical conductivity of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery; Figure 6 The relative chlorophyll content of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery; Figure 7 The soluble sugar content of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery; Figure 8 The POD activity of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery. DETAILED DESCRIPTION

[0018] The technical solutions provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0019] Example 1

[0020] 1. Construction of plant overexpression vector containing pepper LOC107841648 gene and transformation of Agrobacterium

[0021] 1.1 Primer design

[0022] LOC107841648-F (SEQ ID NO. 3): Actagggtctc Gcacc ATGGAAAGAAAAACAATGATCAGTACCAAGAAAC

[0023] LOC107841648-R (SEQ ID NO. 4): Actagggtctc Tcgcc ATAAACAAGAAGTTGCTGGTTTTGACTTTCT

[0024] UBI-F (SEQ ID NO. 5): TTAGCCCTGCCTTCATACGC

[0025] eGFP-cx (SEQ ID NO. 6): GACACGCTGAACTTGTGG

[0026] 1.2 Amplification and recovery of target fragment

[0027] PCR was performed using primers as described in SEQ ID NO. 3 and SEQ ID NO. 4 LOC107841648 The PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0028] Table 1 PCR reaction system

[0029] Table 2 PCR reaction conditions

[0030] 1.3 Gel recovery

[0031] The PCR product was detected by agarose gel electrophoresis, and the correct electrophoresis fragment was cut off and the target fragment was recovered using the agarose gel DNA recovery kit (DP209-03) of Tiangen Bioscience Co., Ltd. The operation was carried out according to the kit instructions. The enzyme digestion and ligation reaction system used is shown in Table 3, and the reaction conditions are shown in Table 4.

[0032] Table 3 Enzyme digestion and ligation reaction

[0033] Table 4 Enzyme digestion and ligation reaction parameters

[0034] 1.4 Recombinant plasmid transformation

[0035] (1) Take a tube of 100 μL DH5a E. coli competent cells and mix with 2-5 μL ligation product, ice bath for 30 min; (2) quickly placed in 42℃ constant temperature water bath, heat shock 90 s, ice bath 2 min; (3) add 500 μL LB liquid medium, mix well; (4) 37℃, 200 rpm, cultivate for 45 min, so that the cells recover to normal growth state; (5) evenly spread the bacterial liquid on the Kana-resistant LB solid medium plate; (6) After 30 min, place in a 37℃ constant temperature incubator and incubate overnight.

[0036] 1.5 Bacterial detection

[0037] Colony PCR detection was performed using UBI-F / eGFP-cx primers, and the positive bacterial plaque detected was picked and shaken. The colony PCR detection system is shown in Table 5, and the colony PCR reaction conditions are shown in Table 6.

[0038] Table 5 Colony PCR amplification system

[0039] Table 6 Colony PCR reaction conditions

[0040] 1.6 Plasmid extraction: (1) Single colony was inoculated from LB solid medium plate into LB liquid medium with kanamycin at a final concentration of 50 μg / mL, and incubated at 37 °C overnight; (2) 4 mL of activated bacterial solution was centrifuged at 10000 rpm for 2 min at room temperature, and the supernatant was completely discarded; (3) 250 μL of Solution I reagent containing ribonuclease A was used to completely resuspend the bacterial pellet; (4) 250 μL of Solution II reagent was used to lyse the bacterial pellet, and the bacterial solution was gently inverted several times until the bacterial solution was transparent; (5) 350 μL of Solution III reagent was used, and the solution was inverted several times until a white and compact flocculent was formed; (6) The solution was centrifuged at 12000 rpm for 10 min at room temperature, and the supernatant was collected; (7) The nucleic acid purification column was taken out from the kit and placed on the collection tube; (8) The clear supernatant obtained in step (6) was added to the nucleic acid purification column, which was centrifuged at 12000 rpm for 1 min at room temperature, and the filtrate was discarded; (9) 500 μL of Buffer W1 was added to the nucleic acid purification column, which was centrifuged at 12000 rpm for 30 s at room temperature, and the filtrate was discarded; (10) 700 μL of Buffer W2 was added to the nucleic acid purification column, which was centrifuged at 12000 rpm for 30 s at room temperature, and the filtrate was discarded; (11) The above step (10) was repeated; (12) The nucleic acid purification column was placed on the collection tube, which was centrifuged at 12000 rpm for 2 min at room temperature, and the residual liquid was removed as much as possible; (13) The collection tube was discarded, and the nucleic acid purification column was placed in a 1.5 mL EP tube, and 50 μL of elution buffer was added to elute the DNA attached to the membrane of the nucleic acid purification column (the elution buffer was preheated in a 65 °C constant temperature water bath to facilitate the elution of DNA), and the mixture was incubated at room temperature for 2 min; (14) The mixture was centrifuged at 12000 rpm for 2 min at room temperature to elute the DNA attached to the membrane of the nucleic acid purification column, and the eluted DNA was stored at -40 °C for later use; (15) The recovered product was detected by 1% agarose gel electrophoresis to determine the quality of the extracted plasmid.

[0041] 1.7 Sequencing

[0042] The plasmid extracted from the above positive bacterial plaques was subjected to Sanger sequencing using the sequencing primers UBI-F / eGFP-cx. The sequencing results showed that the sequence matched the target fragment sequence, indicating that the overexpression vector was successfully constructed.

[0043] The constructed pEGOEPubi-H-LOC107841648-GFP vector map is shown below. Figure 1 As shown, the vector restriction enzyme digestion pattern is as follows: Figure 2 As shown (EcoRI / HindIII digestion: 8906bp, 1524bp, 2103bp; Marker: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp).

[0044] 1.8 Transformation of Agrobacterium

[0045] The constructed pEGOEPubi-H-LOC107841648-GFP vector was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method to obtain recombinant Agrobacterium.

[0046] 2. Infection of Arabidopsis thaliana

[0047] Arabidopsis thaliana was infected using the flower-dipping method. Arabidopsis thaliana The Colombian wild-type (Col-0) was obtained using the following method: 800 μL of antibiotic-free LB medium was added to a centrifuge tube containing recombinant Agrobacterium, and the tube was incubated at 28°C and 180 rpm for 2–3 h. The tube was then centrifuged at 5,000 rpm for 1 min to collect the bacterial cells. Approximately 700 μL of the supernatant was discarded, and the bacterial cells were gently resuspended using a pipette. Subsequently, the bacterial suspension was evenly spread on the surface of LB medium containing Rif and Kan. Invert the plates and incubate at 28℃ for 2-3 days. Single colonies are picked from the plates and transferred to LB liquid medium containing Rif and Kan resistance. After incubation at 28℃ and 180 rpm for 2-3 days, single colonies are picked and cultured. After PCR identification, bacteria are selected and propagated in LB liquid medium containing both Rif and Kan resistance until OD600 = 1.0-1.4. The bacterial weight is collected and placed in a 5% sucrose solution (prepared immediately). 0.01% of the surfactant Silwet L-77 is added, and the bacterial solution is adjusted to OD600 = 0.6-0.8. Healthy 4-week-old Arabidopsis plants are selected, and the pods are removed. The inflorescences are infected in the dark for 60 seconds, followed by 24 hours of dark treatment and then light cultivation. The plants are reinfected after one week, and the inflorescences are harvested when the pods mature.

[0048] The T0 generation seeds were collected in dry centrifuge tubes, dried and stored for later use. After soaking in 5% sodium hypochlorite for 5 min and rinsing with sterile water for 5 times, the seeds were spread on 1 / 2MS solid medium containing hygromycin resistance for screening, and cultured for about 10 days. The healthy seedlings were transplanted into nutrient soil, and the T1 generation seeds were collected. The T2 generation seeds were collected by further planting and screening with hygromycin, and finally the T3 generation homozygous seeds were collected.

[0049] 3. Obtaining of Arabidopsis thaliana plants

[0050] The obtained T3 generation Arabidopsis thaliana seeds were placed in a 1.5 mL centrifuge tube, 1 mL distilled water was added, and then the seeds were vernalized at 4°C for 3 days. The vernalized seeds were placed in a long-day culture room (light 16h / dark 8h, 22°C), and water was poured every 2 days. After 30 days, the serial numbers of each Arabidopsis thaliana plant were marked, and the leaf DNA was extracted one by one. PCR detection was performed, and a total of 10 transgenic lines were obtained. The T3 generation homozygous transgenic lines were detected by qRT-PCR, and the expression amounts in each line were analyzed. LOC107841648 Three plants (L1, L2, L3) with high expression were selected from the lines for later analysis.

[0051] The method used for DNA extraction was CTAB method, and the specific steps were as follows: ① Take 2-3 fresh Arabidopsis thaliana leaves and quickly put them into a 2 mL centrifuge tube containing steel balls cooled by liquid nitrogen. After grinding by a ball mill, add 1 mL of preheated (65°C) mixed solution (1 mL CTAB and 200 μL β-mercaptoethanol) to each tube, and incubate at 65°C for 45 min, mix well every 5 min, centrifuge at 12000 rpm for 10 min. ② Take the supernatant, add an equal volume of chloroform, mix well and stand for 12 min, centrifuge at 12000 rpm for 10 min. ③ Repeat step ②, add 2 times the volume of anhydrous ethanol to the supernatant, mix well and place in a -20°C refrigerator for 45 min. The white solid at the bottom of the centrifuge tube is the genomic DNA precipitate. Centrifuge at 12000 rpm for 10 min, and discard the supernatant. ④ Wash the DNA precipitate with 1 mL of 75% ethanol for 3 times, centrifuge at 12000 rpm for 5 min, discard the supernatant, and dry the precipitate at room temperature until it becomes translucent. ⑤ Add 40 μL of ddH2O to dissolve the precipitate, and add 0.5 μL of RNase, and stand at room temperature for 30 min. ⑥ Perform agarose gel electrophoresis to detect the genomic DNA, and store the DNA at -20°C for later use.

[0052] The primers UBI-F and eGFP-cx were used for PCR detection, and the detection system is shown in Table 7, and the detection procedure is shown in Table 8.

[0053] Table 7 PCR detection system

[0054] Table 8 PCR Detection Procedure

[0055] The primers used for qRT-PCR detection are: F: CCTGTCAAGTGCTGGCCTCATTAC (SEQ ID NO.7) R: GAGAGGAGCAACGCCTTGTGAAG (SEQ ID NO.8) The primers for the internal reference gene are: F: CTCCTTTGTTGCTGTTGACTAC (SEQ ID NO.9) R: GACAATGTTACCGTACAGATC (SEQ ID NO.10) RNA was first extracted using the EZNA® Plant RNA Kit, and then reverse transcribed into cDNA using the Novizan kit before qRT-PCR detection. The detection system and procedure are shown in Tables 9-10.

[0056] Table 9 qRT-PCR detection system

[0057] Table 10 qRT-PCR Detection Procedure

[0058] qRT-PCR test results are as follows Figure 3 As shown, compared with wild-type Arabidopsis, L1, L2, and L3 plants... LOC107841648 The expression level in it increased significantly.

[0059] Example 2

[0060] Transgenic Arabidopsis thaliana (L1, L2, L3) and wild-type (WT) Arabidopsis thaliana seedlings were used as experimental materials. Arabidopsis thaliana seedlings with uniform growth were selected and submerged in water, with the water level reaching the boundary between the seedlings and the soil surface. After two days of submersion, the seedlings were removed for recovery. Samples were taken at three time points: before submersion (0d, CK), two days after submersion (2d, T1), and one day after recovery (R1d, T2). 0.1g of sample was taken in each 2mL centrifuge tube. Photos were taken daily for observation. The experiment was repeated three times, with six seedlings measured in each replicate. Relevant growth and physiological indicators were measured.

[0061] 1. Phenotypic observation

[0062] like Figure 4As shown, after the flooding treatment, L1, L2 and L3 have higher tiller number and plant height compared with WT; before the flooding, the leaves of transgenic and wild-type Arabidopsis are green, the plants are strong, and the overall growth is healthy. After 2 days of flooding, the leaves of wild-type Arabidopsis turn purple, the leaves become thin and start to curl, while the transgenic Arabidopsis has no obvious change. After 1 day of recovery, the purple of wild-type Arabidopsis becomes lighter, the leaves turn yellow and withered, while only a few leaves of transgenic Arabidopsis turn yellow and curl. This shows that transgenic Arabidopsis has better waterlogging tolerance.

[0063] 2. Relative conductivity content

[0064] The relative conductivity content is an important bioelectricity index for evaluating the damage of plant cell membrane, reflecting the integrity and permeability of cell membrane. For example, Figure 5 As shown, the relative conductivity content of WT is significantly higher than that of L1, L2 and L3 at T1 and T2, indicating that the damage degree of WT after flooding treatment is significantly higher than that of transgenic materials, indicating that transgenic materials have the ability to resist waterlogging stress.

[0065] 3. Relative chlorophyll content

[0066] As shown, Figure 6 there is no obvious difference in chlorophyll content between transgenic and wild-type Arabidopsis before flooding stress treatment. However, after flooding stress, the chlorophyll content of transgenic and wild-type plants shows a downward trend, and the wild-type plants show a significantly higher degree of decline than the transgenic plants. After 1 day of recovery culture, the chlorophyll content of transgenic and wild-type plants has increased, and the chlorophyll content of transgenic plants is significantly higher than that of wild-type plants. This shows that overexpression LOC107841648 of the gene improves the active oxygen scavenging capacity of the plant and accumulates higher chlorophyll content to resist waterlogging stress.

[0067] 4. Soluble sugar content

[0068] As shown, Figure 7 there is no obvious difference in soluble sugar content between transgenic and wild-type Arabidopsis before flooding stress treatment. After flooding stress, the soluble sugar content of transgenic and wild-type plants shows an upward trend, and the transgenic plants show a significantly higher degree of increase than the wild-type plants. After 1 day of recovery culture, the soluble sugar content of transgenic and wild-type plants continues to rise, and the soluble sugar content of transgenic plants is significantly higher than that of wild-type plants. This shows that overexpression LOC107841648 of the gene can make the plant accumulate more soluble sugar to resist waterlogging stress.

[0069] 5. Peroxidase (POD) activity

[0070] As shown, Figure 8As shown in the figure, there is no obvious difference in the POD activity between the transgenic Arabidopsis and the wild-type Arabidopsis before the flooding stress treatment. After the flooding stress treatment, the POD activity of the transgenic plants and the wild-type plants shows an upward trend, and the upward degree of the transgenic plants is significantly higher than that of the wild-type plants. After recovery culture for 1 day, the POD activity of the transgenic plants and the wild-type plants continues to rise, and the POD activity of the transgenic plants is significantly higher than that of the wild-type plants. This shows that the overexpression of the gene can make the plants improve the POD activity to resist the flooding stress. LOC107841648

[0071] The above merely describes the preferred embodiments of the present application, and it should be noted that, for those skilled in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.​

Claims

1. Capsicum annuum LOC107841648 application of the gene in improving the waterlogging tolerance of plants, characterized in that, The pepper LOC107841648 The CDS sequence of the gene is shown as SEQ ID NO.

2.

2. Use according to claim 1, characterized in that, The plants include Arabidopsis thaliana and Capsicum annuum.

3. A method for improving the waterlogging tolerance of plants, characterized in that, The pepper LOC107841648 The CDS sequence of the gene is shown as SEQ ID NO.

2. LOC107841648 The CDS sequence of the gene is shown as SEQ ID NO.

2.

4. The method of claim 3, wherein, The plants include Arabidopsis thaliana and Capsicum annuum.

5. The method of claim 3, wherein, The plant overexpression vector containing the pepper LOC107841648 gene is introduced into the target plant.

6. The method of claim 3, wherein, The method of introduction is by pollen dip.

Images