ALOX12 gene molecular marker related to donkey body size character and application of ALOX12 gene molecular marker

By analyzing the polymorphism of the ALOX12 gene, molecular markers related to donkey body size traits were identified, solving the breeding challenges in the transformation of the donkey industry and achieving a significant improvement in donkey body size traits and protection of local germplasm resources.

CN121344210APending Publication Date: 2026-01-16CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511562479.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-29
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

The current pace of transformation in the donkey industry cannot keep up with market demand. Donkeys have low reproductive capacity, slow growth rate, and a weak seed industry foundation, resulting in serious disorderly hybridization, a reduction in distinctive genetic resources, blurred breed characteristics, and declining production performance, making the breeding task arduous.

Method used

By analyzing the polymorphism of the ALOX12 gene in Yangyuan donkey, Guangling donkey, Turpan donkey and Xinjiang donkey populations, molecular markers significantly associated with donkey body size traits were identified. Specific primer pairs were provided for PCR amplification and sequencing, and an association analysis model was established for application in specialized donkey breeding.

Benefits of technology

Molecular markers significantly associated with donkey body size traits were discovered, which facilitated the breeding of specialized donkey breeds, protected local germplasm resources, improved production performance, and met market demands.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344210A_ABST
    Figure CN121344210A_ABST
Patent Text Reader

Abstract

The invention discloses an ALOX12 gene molecular marker related to donkey body size traits and application, and belongs to the technical field of gene detection. Nucleotide sequences of the molecular marker are as shown in SEQ ID NO.1 and SEQ ID NO.2, and two SNP (Single Nucleotide Polymorphism) sites exist in the sequences, namely g.14737400C > T at the 69bp position in an exon 10 region and g.14741674A > G at the 667bp position in an exon 14 region. A specific amplification primer is designed and synthesized according to a mutation site and used for amplifying the molecular marker, the genotype of the site is determined according to an amplification result, and the donkey body size character is subjected to early selection according to the genotype, so that the production cost can be saved, the genetic progress can be accelerated, and the method enables molecular marker-assisted breeding to be better applied to donkey breeding and has a good application prospect. Reference is provided for specialized variety breeding of donkeys, and the method has high economic application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a molecular marker for body size traits of a local Chinese donkey breed, its detection method, and its application. Background Technology

[0002] Donkeys were once one of the most important draft animals, making indelible contributions to the development of human civilization. They played an important role in agriculture, commerce, migration, transportation, and even the military.

[0003] However, the current pace of transformation in the donkey industry is clearly not meeting the consumption demands of my country's donkey product market. Reasons include: low fertility and slow growth rate of donkeys; the gradual replacement of their draft role with modernization, leading to a decline in breeding numbers; a weak breeding foundation, with no specialized strains developed, resulting in unremarkable hide, meat, and milk production; and the late start of large-scale donkey farming in my country, with predominantly free-range operations leading to severe disordered hybridization, a decrease in distinctive genetic resources, blurred breed characteristics, and a gradual decline in production performance. Over the past two decades, my country's donkey population has continued to decline, with many superior breeds facing extinction. The protection of germplasm resources, the development and utilization of donkey products, and the transformation and upgrading of the donkey industry face enormous challenges. The breeding of specialized donkey strains is still in its initial stages, and the breeding task remains arduous.

[0004] Molecular breeding technology is the preferred method for efficiently breeding high-quality donkeys. Screening and identifying molecular markers that are specific to breeds and closely related to their growth, reproduction, and lactation performance is of great practical significance for the protection and development of donkey genetic resources and for the rapid healthy development of my country's donkey industry. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a molecular marker and its specific primer pair for the body size trait of local Chinese donkey breeds. By analyzing the polymorphism of the ALOX12 gene in Yangyuan donkey, Guangling donkey, Turpan donkey, and Xinjiang donkey populations and its correlation with donkey body size traits, molecular markers significantly associated with donkey body size traits are identified, providing assistance for the specialized breeding of donkey breeds.

[0006] The technical solution of the present invention is as follows: Provide a property related to donkey body size traits ALOX12The gene molecular marker and its application, with its nucleotide sequence as shown in SEQ ID NO.1 and SEQ ID NO.2, contain two SNP sites: g.14737400C>T at the 69th bp of the region of exon 10, where the base is C or T, and this mutation leads to C / T polymorphism in the donkey body size trait molecule; and g.14741674A>G at the 667th bp of the region of exon 14, where the base is A or G, and this mutation leads to A / G polymorphism in the donkey body size trait molecule. Provide specific primer pairs for detecting the above molecular markers: The nucleotide sequence of the primer pair amplifying g.14737400C>T is as follows: Forward primer: 5'AGACCAACCTGTGCGAATGT 3' Reverse primer: 5'TGTTCAGACCTCCCCACTGA 3' The nucleotide sequence of the primer pair amplifying g.14741674A>G is as follows: Forward primer: 5'CATCCGTATCCCACTAGCCCA 3' Reverse primer: 5'GGAGGGAAAGTTGCCAAAGGA 3'.

[0007] Another objective of this invention is to provide a method for detecting molecular markers of donkey body size traits.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Step 1: Extract genomic DNA from the donkeys to be tested and check its integrity; Step 2: Using the specific primer pair described in claim 2, PCR amplification is performed with the genomic DNA of the donkey to be tested as a template, and the quality of the PCR product is detected by agarose gel electrophoresis. Step 3: Perform direct sequencing on the products that have passed the electrophoresis detection described in Step 2; Step 4: Compare and analyze the sequencing results from Step 3 with the molecular markers described in claim 1, and count the genotypes of the SNP sites in the donkey individuals to be tested; Step 5: Perform association analysis between the polymorphic locus genotypes of all individuals in the donkey population to be tested and the body size trait of that individual, and establish an analysis model.

[0009] Furthermore, the PCR amplification reaction system described in step 2 is as follows: template DNA 2.0 μL (<1 μg), forward primer 2.0 μL, reverse primer 2.0 μL, 2×PCR MasterMix 25.0 μL, ddH2O 19.0 μL.

[0010] Furthermore, the PCR amplification reaction conditions described in step 2 are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57.5℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 5 min, and the product is stored at 4℃.

[0011] Furthermore, the analytical model described in step 5 is as follows: y = m + G + A + B + e; Where y is the measured phenotypic value; m is the population mean; G is the genotype effect; A is the age effect; B is the variety effect; and e is the random residual.

[0012] The third objective of this invention is to provide an application of molecular markers for donkey body size traits.

[0013] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The application of the above-mentioned molecular markers is characterized by applying them to the breeding of local Chinese donkey breeds, thereby promoting the protection and utilization of local germplasm resources and providing assistance for the development of donkey gene chips.

[0014] The molecular marker for donkey body size traits, its detection method, and its application described in this invention have the following beneficial effects: Genotypes at two SNP sites (g.14737400C>T, g.14741674A>G) in exons 10 and 14 of the ALOX12 gene from four local Chinese donkey populations—Yangyuan, Guangling, Xinjiang, and Turpan—showed significant correlations with certain body size traits. Specifically, at the g.14737400C>T site, in the Yangyuan donkey population, individuals with genotypes CC and CT were significantly taller than those with TT in height, length, chest girth, and cannon bone circumference. In the Guangling donkey population, individuals with genotype CC had significantly greater height and cannon bone circumference than both CT and TT. In the Xinjiang donkey population, individuals with genotype CC had significantly greater length than CT, and individuals with genotype CT had significantly greater chest girth than TT. No significant differences were found among different genotypes in the Turpan donkey population. The g.14741674A>G locus corresponds to the AA genotype in the Yangyuan donkey population. Individuals with the GA genotype are significantly larger than those with the GG genotype in height, length, chest girth, and cannon bone circumference. No significant differences were found among different genotypes in the Guangling, Xinjiang, and Turpan donkey populations. It is preliminarily speculated that the two SNP loci on the ALOX12 gene (g.14737400C>T, g.14741674A>G) can serve as molecular genetic markers for donkey body size traits. Attached Figure Description

[0015] Figure 1 For donkey ALOX12 Electrophoresis results of PCR products of target gene sequence Figure 2 for ALOX12 Gene structure diagram and SNP site locations: White areas represent the upstream and downstream of the gene, and black blocks represent the downstream regions. ALOX12 The exons of a gene.

[0016] Figure 3 for ALOX12 Genotype peak diagram of two SNP loci of a gene Detailed Implementation

[0017] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0018] This study, based on the genome-wide association analysis of body size traits in Yangyuan donkeys, identified candidate genes significantly associated with body size traits. ALOX12 (Its RefSeq number is NC_091802.1) and its SNP site polymorphisms were validated and correlation analyzed to identify molecular markers significantly associated with body size traits of Chinese local donkey breeds, thereby accelerating the process of specialized donkey breeding. Four Chinese local donkey breeds—Yangyuan donkey, Guangling donkey, Xinjiang donkey, and Turpan donkey—were selected as research subjects in the experiment. PCR amplification was performed on these markers. ALOX12 Partial gene sequences were sequenced to identify SNP loci, and the genotypes of these SNP loci were correlated with donkey body size traits. Results showed two SNP loci (g.14737400C>T and g.14741674A>G) were found in exons 10 and 14 of the donkey ALOX12 gene. The genotypes of these two SNP loci were significantly correlated with donkey body size. Specifically, at the g.14737400C>T locus, in the Yangyuan donkey population, individuals with genotypes CC and CT were significantly larger than those with TT in height, length, chest girth, and cannon bone circumference. In the Guangling donkey population, individuals with genotype CC were significantly taller than both CT and TT, and their cannon bone circumference was significantly larger than CT. In the Xinjiang donkey population, individuals with genotype CC were significantly longer than CT, and individuals with genotype CT had significantly larger chest girths than TT. No significant differences were found among different genotypes in the Turpan donkey population. The g.14741674A>G locus corresponds to the AA genotype in the Yangyuan donkey population. Individuals with the GA genotype are significantly larger than those with the GG genotype in height, length, chest girth, and cannon bone circumference. No significant differences were found between different genotypes in the Guangling, Xinjiang, and Turpan donkey populations. Based on these results, the two SNP loci on the ALOX12 gene (g.14737400C>T, g.14741674A>G) can serve as molecular genetic markers for donkey body size traits.

[0019] The detailed operating steps are as follows: Adult female donkeys from four Chinese donkey breeds—Yangyuan donkey, Guangling donkey, Xinjiang donkey, and Turpan donkey—were selected as research subjects. Approximately 5 mL of blood was collected from the anterior vena cava, injected into EDTA anticoagulant tubes, mixed thoroughly, and frozen at -20°C for DNA extraction. Simultaneously, the height, length, chest girth, and cannula circumference of each donkey were measured.

[0020] DNA was extracted from blood samples of experimental donkeys using a blood genomic DNA extraction kit (Tiangen Biotech Co., Ltd.). The concentration and OD value of the extracted DNA were measured using NanoDrop 2000, and the DNA integrity was detected by 1.0% agarose gel electrophoresis.

[0021] Design primer pairs as follows: g.14737400C>T: Forward primer: 5' AGACCAACCTGTGCGAATGT 3'; Reverse primer: 5' TGTTCAGACCTCCCCACTGA 3' g.14741674A>G: Forward primer: 5' CATCCGTATCCCACTAGCCCA 3'; Reverse primer: 5' GGAGGGAAAGTTGCCAAAGGA 3'.

[0022] Based on the designed specific primer pairs (Table 1), PCR amplification was performed using DNA from individual experimental donkeys as templates.

[0023] Table 1 Donkey ALOX12 Gene-specific primers and annealing temperatures SNP name Forward primer (5'-3') Reverse primer (5'-3') Temperature (°C) Product length (bp) ALOX12-10 AGACCAACCTGTGCGAATGT TGTTCAGACCTCCCCACTGA 57.5 499 ALOX12-14 CATCCGTATCCCACTAGCCCA GGAGGGAAAGTTGCCAAAGGA 57.5 530 The PCR reaction system consisted of 50.0 uL: template DNA 2.0 uL (<1 μg), upstream primer 2.0 uL, downstream primer 2.0 uL, 2×TSINGKE MasterMix 25.0 uL, and ddH2O 19.0 uL.

[0024] PCR reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57.5℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 5 min; products stored at 4℃. PCR product quality was assessed by 1.0% agarose gel electrophoresis.

[0025] The DNA samples extracted in this study all had a concentration exceeding 30 ng / μL, with OD values ​​ranging from 1.8 to 2.0. Electrophoresis results showed clear bands without any extraneous bands, indicating that the DNA samples were qualified. PCR amplification products, examined by 1% agarose gel electrophoresis, showed clear bands without any extraneous bands, good specificity, and product lengths as expected, making them suitable for sequencing.

[0026] The PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for direct sequencing. The sequencing results were compared and analyzed using DNAMAN and ChromasPro software to count the genotypes of SNP sites in the four donkey populations.

[0027] By comparing and analyzing the sequencing results, in ALOX12 A C→T mutation (g.14737400C>T) was found at position 69 bp in exon 10 of the gene (whose nucleotide sequence is shown in SEQ ID NO.1), and an A→G mutation (g.14741674A>G) was found at position 667 bp in exon 14, for a total of two SNP sites.

[0028] Genotype and allele frequencies for each locus were calculated using Excel. Association analyses were performed on SNP loci with body height, body length, chest circumference, and cannon bone circumference of the experimental donkeys using a general linear model in IBM SPSS 26.0 software. Data are expressed as mean ± standard error. The analytical model is: y = μ + G + B + A + e, where y is the phenotypic value, μ is the population mean, G is the genotype effect, B is the breed effect, A is the age effect, and e is the random residual.

[0029] Genotyping results showed that the g.14737400C>T locus exhibited three genotypes (CC, CT, and TT) in all four donkey breeds. C was the dominant genotype in the Yangyuan and Guangling donkey populations, while T was the dominant genotype in the Xinjiang and Turpan donkey populations. The g.14741674A>G locus exhibited three genotypes (AA, GA, and GG) in the Yangyuan, Guangling, and Turpan donkey populations, but only GA and GG genotypes were observed in the Xinjiang donkey population. G was the dominant genotype in the Yangyuan, Turpan, and Xinjiang donkey populations, while A was the dominant genotype in the Guangling donkey population (Table 2).

[0030] Table 2 ALOX12 Genotype and allele frequencies of SNP sites in different breeds of donkeys

[0031] Note: II: Normal homozygous type; ID: Heterozygous type; DD: Mutant homozygous type; YD: Yangyuan donkey; GD: Guangling donkey; TD: Turpan donkey; XD: Xinjiang donkey.

[0032] Association analysis revealed a significant correlation between the genotypes of two SNP loci and the size trait in donkeys. Specifically, at the g.14737400C>T locus (Table 3), individuals with genotypes CC and CT in the Yangyuan donkey population were significantly larger than those with TT in height, length, chest girth, and cannon bone circumference. In the Guangling donkey population, individuals with genotype CC were significantly larger in height than those with CT and TT, and their cannon bone circumference was significantly larger than CT. In the Xinjiang donkey population, individuals with genotype CT were significantly larger in length than those with CC, and their chest girth was significantly larger than TT. No significant differences were found among different genotypes in the Turpan donkey population. At the g.14741674A>G locus (Table 4), individuals with genotypes AA and GA in the Yangyuan donkey population were significantly larger than those with genotype GG in height, length, chest girth, and cannon bone circumference. No significant differences were found among different genotypes in the Guangling, Xinjiang, and Turpan donkey populations.

[0033] Table 3. Association analysis results between the g.14737400C>T site and donkey body size trait. ;

[0034] Note: II: Normal homozygous type; ID: Heterozygous type; DD: Mutant homozygous type; YD: Yangyuan donkey; GD: Guangling donkey; TD: Turpan donkey; XD: Xinjiang donkey. Different letters in the same row's shoulder label indicate significant differences (P<0.05), while no letter or the same letter in the shoulder label indicates no significant differences.

[0035] Table 4. Association analysis results between the g.14741674A>G locus and donkey body size trait. ;

[0036] Note: II: Normal homozygous type; ID: Heterozygous type; DD: Mutant homozygous type; YD: Yangyuan donkey; GD: Guangling donkey; TD: Turpan donkey; XD: Xinjiang donkey. Different letters in the same row's shoulder label indicate significant differences (P<0.05), while no letter or the same letter in the shoulder label indicates no significant differences.

[0037] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0038] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An ALOX12 gene molecular marker associated with a donkey body size trait, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, SEQ ID NO. 2, and two SNP sites are present in the sequence, which are g.14737400C>T at 69bp in exon 10 region, and g.14741674A>G at 667bp in exon 14 region.

2. The specific primer pair for amplifying the molecular marker of claim 1, wherein the nucleotide sequence of the primer pair for amplifying g.14737400C>T is: Forward primer: 5' AGACCAACCTGTGCGAATGT 3' Reverse primer: 5' TGTTCAGACCTCCCCACTGA 3' The nucleotide sequence of the primer pair for amplifying g.14741674A>G is: Forward primer: 5' CATCCGTATCCCACTAGCCCA 3' Reverse primer: 5' GGAGGGAAAGTTGCCAAAGGA 3'. The method comprises the following steps:

3. A method for detecting the molecular marker of claim 1, wherein, Step 1, extracting DNA of the to-be-tested donkey and detecting the integrity thereof; Step 2, using the specific primer pair of claim 2 to perform PCR amplification with the DNA of the to-be-tested donkey as a template, and using agarose gel electrophoresis to detect the quality of the PCR product; Step 3, directly sequencing the product of step 2 that passes the electrophoresis detection; Step 4, comparing and analyzing the sequencing result of step 3 with the molecular marker of claim 1, and counting the genotype of each SNP site of the to-be-tested donkey individual; Step 5, performing association analysis on the polymorphic site genotype of all individuals in the to-be-tested donkey population and the body size trait, and establishing an analysis model. The PCR amplification reaction system in step 2 is as follows: template DNA 2.0 μL (<1 μg), forward primer 2.0 μL, reverse primer 2.0 μL, 2×PCR MasterMix 25.0 μL, and ddH2O 19.0 μL.

4. A method of detecting a molecular label as claimed in claim 3, wherein, The PCR amplification reaction conditions described in step 2 are as follows: pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 57.5℃ for 30 s, extension at 72℃ for 30 s, 35 cycles, final extension at 72℃ for 5 min, and product storage at 4℃.

5. A method of detecting a molecular label as claimed in claim 3, wherein, The analysis model described in step 5 is shown in the following formula:

6. A method of detecting a molecular label as claimed in claim 3, wherein, y = m + G + A + B + e; wherein y is the determined phenotype value, m is the population mean, G is the genotype effect, A is the age effect, B is the breed effect, and e is the random residual error. The above-mentioned molecular marker is applied to the breeding of Chinese local donkey breeds, and the breeding purpose is to promote the protection and utilization of local germplasm resources and the cultivation of specialized breeds of donkeys.

7. Use of the molecular marker of claim 1, wherein, ​