Application of tobacco auxin binding protein gene NtABP19a in regulation and control of salt stress germination of tobacco seeds

Abstract

The invention discloses application of a tobacco auxin binding protein gene NtABP19a in regulation and control of salt stress germination of tobacco seeds, and belongs to the technical field of tobacco gene engineering. The CDS sequence of the gene is as shown in SEQ ID NO. 1. Under the stress of 150mM NaCl, the expression quantity of NtABP19a in the tobacco seeds is obviously increased along with the prolonging of treatment time; the tobacco mutant of which the gene is knocked out has obviously reduced seedling rate compared with a wild type under salt stress, and can be used for creating salt-sensitive tobacco strains. Meanwhile, the NtABP19a is prompted to positively regulate the biological function of the salt tolerance of the tobacco seeds, the germination ability of the seeds in saline-alkali soil can be enhanced by up-regulating the expression of the NtABP19a through a genetic engineering means, and a key gene resource and a technical path are provided for cultivating salt-tolerant tobacco varieties. The method is of great significance to tobacco salt-resistant breeding and saline-alkali land utilization.

Description

Technical Field

[0001] This invention relates to the field of tobacco genetic engineering technology, specifically to a tobacco auxin-binding protein gene. NtABP19a Application in regulating the germination of tobacco seeds under salt stress. Background Technology

[0002] tobacco( Nicotiana tabacum Tobacco is an important economic crop in my country. During its seed germination and seedling emergence stages, salt precipitation can cause damage, affecting the seedling survival rate. In the field, salt stress can also lead to a decline in yield and quality. Therefore, identifying endogenous salt-resistant genes in tobacco to improve seed germination rate, seedling survival rate, and overall yield and quality under salt stress has become a crucial requirement for ensuring the sustainable development of tobacco production.

[0003] Existing research indicates that plant hormones, particularly auxins (IAAs), play a crucial role in regulating stress responses. Their signaling pathways enhance plant salt tolerance by sensing and transducing environmental stress signals, activating protective gene expression, maintaining root conformational plasticity, and balancing reactive oxygen species metabolism. Auxin-binding protein 1 (ABP1), a classic auxin receptor, is primarily located in the cell membrane system and rapidly mediates auxin signaling through a non-transcriptional cascade pathway, regulating cell polarity expansion and division. However, current research on the function of the tobacco ABP1 gene in salt stress response, both domestically and internationally, remains lacking. Whether it participates in the regulation of tobacco salt tolerance and, through what mechanism, it remains unclear.

[0004] Although some transcription factors or functional genes have been used in tobacco salt-tolerant breeding, traditional single-gene strategies often have limited salt-tolerant effects due to the single regulatory pathway. Furthermore, most studies focus on transcriptional regulation, neglecting the contribution of the rapid auxin sensing pathway in tobacco salt stress. Therefore, elucidating the expression pattern, functional mechanism, and interaction between the tobacco ABP1 gene and auxin signaling under salt stress will not only fill a research gap in this field but also provide key gene resources and technical pathways for creating new, highly efficient salt-tolerant tobacco germplasm. Summary of the Invention

[0005] The purpose of this invention is to provide a tobacco auxin-binding protein gene. NtABP19a Its application in regulating the germination ability of tobacco seeds under salt stress helps to regulate the sensitivity of tobacco to salt tolerance and can be used to create strains with enhanced salt tolerance or sensitivity. To achieve the above objectives, the present invention provides a tobacco auxin-binding protein gene. NtABP19a Application in improving the germination ability of tobacco seeds under salt stress. NtABP19a The CDS nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] This invention also provides a tobacco auxin-binding protein gene. NtABP19a Its application in creating salt-sensitive tobacco strains involves knocking out... NtABP19a Genetic acquisition of salt-sensitive tobacco lines was achieved.

[0007] This invention also provides a tobacco auxin-binding protein gene. NtABP19a Application in screening salt-tolerant tobacco germplasm resources, by detecting the salt content of the target tobacco species. NtABP19a Whether genes are mutated, deleted, or silenced is used to determine the germination ability and seedling efficiency of tobacco under salt stress.

[0008] Furthermore, in the above applications, when the tobacco to be tested contains... NtABP19a When a gene loses its function, the tested tobacco strain exhibits decreased salt tolerance.

[0009] This invention also provides a method for enhancing the germination ability of tobacco seeds under salt stress by upregulating the salt content of tobacco through genetic engineering. NtABP19a Gene expression is achieved.

[0010] This invention also provides a method for creating salt-sensitive tobacco strains, using gene knockout technology to eliminate the salt-sensitive tobacco gene. NtABP19a Genetic implementation.

[0011] The gene knockout technology used in the above method is preferably CRISPR / Cas9 technology, wherein the nucleotide sequence of the target site used for knockout is selected from any one of SEQ ID NO.7-9.

[0012] This invention also provides a method for screening salt-tolerant tobacco germplasm resources, comprising the following steps: (1) Extract genomic DNA from the tobacco samples to be tested; (2) Detection NtABP19a The integrity or expression status of genes; (3) If the gene is not mutated, deleted and normally expressed, it is determined to be a candidate germplasm for salt tolerance; if the gene is mutated, deleted or silenced, it is determined to be a germplasm with decreased salt tolerance.

[0013] The present invention has the following advantages: This study reveals for the first time the biological function of the NtABP19a gene in positively regulating salt tolerance in tobacco seeds, elucidating its upregulated expression under salt stress, which will help to further explore the molecular mechanisms by which plant auxin signaling pathways participate in salt tolerance regulation.

[0014] The results of this invention suggest that the NtABP19a gene functions through a rapid auxin sensing pathway, providing a novel key gene resource for the breeding of salt-tolerant tobacco varieties. Upregulating its expression through genetic engineering can significantly enhance the germination ability of seeds in saline-alkali soil, thereby improving breeding efficiency and effectiveness.

[0015] This invention cultivates salt-tolerant varieties by upregulating the expression of target genes, and can also create salt-sensitive lines by knocking out the gene. In addition, it can be used as a screening marker for the rapid identification of salt-tolerant tobacco germplasm resources. Its application scenarios cover multiple links such as breeding and germplasm screening, and it is highly practical. Attached Figure Description

[0016] Figure 1 Tobacco in this invention NtABP19a Gene expression at different times during seed salt treatment.

[0017] Figure 2 This is a statistical result showing the germination of seeds from wild tobacco and gene mutant plants under normal culture and salt stress, respectively, in this invention. Detailed Implementation

[0018] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0019] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0020] Example 1 Tobacco NtABP19a Gene expression analysis Seeds of wild-type tobacco variety K326 were selected and treated with 150 mM NaCl for 0, 1, 2, 3, 4, 5, 6, 7, and 8 days, respectively. After treatment, the seeds were frozen in liquid nitrogen and then quickly ground into powder. The powder samples were stored at -80 °C. The experiment was repeated three times.

[0021] RNA was extracted from each sample; cDNA was generated by reverse transcription using the HiScript® II Reverse Transcriptase system (Vazyme Biotech Co., Ltd). Using the cDNA as a template, quantitative real-time PCR was performed on tobacco auxin-binding protein. NtABP19a We will analyze the expression of [the information].

[0022] Among them, the NtABP19aThe CDS nucleotide sequence of the gene is shown in SEQ ID NO.1, and its encoded amino acid sequence is shown in SEQ ID NO.2. The specific sequences are as follows: A quantitative real-time PCR detection method was designed. NtABP19a The primer sequences are as follows: the upstream primer nucleotide sequence is shown in SEQ ID NO.3, and the downstream primer nucleotide sequence is shown in SEQ ID NO.4. The tobacco internal reference gene was used. EF1A The primers have the following nucleotide sequences: the upstream primer is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6. All nucleic acid sequences are in the 5'-3' orientation.

[0023] NtABP19a Gene CDS sequence (SEQ ID NO.1): .

[0024] NtABP19a The amino acid sequence encoded by the gene (SEQ ID NO.2): MFFQAFFIFSLLFLSSDAAVLDFCVGDLSVPDGPGGYACKKPSAVTANDFVFSGLATPVKLNPLIKAAVTPAFAPQFPGLNGLGISMARLDLAIGGVIPMHTHPGASEVLYVVTGEICAGFISSSDNKVFFKNLKQGDIMVFPQGLLHFQINSGKTTGLAIVSFSSPTPGLQITDFALFANDLATELVQATTFLDAATIKKLKGVLGGTN.

[0025] NtABP19a Upstream primer for quantitative gene sequencing (SEQ ID NO.3): AAGTTGAAGGGTGTCCTTGGTG; NtABP19a Gene fluorescence quantitative downstream primer (SEQ ID NO.4): ACAACAACAACTACGCCTGTGTC; Fluorescent quantitative internal control primer F (SEQ ID NO.5): AGCTTCACCACCCAGGTCATC; Fluorescent quantitative internal control primer R (SEQ ID NO.6): AGAACGCCTGTCAATTCTTGG.

[0026] Obtain tobacco NtABP19a Gene expression at different times during seed salt treatment, as follows: Figure 1 As shown, the results indicate that during seed salt treatment germination... NtABP19a The gene expression levels showed a gradually upward trend, indicating that as the germination time of seed salt treatment increased, NtABP19a The gradual increase in gene expression indicates that ABP19a gene expression is induced by salt stress, suggesting that it may play a regulatory role in the salt-tolerant germination process of seeds.

[0027] Example 2 Tobacco NtABP19a Construction of gene mutants Based on the target gene sequence, gDNA targets were screened using conventional methods. Three gDNA targets were selected, and their primer nucleotide sequences are shown in SEQ ID NO.7-9. Amplification primers were designed based on the sequences corresponding to the targets. PCR products containing the target targets were amplified using a Vazyme P520 (Vazyme Biotech Co., Ltd.). The PCR products were purified and recovered, and then constructed into the pHSbdcas9i vector using T4 ligase.

[0028] Knockout target 1 (SEQ ID NO.7): TTTCCAGGACTTAACGGTCTTGG; Knockout target 2 (SEQ ID NO.8): AGGCTAGATTTAGCTATAGGTGG; Knockout target 3 (SEQ ID NO.9): GTGACTGCGGCTTTAATGAGAGG.

[0029] The obtained containing the target gene NtABP19a The pHSbdcas9i vector plasmid targeting the target was transformed into Agrobacterium. The Agrobacterium carrying the transformation plasmid was then transformed into wild-type tobacco variety K326. Homozygous mutants were screened by PCR amplification using homozygous mutant screening primers and sequenced. Homozygous mutants were screened by comparison with the wild-type. The upstream primer F sequence is shown in SEQ ID NO. 10, and the downstream primer R sequence is shown in SEQ ID NO. 11. After identification of the transfected tobacco mutants, two tobacco genes were obtained. NtABP19a mutant Ntabp19a-1 , Ntabp19a-2 .

[0030] Screening primer F (SEQ ID NO.10): TATGTCGTTTCCTTCGTACC; Screening primer R (SEQ ID NO.11): TCTGGAAATGCAACAACCCT.

[0031] Example 3 Tobacco NtABP19a Phenotypic analysis of gene mutant materials Using the constructed NtABP19a CRISPR / Cas9 mutant Ntabp19a-1 , Ntabp19a-2Germination tests were conducted on wild-type tobacco variety K326 (WT). The specific method was as follows: Healthy, plump seeds were repeatedly selected and placed in petri dishes. 8 mL of distilled water (control treatment) and 8 mL of 150 mM NaCl solution (salt stress treatment) were added respectively. The dishes were then incubated at 25 ℃ under light / dark conditions for 12 hours each. After germination for 6 days in both treatments, the seedling rate was calculated. The results are shown below. Figure 2 As shown, where, Figure 2 In the diagram, A represents the phenotypic representation of seed germination and seedling development. Figure 2 B in the figure represents the seedling survival rate statistics.

[0032] In summary, under 150 mM NaCl stress, tobacco seeds... NtABP19a Expression levels were significantly upregulated with prolonged treatment time; the seedling survival rate of mutants with this gene knocked out under salt stress was significantly lower than that of the wild type, demonstrating that... NtABP19a This gene has a biological function that positively regulates salt tolerance in tobacco seeds. This invention reveals for the first time... NtABP19a Genes can enhance the germination ability of tobacco seeds in saline-alkali soil through the auxin signaling pathway, providing key genetic resources for breeding salt-tolerant tobacco varieties. Upregulation can be achieved through genetic engineering. NtABP19a The expression can effectively improve the salt stress resistance of tobacco seeds and has important value for tobacco salt-resistant breeding and saline-alkali land utilization.

[0033] Through the disclosure of this invention, it is suggested that... NtABP19a Genes associated with tobacco salt tolerance help elucidate the molecular mechanisms by which tobacco responds to salt stress, providing a basis for further research. NtABP19a The study of gene function has profound implications.

[0034] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A tobacco auxin binding protein gene NtABP19a application in improving the salt stress germination ability of tobacco seeds, said NtABP19a The CDS nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. A tobacco auxin binding protein gene NtABP19a Use in the creation of salt-sensitive tobacco lines, characterized in that, A salt-sensitive tobacco strain is obtained by knocking out the gene NtABP19a The CDS nucleotide sequence of the gene is shown as SEQ ID NO.

1. NtABP19a The CDS nucleotide sequence of the gene is shown as SEQ ID NO.

1.

3. A tobacco auxin binding protein gene NtABP19a In the application of screening tobacco salt-tolerant germplasm resources, characterized in that, By detecting the aforementioned in the tobacco sample NtABP19a Whether genes are mutated, deleted, or silenced is used to determine the germination ability and seedling efficiency of tobacco under salt stress; wherein, the aforementioned NtABP19a The CDS nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. Use according to claim 3, characterized in that, When the gene function of the gene in the to-be-tested tobacco is lost NtABP19a The to-be-tested tobacco is a salt tolerance decreased strain.

5. A method of creating a salt-sensitive tobacco line, characterized in that, Adopt gene knockout technology to knock out the gene in tobacco NtABP19a The CDS nucleotide sequence of the gene is shown as SEQ ID NO.

1. NtABP19a The CDS nucleotide sequence of the gene is shown as SEQ ID NO.

1.

6. The method of claim 5, wherein, The gene knockout technology is selected from the CRISPR / Cas9 technology.

7. The method of claim 6, wherein, The CRISPR / Cas9 uses the nucleotide sequence of any one of SEQ ID NO. 7-9 for knocking out the target point.

Images