Viral nucleic acid and tumor necrosis factor combined detection method based on CRISPR (clustered regularly interspaced short palindromic repeats) technology

Abstract

The invention discloses a virus nucleic acid and tumor necrosis factor combined detection method based on a CRISPR (clustered regularly interspaced short palindromic repeats) technology. Comprising the following steps: constructing a CRISPR (clustered regularly interspaced short palindromic repeats)-based nucleic acid molecule recognition system by utilizing the recognition of crRNA on target nucleic acid and the induction activation capability of crRNA on Cas12a trans-cleavage activity; reading conditions of a CRISPR recognition system are optimized, subpicomole-level quantitative detection of nucleic acid molecules is achieved, and the detection capacity of the nucleic acid molecules on different subtypes of human papilloma virus nucleic acid is verified; on the basis of a nucleic acid molecule recognition system, the nucleic acid aptamer capable of being specifically combined with the tumor necrosis factor-alpha is utilized to realize the quantitative detection of the tumor necrosis factor with high specificity as low as picomole level. The detection method disclosed by the invention has the advantages of rapidness, low cost, simplicity in reading, realization of combined detection of viral nucleic acid and cell factors and the like, and a new detection method is provided for early screening of human papilloma virus infection and cervical cancer.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biochemical molecule detection, and in particular to a virus nucleic acid and tumor necrosis factor combined detection method based on CRISPR technology. BACKGROUND

[0002] Cervical cancer is the fourth most common cancer in women worldwide, and persistent infection with high-risk human papillomavirus (HPV) is the main pathogenic factor, which poses a serious threat to women's health. Early screening for high-risk HPV helps to implement intervention measures as soon as possible and improve the prognosis level. At the same time, the occurrence of cervical cancer is closely related to the persistent infection of HPV virus, and studies have found that during the development of cancer, the concentration of certain key cytokines such as tumor necrosis factor-α (TNF-α) in the local tissues of patients will change significantly. Therefore, if the virus typing and the simultaneous combined detection of cytokine levels can be realized, it will help to comprehensively evaluate the disease progression state, improve the early detection rate of cervical cancer and improve the prognosis level of patients.

[0003] The current HPV nucleic acid detection methods used in clinical practice mainly include quantitative real-time PCR (qPCR), transcription-mediated amplification technology and hybrid capture technology, etc. Although such technologies have high sensitivity, they are complex to operate, rely on professional personnel and large equipment, and cannot be popularized for early screening in primary medical care. There are also some kits suitable for home testing and primary medical care, which are often based on colloidal gold technology and use viral antigens as markers, lack the ability to type viruses and have limited sensitivity. In recent years, with the continuous deepening of molecular biology research, the CRISPR / Cas system has shown great application potential in the field of molecular diagnosis due to its highly specific target recognition and cleavage ability. In particular, the trans-cleavage mechanism of CRISPR / Cas12 provides technical support for constructing a new generation of sensitive and rapid nucleic acid detection platform. Currently, there have been studies combining CRISPR / Cas system with polymerase chain reaction (PCR) or isothermal amplification technology for the detection of pathogen nucleic acids, which have achieved good results. However, such methods are usually limited to single detection of nucleic acid markers and are difficult to expand to the analysis of tumor necrosis factor-α biological molecules such as TNF-α.

[0004] Therefore, although the CRISPR system provides a new technical method for the detection field, the existing strategy is still difficult to realize the combined detection analysis of human papilloma virus nucleic acid and tumor necrosis factor alpha. In order to solve this key challenge and meet the aforementioned demand for comprehensive and popular technology, it is of great significance to develop a method that is fast, compatible with multiple samples, and can realize the combined detection of nucleic acid and tumor necrosis factor alpha target, for early screening and typing of HPV and cervical cancer. SUMMARY

[0005] The present application aims to overcome the shortcomings of the prior art and provide a virus nucleic acid and tumor necrosis factor combined detection method based on CRISPR technology, which solves the problems of high cost, complex operation and difficulty in realizing combined detection of virus and cytokine multiple markers of the existing detection methods.

[0006] The object of the present application is achieved by the following technical solution: a virus nucleic acid and tumor necrosis factor combined detection method based on CRISPR technology, which realizes the combined detection of virus nucleic acid detection and tumor necrosis factor by the same readout method, specifically including: after pretreatment of the sample to be tested, adding the sample to be tested into the CRISPR detection system, recording the detected fluorescence signal to realize the combined detection of virus nucleic acid and tumor necrosis factor alpha; The CRISPR detection system includes a CRISPR-based virus nucleic acid quantitative detection system and a CRISPR-based tumor necrosis factor alpha quantitative detection system. The CRISPR-based virus nucleic acid quantitative detection system includes crRNA, Cas12a, fluorescent reporter nucleic acid, reaction buffer and dithiothreitol. The CRISPR-based tumor necrosis factor alpha detection system includes crRNA, Cas12a, fluorescent reporter nucleic acid, nucleic acid aptamer, binding buffer, reaction buffer and dithiothreitol. For virus nucleic acid detection, when the target double-stranded nucleic acid exists, it will bind to the corresponding crRNA and induce the activation of Cas12a transcleavage activity. For tumor necrosis factor alpha detection, the nucleic acid aptamer as the target nucleic acid can activate the transcleavage activity of Cas12a and produce a fluorescence signal. When tumor necrosis factor alpha exists in the system, the nucleic acid aptamer specifically binds to tumor necrosis factor alpha and cannot be recognized by crRNA, resulting in a decrease in activated Cas12a and a decrease in fluorescence signal.

[0007] Further, the fluorescent reporter nucleic acid is a single-stranded nucleic acid with a fluorescent agent and a quencher at both ends, and the sequence is 5' 6-FAM-TTATT-BHQ1-3'; the sequence of the crRNA is SEQ ID NO. 1: 5'-UAAUUUCUACUAAGUGUAGAUNNNNNNNNNNNNNNNNNNNNN-3' (since the u in the WIPO software will cause an error, replace the u in the sequence listing file with t), wherein the crRNA sequence includes a hairpin structure UAAUUUCUACUAAGUGUAGAU combined with Cas12a and a sequence NNNNNNNNNNNNNNNNNNNNN paired with the target nucleic acid for recognition, wherein N represents A, G, C, and U four bases.

[0008] Further, the reaction buffer is r2.1 buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml recombinant albumin, pH 7.9 25°C; the concentration of dithiothreitol is 20-50 mM; the molar concentration ratio of crRNA to Cas12a is 1:1, and the concentration of crRNA-Cas12a complex is 100-200 nM.

[0009] Further, the concentration of dithiothreitol is 20 mM; and the concentration of crRNA-Cas12a complex is 100 nM.

[0010] Further, the CRISPR-based viral nucleic acid quantitative detection system includes: for HPV-16 detection, the target sequence is SEQ ID NO. 2: 5'-GTGCTGCCATATCTACTTCA-3'; for HPV-18 detection, the target sequence is SEQ ID NO. 3: 5'-TGTGTAGAAGCACATATTGT-3'; for HPV-52 detection, the target sequence is SEQ ID NO. 4: 5'-AGGCCAGACACCTTGGGAAC-3'; and for HPV-58 detection, the target sequence is SEQ ID NO. 5: 5'-TGTTATTGGGACTCTTGATG-3'; the target nucleic acid and the gene fragment near it are introduced into a pUC57 plasmid vector to simulate viral nucleic acid for verification, and different concentrations of viral nucleic acid can induce different transcleavage rates of Cas12a, thereby producing different fluorescence responses, and the transcleavage rate and the nucleic acid concentration show good linearity, and the fastest detection is completed within 30 min.

[0011] Further, the binding buffer is a MES buffer: 100 mM MES, 150 mM NaCl, 1 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 100 µg / ml bovine serum albumin, pH 6.0, 25℃.

[0012] Furthermore, the aptamer that specifically binds to tumor necrosis factor-α serves as the target nucleic acid recognized by crRNA, wherein the molar ratio of crRNA to nucleic acid aptamer is 1:1, and the concentration of nucleic acid aptamer is 20 nM.

[0013] Furthermore, the target nucleic acid recognition pairing sequence in the crRNA is designed using specific fragments of the target viral nucleic acid; specific nucleic acid fragments with adjacent motifs (5'-TTTN-3', where N represents A, C, or G) are searched in the L1 genes of the four high-risk HPV subtypes 16 / 18 / 52 / 58.

[0014] Furthermore, the nucleic acid aptamer sequence is SEQ ID NO.6: 5'-GGGGGCTGGGAGTTTCTGCG-3', which can be recognized by crRNA and activate the trans-cleavage activity of Cas12a, generating a fluorescent signal response. Its trans-cleavage rate is linearly correlated with the concentration of nucleic acid aptamer. The specific binding of tumor necrosis factor-α to the nucleic acid aptamer reduces the concentration of free nucleic acid aptamer in the solution, thereby leading to a decrease in the trans-cleavage rate.

[0015] Furthermore, the viral nucleic acid quantitative detection system and the tumor necrosis factor-α detection system require similar biologically sensitive substances, and have the same detection environment and signal readout method, allowing for joint detection of the two in the same fluorescence detection instrument.

[0016] The beneficial effects of this invention are as follows: This invention provides a method for the joint detection of viral nucleic acid and tumor necrosis factor based on CRISPR technology, which can achieve quantitative detection of multiple HPV viral nucleic acid subtypes at the sub-pM level, with good selectivity and sensitivity. At the same time, it can achieve detection of tumor necrosis factor-α at a level as low as 200 pM. The operation process is simple and the readout device is universal, providing a new technical path for portable joint detection of nucleic acid and tumor necrosis factor-α.

[0017] Compared with traditional nucleic acid and tumor necrosis factor alpha detection methods, the virus nucleic acid and tumor necrosis factor combined detection method based on the CRISPR technology of the application has the characteristics of fast, low cost, simple reading and can realize the combined detection of different types of markers. Its design method can be expanded to the detection of more nucleic acid and tumor necrosis factor alpha markers, greatly improving the instantaneity of detection, and can be combined with portable fluorescence reading equipment, making the detection free from the limitation of laboratory, meeting the needs of primary medical care and home detection, and providing a new detection method for human papilloma virus infection and early screening of cervical cancer. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0019] Figure 1 is the nucleic acid and tumor necrosis factor alpha detection principle diagram based on CRISPR / Cas12a provided by the embodiment of the application; Figure 2 is the random single strand verification diagram of trans-cleavage activated Cas12a protein cleavage provided by the embodiment of the application; Figure 3 is the dithiothreitol concentration optimization diagram in the detection system provided by the embodiment of the application; Figure 4 is the crRNA-Cas12a complex concentration optimization diagram in the detection system provided by the embodiment of the application; Figure 5 is the nucleic acid recognition system principle verification diagram based on CRISPR / Cas12a provided by the embodiment of the application; Figure 6 is the response diagram of the constructed nucleic acid detection system to different concentrations of HPV-16 virus nucleic acid provided by the embodiment of the application; Figure 7 is the detection linear diagram of the constructed nucleic acid detection system to HPV-16 subtypes provided by the embodiment of the application; Figure 8 is the response diagram of the constructed nucleic acid detection system to different concentrations of HPV-18 virus nucleic acid provided by the embodiment of the application; Figure 9 is the detection linear diagram of the constructed nucleic acid detection system to HPV-18 subtypes provided by the embodiment of the application; Figure 10is a response graph of the constructed nucleic acid detection system provided by the embodiment of the present application to different concentrations of HPV-52 virus nucleic acid; Figure 11 is a detection linear graph of the constructed nucleic acid detection system provided by the embodiment of the present application to HPV-52 subtype; Figure 12 is a response graph of the constructed nucleic acid detection system provided by the embodiment of the present application to different concentrations of HPV-58 virus nucleic acid; Figure 13 is a detection linear graph of the constructed nucleic acid detection system provided by the embodiment of the present application to HPV-58 subtype; Figure 14 is a cross-selectivity verification graph of the constructed nucleic acid detection system provided by the embodiment of the present application to other subtypes of viruses; Figure 15 is a fluorescence response graph caused by the activation of Cas12a reverse transcleavage by different concentrations of single-stranded nucleic acid aptamers provided by the embodiment of the present application; Figure 16 is a linear graph of the cutting rate of Cas12a with different concentrations of single-stranded nucleic acid aptamers provided by the embodiment of the present application; Figure 17 is a detection result graph of different crRNA and nucleic acid aptamer ratios in the detection system to 20 nM and 500 pM tumor necrosis factor-α provided by the embodiment of the present application; Figure 18 is a response graph of different nucleic acid aptamer concentrations in the detection system to 2 nM and 0 nM tumor necrosis factor-α provided by the embodiment of the present application; Figure 19 is a detection result graph of different nucleic acid aptamer concentrations in the detection system to 2 nM tumor necrosis factor-α provided by the embodiment of the present application; Figure 20 is a response graph of the constructed tumor necrosis factor-α detection system provided by the embodiment of the present application to different concentrations of TNF-α detection; Figure 21 is a linear graph of the constructed tumor necrosis factor-α detection system provided by the embodiment of the present application to different concentrations of TNF-α detection; Figure 22 is a detection selectivity verification graph of the constructed tumor necrosis factor-α detection system provided by the embodiment of the present application; Figure 23 is a detection process schematic diagram of the virus nucleic acid and tumor necrosis factor combined detection method provided by the embodiment of the present application. DETAILED DESCRIPTION

[0020] Embodiments, features and aspects of the present disclosure will be described in detail below with reference to the accompanying drawings, but are not limited thereto. Any one of the embodiments expanded based on the embodiments of the present disclosure, all other embodiments obtained by those of ordinary skill in the art without making creative efforts, belong to the scope of protection of the present disclosure. The same reference signs in the drawings represent the same or functionally similar elements. Although various aspects of the embodiments are shown in the drawings, the drawings are not necessarily drawn to scale unless specifically indicated.

[0021] In addition, in order to better illustrate the present disclosure, numerous specific details are given in the specific embodiments below, but those skilled in the art should understand that the present disclosure can also be implemented without some specific details, and some methods and means familiar to those skilled in the art are not described in detail in order to highlight the main idea of the present disclosure.

[0022] As shown in Figure 1 , the principle of nucleic acid detection and tumor necrosis factor-α detection (tumor necrosis factor-α) in a virus nucleic acid and tumor necrosis factor combined detection method based on CRISPR technology constructed by the present application. For nucleic acid detection, when the target double-stranded nucleic acid exists, it will bind to the corresponding crRNA and induce the activation of the transcleavage activity of Cas12a, and the more target nucleic acid will activate more Cas12a. Among them, the fluorescent reporter nucleic acid is a single-stranded DNA modified with a fluorescent agent and a quencher at both ends (-TTATT-), which will produce a fluorescent signal after being cut by Cas12a. For tumor necrosis factor-α detection, single-stranded nucleic acid aptamer (Aptamer) as target nucleic acid, can activate the transcleavage activity of Cas12a and produce a fluorescent signal, when the target exists in the system, the nucleic acid aptamer will specifically bind to the target and cannot be recognized by crRNA, resulting in a decrease in activated Cas12a and a decrease in fluorescent signal.

[0023] As shown in Figure 2 , the present application first verifies the transcleavage activity of Cas12a. The target strand and random single-strand of different lengths (including 20 nt, 40 nt, 60 nt) are added to the CRISPR / Cas12a system, and after 0 min, 3 min, 5 min, 10 min, 20 min, 30 min, 40 min, 50 min, 60 min of reaction, respectively, put into a PCR instrument for 10 min at 65℃ to inactivate Cas12a, and add to a 3.5% agarose gel, 130 V run gel for 70 min. With the increase of reaction time, the random single-strand substrate decreases, and after 30 min its band almost disappears, proving that the transcleavage activity of Cas12a is good.

[0024] As shown in Figure 3The figure shows the variation of Cas12a trans-cleavage activity with dithiothreitol concentration in the system in the CRISPR-based combined detection method for viral nucleic acid and tumor necrosis factor. This invention evaluated the trans-cleavage activity of the reducing agent dithiothreitol on Cas12a. With the same concentrations of target nucleic acid and crRNA-Cas12a complex, continuously increasing the dithiothreitol concentration significantly increased the cleavage rate of Cas12a on the fluorescent reporter nucleic acid, reaching a maximum at a dithiothreitol concentration of 20 mM. The concentration of DTT in the system was 20-50 mM, preferably 20 mM.

[0025] This invention constructs and optimizes both a nucleic acid detection system and a tumor necrosis factor-α detection system.

[0026] Example 1: Detection of different subtypes of human papillomavirus.

[0027] like Figure 4 The figure shows the variation of Cas12a trans-cleavage activity with the concentration of crRNA-Cas12a complex in the CRISPR-based human papillomavirus nucleic acid detection system. This invention evaluated the optimal crRNA-Cas12a complex concentration in the nucleic acid detection system, finding that the cleavage rate approached its maximum when the crRNA-Cas12a complex concentration was increased to 100 nM. The concentration of DTT in the system was 20-50 mM, preferably 20 mM.

[0028] like Figure 5 The diagram shown is a verification diagram of nucleic acid recognition for the CRISPR-based human papillomavirus nucleic acid detection system. No fluorescent signal response is generated in the system without target nucleic acid, crRNA, or Cas12a. Even with only fluorescent reporter nucleic acid, a sustained increase in fluorescence signal is not produced. Only when the system is intact and target nucleic acid is present will an effective fluorescent signal response be generated.

[0029] The CRISPR-based human papillomavirus nucleic acid detection system can detect multiple viral nucleic acids, especially distinguishing between HPV-16 / 18 / 52 / 58 subtypes. Figure 6 The image shows the results of HPV-16 nucleic acid detection using plasmid vectors at different concentrations. Within the range of 0.1–100 pM, higher nucleic acid concentrations result in more activated Cas12a protein, a higher overall enzyme digestion rate, and a faster increase in fluorescence intensity. A linear fit was performed on the fluorescence curves; the slope represents the rate of change in fluorescence intensity, which also indicates the Cas12a shearing rate. Figure 7 As shown, a linear fit was performed between the shearing rate and the nucleic acid concentration, yielding a good linearity with a coefficient of determination R0. 2 It is 0.9885.

[0030] As shown in Figure 8 , the results of HPV-18 nucleic acid detection by the CRISPR-based human papillomavirus nucleic acid detection system on different concentrations of plasmid vectors, within the range of 0.1-100 pM, the higher the nucleic acid concentration, the more Cas12a proteins activated, the higher the overall enzyme cutting reaction rate, and the faster the fluorescence intensity rises. Linear fitting of the fluorescence curve, the slope of which is the rate of change of fluorescence intensity, also represents the cutting rate of Cas12a, as shown in Figure 9 , linear fitting of the cutting rate and nucleic acid concentration gives a good linearity, with a determination coefficient R 2 of 0.9986.

[0031] As shown in Figure 10 , the results of HPV-52 nucleic acid detection by the CRISPR-based human papillomavirus nucleic acid detection system on different concentrations of plasmid vectors, within the range of 0.1-100 pM, the higher the nucleic acid concentration, the more Cas12a proteins activated, the higher the overall enzyme cutting reaction rate, and the faster the fluorescence intensity rises. Linear fitting of the fluorescence curve, the slope of which is the rate of change of fluorescence intensity, also represents the cutting rate of Cas12a, as shown in Figure 11 , linear fitting of the cutting rate and nucleic acid concentration gives a good linearity, with a determination coefficient R 2 of 0.9971.

[0032] As shown in Figure 12 , the results of HPV-58 nucleic acid detection by the CRISPR-based human papillomavirus nucleic acid detection system on different concentrations of plasmid vectors, within the range of 0.1-100 pM, the higher the nucleic acid concentration, the more Cas12a proteins activated, the higher the overall enzyme cutting reaction rate, and the faster the fluorescence intensity rises. Linear fitting of the fluorescence curve, the slope of which is the rate of change of fluorescence intensity, also represents the cutting rate of Cas12a, as shown in Figure 13 , linear fitting of the cutting rate and nucleic acid concentration gives a good linearity, with a determination coefficient R 2 of 0.9962.

[0033] As shown in Figure 14 , the results of the selectivity verification of the CRISPR-based human papillomavirus nucleic acid detection system constructed, the detection system constructed with the corresponding subtype crRNA only responds to the corresponding subtype target nucleic acid and has no response to other subtypes of nucleic acid, proving its ability to distinguish different subtypes.

[0034] Example 2: Quantitative detection of tumor necrosis factor-α.

[0035] As shown in Figure 15The image shows the response of the constructed CRISPR-based tumor necrosis factor-α detection system to different concentrations of nucleic acid aptamers. Within the detection range of 0.1-20 nM, the fluorescence response continuously increases with increasing nucleic acid aptamer concentration. Figure 16 As shown, the shear rate is linearly related to its concentration, with the coefficient of determination R0. 2 The value was 0.9974, which verifies the system's ability to identify and detect single-stranded nucleic acids.

[0036] like Figure 17 The figure shows the detection results of 20 nM and 500 pM tumor necrosis factor-α in the CRISPR-based tumor necrosis factor-α detection system with different ratios of crRNA to aptamer. For high-concentration detection, all four ratios showed significant fluorescence signal attenuation, but the 1:1 ratio group was relatively the best. For low-concentration detection, except for the 1:1 group, the fluorescence signals of the other groups did not attenuate. The preferred ratio is crRNA concentration: aptamer concentration = 1:1.

[0037] like Figure 18 The figure shows the detection results of different aptamer concentrations for 2 nM tumor necrosis factor-α in the CRISPR-based tumor necrosis factor-α detection system. Different concentrations of aptamers all showed significant responses to 2 nM tumor necrosis factor-α. According to the formula: .

[0038] in This represents the concentration of tumor necrosis factor-α. The cleavage attenuation rate corresponding to 2 nM tumor necrosis factor-α at different nucleic acid aptamer concentrations was calculated using the formula, such as... Figure 19 As shown, 5 nM, 10 nM, and 20 nM all exhibit high cleavage attenuation rates. Based on the comprehensive fluorescence intensity detection, 20 nM is the preferred option.

[0039] like Figure 20 As shown, under the above-mentioned preferred conditions, the fluorescence response of the CRISPR-based tumor necrosis factor-α quantitative detection system to different concentrations of tumor necrosis factor-α is as follows: within the range of 0.2-10 nM, the fluorescence response continuously weakens with increasing tumor necrosis factor-α concentration. Linear fitting was used to obtain the cleavage rate at different concentrations and the corresponding cleavage attenuation rate was calculated. With the cleavage attenuation rate on the vertical axis and tumor necrosis factor-α concentration on the horizontal axis, the linearity of the CRISPR-based tumor necrosis factor-α quantitative detection system was obtained, as shown below. Figure 21 As shown, the coefficient of determination R 2 It is 0.9778.

[0040] like Figure 22The specificity verification diagram of the CRISPR-based tumor necrosis factor-α quantitative detection system under the above preferred conditions is shown. The detection system has no obvious signal response to albumin, interleukin-6, C-reactive protein, and interferon-γ, which are all 2 nM as tumor necrosis factor-α, and the response to tumor necrosis factor-α is obviously much greater than that of other interferents, indicating that the constructed CRISPR-based tumor necrosis factor-α quantitative detection system has good specificity.

[0041] As shown in Figure 23 After the collection of the sample to be tested is completed, the sample is added to a tube containing tumor necrosis factor-α aptamer and viral nucleic acid pre-amplification reagent, and the pre-amplification of the viral nucleic acid and the tumor necrosis factor-α is completed at 37℃, then the solution is added to the CRISPR system, and the signal reading and concentration quantification are completed by a fluorescence detection instrument.

[0042] The virus nucleic acid and tumor necrosis factor combined detection method based on CRISPR technology provided by the present application optimizes the cleavage activity of Cas12a, designs crRNA according to different human papilloma virus specific gene fragments to construct a nucleic acid detection system, and verifies its nucleic acid quantitative detection ability. The tumor necrosis factor-α detection system is constructed by combining the nucleic acid aptamer that can bind to tumor necrosis factor-α, and the tumor necrosis factor-α quantitative detection ability and specificity are verified. The nucleic acid and tumor necrosis factor-α detection system technology route is compatible and can realize signal reading on the same platform, which can provide a new technical platform for HPV virus infection and early screening of cervical cancer. At the same time, the system also has good expandability, can be optimized and developed for various nucleic acids and non-nucleic acids, has the ability of multi-marker combined rapid detection, and is expected to provide a new technical tool for precision treatment.

[0043] It should be noted that the above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various changes and modifications. Without creative labor, any modification, equivalent replacement, improvement, etc. should be included in the protection scope of the present application.

Claims

1. A method for detecting a virus nucleic acid and tumor necrosis factor based on CRISPR technology, characterized in that, The application relates to a CRISPR-based combined detection method for virus nucleic acid and tumor necrosis factor-alpha. The method comprises the following steps: adding a sample to be detected into a CRISPR detection system after pretreatment of the sample to be detected, and recording a detected fluorescence signal to realize combined detection of virus nucleic acid and tumor necrosis factor-alpha. The CRISPR detection system comprises a CRISPR-based virus nucleic acid quantitative detection system and a CRISPR-based tumor necrosis factor-alpha quantitative detection system. The CRISPR-based virus nucleic acid quantitative detection system comprises crRNA, Cas12a, a fluorescence reporter nucleic acid, a reaction buffer and dithiothreitol. The CRISPR-based tumor necrosis factor-alpha quantitative detection system comprises crRNA, Cas12a, a fluorescence reporter nucleic acid, an aptamer, a binding buffer, a reaction buffer and dithiothreitol. The combined detection comprises the following steps: for virus nucleic acid detection, when target double-stranded nucleic acid exists, the target double-stranded nucleic acid is combined with corresponding crRNA and induces trans-cleavage activity of Cas12a. For tumor necrosis factor-alpha detection, the aptamer is used as target nucleic acid, can activate trans-cleavage activity of Cas12a and generate a fluorescence signal, when tumor necrosis factor-alpha exists in the system, the aptamer is specifically combined with tumor necrosis factor-alpha and cannot be recognized by crRNA, so that activated Cas12a is reduced and the fluorescence signal is reduced.

2. The detection method according to claim 1, characterized in that, The fluorescence reporter nucleic acid is a single-stranded nucleic acid with a fluorescence agent and a quencher at two ends, and the sequence is 5'6-FAM-TTATT-BHQ1-3'; the sequence of the crRNA is SEQ ID NO. 1: 5'-UAAUUUCUACUAAGUGUAGAUNNNNNNNNNNNNNNNNNNNN-3', wherein the crRNA sequence comprises a hairpin structure UAAUUUCUACUAAGUGUAGAU combined with Cas12a and a sequence NNNNNNNNNNNNNNNNNNNN for recognizing and pairing with target nucleic acid, wherein N represents A, G, C and U.

3. The method of claim 1, wherein, The reaction buffer is r2.1 buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 ug / ml recombinant albumin, pH 7.9 25 DEG C; the concentration of dithiothreitol is 20-50 mM; the molar concentration ratio of crRNA to Cas12a is 1:1, and the concentration of the crRNA-Cas12a complex is 100-200 nM.

4. The detection method according to claim 3, characterized in that, The concentration of dithiothreitol is 20 mM, and the concentration of the crRNA-Cas12a complex is 100 nM.

5. The method of claim 1, wherein The CRISPR-based viral nucleic acid quantitative detection system comprises: for HPV-16 detection, the target sequence is SEQ ID NO. 2: 5'-GTGCTGCCATATCTACTTCA-3'; for HPV-18 detection, the target sequence is SEQ ID NO. 3: 5'-TGTGTAGAAGCACATATTGT-3'; for HPV-52 detection, the target sequence is SEQ ID NO. 4: 5'-AGGCCAGACACCTTGGGAAC-3'; and for HPV-58 detection, the target sequence is SEQ ID NO. 5: 5'-TGTTATTGGGACTCTTGATG-3'.

6. The method of claim 1, wherein The binding buffer is MES buffer: 100 mM MES, 150 mM NaCl, 1 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 100 μg / ml bovine serum albumin, pH 6.0 25℃.

7. The method of claim 1, wherein The nucleic acid aptamer sequence is SEQ ID NO. 6: 5'-GGGGGCTGGGAGTTTCTGCG-3'.

8. The method of claim 1, wherein, The tumor necrosis factor-alpha specific binding aptamer is used as a target nucleic acid recognized by the crRNA, the molar concentration ratio of the crRNA to the nucleic acid aptamer is 1:1, and the concentration of the nucleic acid aptamer is 20 nM.

Images