Method for obtaining heat-resistant grape germplasm by transgenosis of grape zygotic embryo
By using the genetic transformation method of grape zygotic embryos and introducing the heat-resistant gene GP1 into the grape genome, the difficulties in induction and material limitations of traditional grape genetic transformation have been solved, achieving efficient introduction of heat-resistant traits and simplifying the grape breeding process.
Patent Information
- Application Number
- CN202511451699.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-11
- Publication Date
- 2026-01-16
AI Technical Summary
Among existing methods for genetic transformation of grapes, embryogenic callus induction is difficult, costly, and has low transformation efficiency. The recipient materials are limited, the process is complex and the cycle is long, making it difficult to achieve efficient breeding.
Genetic transformation was performed using grape zygotic embryos. A plant overexpression vector was constructed using the heat-resistant gene GP1 and introduced into the grape genome via Agrobacterium-mediated transformation, directly obtaining heat-resistant grape germplasm. This simplified the operation process and expanded the source of materials.
It reduced manpower and material costs, improved conversion efficiency, expanded the range of recipient materials, achieved efficient introduction of heat-resistant traits, and simplified the grape breeding process.
Smart Images

Figure CN121344086A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of agricultural biotechnology and plant genetic engineering, and more specifically, to a method for obtaining heat-resistant grape germplasm through transgenic processing of grape zygotic embryos. Background Technology
[0002] Grapes are warm-loving plants but intolerant of high temperatures. Their growth, development, and fruit quality are extremely susceptible to the negative effects of summer heat stress. Developing new grape varieties with heat-resistant characteristics has become a critical issue that urgently needs to be addressed in grape breeding. Traditional hybridization breeding methods are the main means of improving grape traits, but they suffer from drawbacks such as long breeding cycles, severe segregation of traits in offspring, and limitations imposed by germplasm resources. With the rapid development of plant genetic engineering technology, directly introducing exogenous superior genes into the grape genome through genetic transformation to create new germplasm with specific target traits (such as heat resistance) has become a highly efficient and precise breeding approach.
[0003] Currently, the main methods for grape genetic transformation include Agrobacterium-mediated transformation and gene gun methods, with Agrobacterium-mediated transformation being the most widely used. However, grapes are woody plants that are difficult to genetically transform, and their transformation efficiency is limited by the recipient's genetic background and the type of recipient material. In existing technologies, commonly used recipient materials are embryogenic callus tissue or embryogenic cell lines. Although transgenic grape plants have been successfully obtained using these materials, existing technologies still have the following problems:
[0004] First, the induction and long-term maintenance of embryogenic callus are extremely difficult. The induction rate of embryogenic callus in grapes is highly dependent on genotype, and the induction process is cumbersome and time-consuming. More importantly, embryogenic callus is prone to losing its embryogenic differentiation capacity (i.e., somatic embryogenesis capacity) during long-term subculture, leading to a significant decrease in transformation efficiency over time, or even complete failure. This requires researchers to invest a great deal of manpower and resources in frequent subculture and system maintenance, which is costly and unstable.
[0005] Second, the establishment of superior embryogenic cell lines is highly contingent and limited. Not all varieties can successfully induce embryogenic callus suitable for transformation, which severely restricts the range of grape genotypes that can be used for transformation, making it difficult to achieve genetic improvement of many superior varieties.
[0006] Third, the transformation process is complex and time-consuming. Existing transformation systems using embryogenic callus as the recipient typically require a lengthy process: first, inducing embryogenic callus, then co-culturing with Agrobacterium, selecting for resistance, regenerating embryoids, and finally developing into seedlings. The entire process can take months or even more than a year, resulting in low efficiency.
[0007] Therefore, there is an urgent need for a new method for grape genetic transformation that does not rely on long-term subculture, has a wide range of recipient materials, is easy to operate, and has high transformation efficiency, so as to accelerate the molecular breeding process of grape gene function research and stress resistance and other excellent traits.
[0008] Therefore, this application provides a method for obtaining heat-resistant grape germplasm through transgenic processing of grape zygotes to solve the above-mentioned problems. Summary of the Invention
[0009] The purpose of this invention is to solve the technical problems mentioned in the background section and to provide a method for obtaining heat-resistant grape germplasm through transgenic processing of grape zygotic embryos.
[0010] The above-mentioned objective of the present invention is achieved as follows:
[0011] A method for obtaining heat-resistant grape germplasm through transgenic processing using grape zygotic embryos includes the following steps:
[0012] S1. Vector construction and infection solution preparation: The thermostable gene GP1 was constructed into a plant overexpression vector, transformed into Agrobacterium tumefaciens, and an infection solution containing the recombinant engineered strain was prepared.
[0013] S2. Extraction of zygotic embryos: Take seeds of diploid Eurasian grapes about 60 days after flowering, disinfect them, cut them open, and extract the zygotic embryos.
[0014] S3. Genetic transformation: The zygotic embryos obtained in step S2 are chopped and placed in the infection solution obtained in step S1 for infection treatment. Then, they are placed on sterile filter paper moistened with liquid DM medium for co-culture. After co-culture, they are destered and then transferred to solid DM medium to induce embryogenic callus.
[0015] S4. Cultivation of heat-resistant transgenic plants: The embryogenic callus induced in step S3 is transferred to X6 medium to induce embryoids, and then the embryoids are placed on seedling medium for culture to obtain heat-resistant transgenic grape plants.
[0016] Furthermore, the heat-resistant gene GP1 mentioned in step S1 is the Ahsa1 gene, and its nucleotide sequence is shown in SEQ ID NO: 1.
[0017] Furthermore, the plant overexpression vector in step S1 is pCAMBIA2300, and the Ahsa1 gene is inserted into it through the Xba I and Kpn I restriction sites to construct the recombinant plasmid pCAMBIA2300-Ahsa1.
[0018] Furthermore, the Agrobacterium tumefaciens mentioned in step S1 is strain GV3101.
[0019] Furthermore, the infection solution described in step S1 is prepared by the following method: Agrobacterium tumefaciens containing recombinant plasmid is resuspended in DM liquid medium and the OD600 value is adjusted to 0.4-0.6. Then, acetylsyl syringone with a final concentration of 100 μM is added to the resuspended solution and it is left to stand at 25°C for 2-3 hours before use.
[0020] Furthermore, the DM liquid culture medium is composed of the following components in the following amounts: DKW basal medium, 2.0 mg / L thiamine hydrochloride, 2.0 mg / L glycine, 1.0 mg / L nicotinic acid, 0.3 g / L KNO3, 1.0 g / L inositol, 30 g / L sucrose, 5.0 μM 6-BA, 2.5 μM NAA and 2.5 μM 2,4-D, with a pH of 5.7.
[0021] Furthermore, the specific disinfection process described in step S2 is as follows: first disinfect the peeled seeds with 70% alcohol for 30 seconds, rinse them with sterile water 2-3 times, then soak the seeds in a solution containing 5% NaClO and 0.1% Tween-20 for 15 minutes, and finally rinse them with sterile water 3-5 times.
[0022] Furthermore, the infection treatment time in step S3 is 7-10 minutes; the co-culture time is 3 days; both the co-culture and the induction of embryogenic callus are carried out under dark culture conditions at 25℃.
[0023] The sterilization process described in step S3 involves washing with sterile water containing 500 mg / L carbenicillin and 500 mg / L cephalosporin; the solid DM culture medium also contains 200 mg / L carbenicillin and 200 mg / L cephalosporin.
[0024] Furthermore, the X6 culture medium in step S4 consists of the following components: MS-glycine-NH4NO3, 3.033 g / L KNO3, 0.364 g / L NH4Cl, 60.0 g / L sucrose, 1.0 g / L inositol, 7.0 g / L agar, and 0.5 g / L activated carbon, with a pH of 5.8; during the induction of embryoid culture, 75 mg / L kanamycin is also added to the X6 culture medium for resistance screening;
[0025] The seedling culture medium mentioned in step S4 is an embryo germination culture medium, which consists of the following components: MS medium, 0.1 g / L inositol, 20 g / L sucrose, 7.0 g / L agar and 0.2 mg / L 6-BA, with a pH of 5.8.
[0026] Furthermore, after obtaining heat-resistant transgenic grape plants in step S4, the method further includes the following steps:
[0027] The plants obtained from the seedling culture medium were transferred to the subculture culture medium for further propagation, and the DNA of each line was extracted. The obtained lines were then tested for positive results using vector-specific primers.
[0028] The subculture medium consists of the following components in the following proportions: 1 / 2 MS medium, 0.02 mg / L 6-BA, 0.2 mg / L IBA, 30 g / L sucrose, 8.0 g / L agar and 0.5 g / L activated carbon, with a pH of 5.8.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] The zygotic embryo in this invention is derived from diploid Eurasian grapes approximately 60 days after flowering. Compared to existing methods that use embryogenic callus induced from seedless white anthers for genetic transformation, this invention offers the following advantages:
[0031] (1) The source of materials is wide and most Eurasian grape varieties can be genetically transformed using this method, which solves the limitation of traditional methods that can only use a few varieties such as seedless white grapes;
[0032] (2) Compared with the huge amount of work required to peel the anthers in the traditional method, the method of the present invention greatly reduces the workload;
[0033] (3) Traditional methods require inducing embryogenic callus to form embryoids, and then using embryoids to re-induce embryogenic callus, and so on to achieve the purpose of long-term preservation of materials. The method of the present invention does not require cyclic induction. It only needs to preserve grape fruits about 60 days after flowering. When needed, the embryo can be removed for transformation. It does not require a large amount of culture medium for subculture and induction, thus reducing manpower and material costs.
[0034] In summary, the method of the present invention effectively overcomes the shortcomings of traditional genetic transformation technology, and can achieve genetic transformation without long-term subculture preservation of embryogenic callus tissue, saving manpower and material resources, and greatly expanding the source of raw materials. It has high transformation efficiency and ease of operation. Attached Figure Description
[0035] Figure 1 This is a diagram illustrating the zygotic embryo, which was peeled off and placed on X6 culture medium in an embodiment of the present invention.
[0036] Figure 2 It is the zygote embryo infected with Agrobacterium in the embodiments of the present invention;
[0037] Figure 3 In this embodiment of the invention, embryogenic callus is induced on solid DM culture medium;
[0038] Figure 4 These are embryoids grown on X6 culture medium supplemented with antibiotics in the embodiments of the present invention;
[0039] Figure 5 These are plants grown on seedling culture medium in the embodiments of the present invention;
[0040] Figure 6 These are transgenic lines on the subculture medium in the embodiments of the present invention;
[0041] Figure 7 This embodiment of the invention uses PCR to detect whether the transgenic line is a positive plant. Detailed Implementation
[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0043] The implementation of the present invention will be described in detail below with reference to specific embodiments.
[0044] Reference Figures 1-7 The image shown is a preferred embodiment of the present invention.
[0045] Example: This embodiment of the invention provides a method for obtaining heat-resistant grape germplasm through transgenic processing of grape zygotic embryos, comprising the following steps:
[0046] Step 1: Construct a heat-resistant overexpression vector and transform it into Agrobacterium tumefaciens to prepare an infection solution;
[0047] Step 2: Extract the grape zygotic embryo;
[0048] Step 3: Agrobacterium-mediated transformation of zygotes;
[0049] Step 4: Obtain heat-resistant transgenic plants.
[0050] In step 1, the specific steps for constructing the thermostable overexpression vector and transforming it into Agrobacterium tumefaciens to prepare the infection solution are as follows:
[0051] Step 1.1: Construct the overexpression vector: The thermostable gene is Ahsa1 (Vitvi08g01757), and its sequence is:
[0052] SEQ ID NO: 1:
[0053]
[0054] The coding region sequence of Ahsa1 was amplified by PCR from the cDNA of the heat-resistant wild Chinese grape 'Guidong' using upstream and downstream specific primers with added homologous arms and restriction enzyme sites. The pCAMBIA2300 vector plasmid was digested with Xba I and Kpn I. The PCR products and enzyme digestion products were subjected to 1.0% agarose gel electrophoresis, and the target band was recovered by gel excision. A 20 µL ligation reaction system was constructed and reacted at 37 ℃ for 30 min. The ligation product was transformed into E. coli DH5α competent cells by heat shock and evenly spread on LB solid medium containing 100 mg / L kanamycin. The cells were incubated upside down at 37 ℃ for 16 h. Single colonies were picked and transferred to LB liquid medium containing the same concentration of kanamycin and incubated with shaking at 37 ℃ for 14 h. After bacterial PCR detection and plasmid restriction enzyme detection, the overexpression vector was successfully constructed and named pCAMBIA2300-Ahsa1.
[0055] Step 1.2: Transformation of Agrobacterium tumefaciens with overexpression vector: Transform Agrobacterium tumefaciens GV3101 competent cells with pCAMBIA2300-Ahsa1 vector, spread evenly on LB solid medium containing 100 mg / L Kan and 50 mg / L rifampin, and incubate upside down at 28 ℃ for 48 h. Pick single colonies and transfer them to LB liquid medium containing the same antibiotics of the same type and concentration, and incubate at 28 ℃ with shaking for 24-48 h. Perform bacterial PCR amplification using gene-specific primers, and perform 1.0% agarose gel electrophoresis. If the PCR product is a 1044bp fragment, the thermostable plant overexpression vector engineered strain has been successfully transformed.
[0056] Step 1.3: Preparation of Infection Solution: Take 10 µL of Agrobacterium tumefaciens GV 3101 bacterial culture containing the plant overexpression vector pCAMBIA2300-Ahsa1 and add it to 1 mL of liquid LB medium containing 50 mg / L rifampin, 100 mg / L gentamicin, and 100 mg / L kanamycin. Incubate at 28 ℃ and 180 rpm for 24-48 h to activate the culture. Then, take 200 µL of the activated bacterial culture and add it to 50 mL of liquid LB medium containing 50 mg / L rifampin, 100 mg / L gentamicin, and 100 mg / L kanamycin. Incubate at 28 ℃ and 180 rpm for 8-12 h until the OD600 is approximately 0.6-0.8. Collect the cultured bacterial suspension in a 50 mL sterile centrifuge tube, centrifuge at 8000 rpm for 5 min, discard the supernatant, wash once with 5 mL of DM liquid medium, and then resuspend in DM liquid medium to an OD600 of approximately 0.4-0.6. Add 100 mM acetylsylgenone to the resuspended suspension. Incubate the resuspended bacterial suspension at 25℃ for 2-3 h. The concentration of the resuspended bacterial suspension directly affects the transformation success rate; too low a concentration can lead to unsuccessful infection, while too high a concentration can cause necrosis of the zygote.
[0057] In this implementation scheme, the heat-resistant gene Ahsa1 An activator encoding a 90 kDa heat shock protein was found, and the expression level of this gene in the leaves of the heat-resistant 'Guidong' variety after 4 h of high-temperature treatment was 8.81 times higher than that of the control.
[0058] The upstream specific primer Ahsa1-F used in step 1.1 above to amplify the Ahsa1 coding region sequence is:
[0059] AGAACACGGGGGACTCTAGAATGGCGAAGTACGGAGAAGG;
[0060] The downstream specific primer Ahsa1-R is:
[0061] GGAAATTCGAGCTCGGTACCTCATATTCCAAAACCAAACA;
[0062] The PCR reaction system consisted of: 2 µL cDNA, 2 µL 10 µM Ahsa1-F, 2 µL 10 µM Ahsa1-R, 20 µL PCRMix, and 14 µL sterile double-distilled water, for a total volume of 40 µL. The PCR reaction program was as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 1 min, for a total of 35 cycles; and 72 °C extension for 10 min.
[0063] The vector digestion system used in step 1.1 is as follows: 5 µL of pCAMBIA2300 vector plasmid, 1 µL of Xba I, 1 µL of KpnI, 5 µL of buffer Q, and 8 µL of sterile ultrapure water.
[0064] The ligation reaction system used in step 1.1 was as follows: 5 µL of the recovered target gene fragment, 3 µL of the vector fragment, 4 µL of 5×CE II buffer, 2 µL of Exnase II, and 6 µL of sterile ultrapure water.
[0065] The components and concentrations of the DM liquid medium used in step 1.3 are as follows: DKW basal medium + 2.0 mg / L thiamine hydrochloride + 2.0 mg / L glycine + 1.0 mg / L nicotinic acid + 0.3 g / L KNO3 + 1.0 g / L inositol + 30 g / L sucrose + 7 g / L agar + 5.0 mM 6-BA + 2.5 mM 2-NAA + 2.5 mM 2,4-D, pH 5.7.
[0066] The specific steps for extracting the grape zygotic embryo in step 2 are as follows:
[0067] Step 2.1: About 60 days after the grapes bloom, select normally developed Eurasian grape berries, remove the seeds under running tap water, and then place them in a clean bench and rinse them with sterile water 3-5 times.
[0068] Step 2.2: Disinfect the seeds with 70% alcohol for 30 seconds, rinse with sterile water 2-3 times, then soak the seeds in an aqueous solution containing 5% NaClO (with 0.1% Tween-20 added) for 15 minutes (during which the seeds need to be shaken constantly to ensure that they are fully disinfected), and rinse with sterile water 3-5 times.
[0069] Step 2.3: Use a scalpel to cut open the seed and extract the zygotic embryo. The zygotic embryos can be temporarily placed on X6 medium, and after a sufficient number are extracted, they can be used for infection.
[0070] The aforementioned zygotic embryos were derived from diploid Eurasian grapes approximately 60 days after flowering.
[0071] Furthermore, the components and contents of the X6 medium used in step 2.3 above are as follows: MS-glycine-NH4NO3+3.033 g / L KNO3+0.364 g / L NH4Cl+60.0 g / L sucrose+1.0 g / L inositol+7.0 g / L agar+0.5 g / L activated carbon, pH 5.8.
[0072] The specific steps for Agrobacterium-mediated transformation of the zygote in step 3 are as follows:
[0073] Step 3.1: Place an appropriate amount of zygote obtained in step 2 on a culture dish, chop it up and place it in a 125 mL sterile Erlenmeyer flask, add 50 mL of Agrobacterium resuspension obtained in step 1, and shake continuously for 7-10 min.
[0074] Step 3.2: Filter the bacterial culture using a cell strainer and discard the bacterial solution. Blot the infected zygote embryo dry with sterile filter paper to remove excess bacterial solution. Place two layers of sterile filter paper on a sterile culture dish, add liquid DM medium to moisten the filter paper, and transfer the blotted zygote embryo onto the filter paper. Seal the culture dish with sealing film and incubate in the dark at 25°C for 3 days.
[0075] After co-culture, the zygotic embryos were transferred to a 125 mL sterile Erlenmeyer flask and washed twice with sterile water containing 500 mg / L carbenicillin and 500 mg / L cephalosporin, 3 min each time. Then, the embryos were washed 3-4 times with sterile water, excess water was blotted dry with absorbent paper, and the embryos were transferred to solid DM medium (containing 200 mg / L carbenicillin and cephalosporin) for callus induction. The embryos were then incubated in the dark at 25°C for 30-60 days to induce embryogenic callus tissue.
[0076] The specific steps for obtaining heat-resistant transgenic plants in step 4 above are as follows:
[0077] Step 4.1: Transfer the induced embryogenic callus to X6 medium containing 75 mg / L kanamycin, 200 mg / L carbenicillin and 200 mg / L cephalosporin, and culture in the dark at 25 ℃. Replace the medium with a new one every 42 days until the cotyledon stage embryoids emerge.
[0078] Step 4.2: Transfer the cotyledon stage embryoids to the embryo germination medium, culture them in the dark at 25℃ for 2-3 days, culture them in low light for 3 days, and then transfer them to normal light conditions. After about 1-2 months of culture, they will germinate into seedlings.
[0079] Step 4.3: Transfer the plants obtained from the seedling culture medium to the subculture culture medium for further propagation, and extract the DNA of each line. Use vector-specific primers to detect whether the obtained lines are positive plants.
[0080] The embryo germination medium used in step 4.2 consists of the following components and concentrations: MS + 0.1 g / L inositol + 20 g / L sucrose + 7 g / L agar + 0.2 mg / L 6-BA, pH 5.8.
[0081] The components and concentrations of the subculture medium used for the transgenic lines in step 4.3 are as follows: 1 / 2 MS + 0.02 mg / L 6-BA + 0.2 mg / L IBA + 30 g / L sucrose + 8 g / L agar + 0.5 g / L activated carbon, pH 5.8.
[0082] The following are specific experiments of the embodiments of the present invention:
[0083] I. Obtaining the Infection Solution
[0084] The method for constructing a heat-resistant overexpression vector and transforming it into Agrobacterium tumefaciens according to the above implementation plan, and preparing the infection solution, is as follows: prepare the Agrobacterium tumefaciens infection solution of pCAMBIA2300-GP1, and the concentration of the bacterial solution after resuspension is OD600=0.512.
[0085] II. Obtaining the Zygote
[0086] Cabernet Sauvignon berries were collected approximately two months after flowering. After sterilization according to claim 7, the zygotic embryos were extracted and placed on X6 medium. Figure 1 As shown.
[0087] III. Bacterial infection
[0088] Following the specific steps in the above implementation plan for transforming zygotes with Agrobacterium, the diced zygotes were infected with Agrobacterium resuspension that had been left to stand for 3 hours for 10 minutes.
[0089] IV. Joint Training
[0090] Following the specific steps in the above-described implementation plan for transforming zygotic embryos with Agrobacterium, the infected zygotic embryos were placed on filter paper moistened with liquid DM medium and incubated in the dark at 25°C for 3 days (e.g., Figure 2 (As shown).
[0091] V. Induction of Embryogenic Callus
[0092] Following the specific steps in the above-described implementation plan for transforming zygotes with Agrobacterium, the co-cultured zygotes were sterilized and then placed on solid DM medium for 30-60 days to induce embryogenic callus (e.g. Figure 3 (As shown).
[0093] VI. Screening and Cultivation
[0094] Following the specific steps in the above implementation plan for obtaining heat-resistant transgenic plants, embryogenic callus induced on solid DM medium was transferred to X6 medium containing 75 mg / L kanamycin, 200 mg / L carbenicillin, and 200 mg / L cephalosporin. The medium was then incubated in the dark at 25 °C, with the medium replaced approximately every 42 days until embryoids (such as...) emerged. Figure 4 (As shown).
[0095] VII. Seedling Cultivation
[0096] Following the specific steps for obtaining heat-resistant transgenic plants described in the above implementation plan, the embryoids grown in the previous step are placed on a seedling culture medium to allow them to grow into complete plants. The entire process takes approximately 30-60 days (e.g., ...). Figure 5 (As shown).
[0097] VIII. Subculture and Detection of Transgenic Lines
[0098] Following the specific steps for obtaining heat-resistant transgenic plants described in the above implementation plan, the established plant lines were cut into stem segments with buds and placed in a subculture medium for propagation. DNA was extracted and detected using vector-specific primers to obtain new heat-resistant grape germplasm (such as...). Figure 6 and Figure 7 (Lane 1-2, 4-8 are transgenic lines, lane 3 is the DL2000 marker, and lane 9 is the wild type).
[0099] Through the above-described embodiments and experiments of the present invention, using immature grape seeds as experimental material, the present invention successfully introduced exogenous heat-resistant genes into the grape genome through the Agrobacterium-mediated method, thereby achieving the genetic transformation of grapes and obtaining heat-resistant transgenic grape plants.
[0100] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for obtaining heat tolerant grape germplasm through transgenic using grape zygotic embryos, characterized in that, The method comprises the following steps: S1, constructing a vector and preparing an infection solution: a heat-resistant gene GP1 is constructed on a plant super-expression vector, Agrobacterium tumefaciens is transformed, and an infection solution containing a recombinant engineering strain is prepared; S2, zygotic embryo stripping: seeds of diploid Vitis vinifera are taken about 60 days after flowering, disinfected, and then cut open to take the zygotic embryo; S3, genetic transformation: the zygotic embryo obtained in step S2 is cut and placed in the infection solution obtained in step S1 for infection treatment, and then placed on a sterile filter paper soaked with liquid DM medium for co-culture, and after co-culture, degerming treatment is performed, and then transferred to a solid DM medium to induce embryogenic callus; S4, heat-resistant transgenic plant cultivation: the embryogenic callus induced in step S3 is transferred to an X6 medium to induce embryoids, and then the embryoids are placed on a seedling culture medium for cultivation to obtain heat-resistant transgenic grape plants.
2. The method of claim 1, wherein, The heat-resistant gene GP1 in step S1 is an Ahsa1 gene, and its nucleotide sequence is shown in SEQ ID NO:
1.
3. The method of claim 2, wherein, The plant super-expression vector in step S1 is pCAMBIA2300, and the Ahsa1 gene is inserted into the vector through Xba I and Kpn I enzyme cutting sites to construct a recombinant plasmid pCAMBIA2300-Ahsa1.
4. The method of claim 3, wherein, The Agrobacterium tumefaciens in step S1 is a GV3101 strain.
5. The method of claim 1, wherein, The infection solution in step S1 is prepared by the following method: the Agrobacterium tumefaciens liquid containing the recombinant plasmid is resuspended with DM liquid medium, and the OD600 value is adjusted to 0.4-0.6, then 100 μM of acetosyringone is added to the resuspension, and the resuspension is placed at 25℃ for 2-3 hours and then used.
6. The method of claim 5, wherein, The DM liquid medium is composed of the following components: DKW basic medium, 2.0 mg / L thiamine hydrochloride, 2.0 mg / L glycine, 1.0 mg / L nicotinic acid, 0.3 g / L KNO3, 1.0 g / L myo-inositol, 30 g / L sucrose, 5.0 μM 6-BA, 2.5 μM NAA, and 2.5 μM 2,4-D, and the pH value is 5.
7.
7. The method of claim 1, wherein, The specific process of the disinfection in step S2 is as follows: the stripped seeds are first disinfected with 70% alcohol for 30 seconds, washed with sterile water for 2-3 times, then soaked in a solution containing 5% NaClO and 0.1% Tween-20 for 15 minutes, and finally washed with sterile water for 3-5 times.
8. The method of claim 1, wherein, The infection treatment time in step S3 is 7-10 minutes; the co-culture time is 3 days; and the co-culture and induction of embryogenic callus are both carried out at 25℃ in dark culture conditions. The degerming treatment in step S3 is washing with sterile water containing 500 mg / L carbenicillin and 500 mg / L cephalosporin; and the solid DM medium further contains 200 mg / L carbenicillin and 200 mg / L cephalosporin.
9. The method of claim 1, wherein, The X6 medium in step S4 is composed of the following components: MS-glycine-NH4NO3, 3.033 g / L KNO3, 0.364 g / L NH4Cl, 60.0 g / L sucrose, 1.0 g / L myo-inositol, 7.0 g / L agar and 0.5 g / L activated carbon, and the pH value is 5.8; and 75 mg / L kanamycin is added to the X6 medium for resistance screening during the induction of the embryoid culture; The seedling culture medium in step S4 is an embryo germination culture medium composed of the following components: MS medium, 0.1 g / L myo-inositol, 20 g / L sucrose, 7.0 g / L agar and 0.2 mg / L 6-BA, and the pH value is 5.
8.
10. The method of claim 1, wherein, The method further comprises the following steps after obtaining the heat-resistant transgenic grape plant in step S4: The plants obtained on the seedling culture medium are transferred to a subculture medium for further propagation, and the DNA of each strain is extracted to detect whether the obtained strain is a positive plant using a vector-specific primer; The subculture medium is composed of the following components: 1 / 2 MS medium, 0.02 mg / L 6-BA, 0.2 mg / L IBA, 30 g / L sucrose, 8.0 g / L agar and 0.5 g / L activated carbon, and the pH value is 5.8.