A molecular marker and its application in identifying pig backfat thickness trait

Abstract

The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker and application thereof in identifying pig backfat thickness. The molecular marker comprises a nucleic acid with a nucleotide sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2, and a polymorphism exists at the 9th position, which is A or G. The application comprises: detecting the polymorphism of the molecular marker in a pig sample to be tested, and determining the backfat thickness of the pig to be tested according to the genotype detection result, and pigs with genotype AA have lower backfat thickness than pigs with genotype AG or GG. The present application screens and obtains a molecular marker related to pig backfat thickness. The genotype of the pig at the molecular marker can be detected to realize the prediction and detection of the pig backfat thickness, and the molecular marker can be applied to breed pig varieties with low backfat thickness, and has important application value.

Description

Technical Field

[0001] This invention relates to the field of animal breeding technology, and in particular to a molecular marker and its application in identifying the backfat thickness trait in pigs. Background Technology

[0002] The pig industry is one of the pillar industries of the agricultural economy, and pork production and quality are directly related to the national economy and people's livelihood. With the upgrading of consumption and changes in market demand, increasing pork production and improving carcass quality have become core issues that breeding scientists and breeding enterprises have been exploring for a long time. Among the many economic traits of pigs, backfat thickness is a key indicator for evaluating the fattening effect and fat deposition capacity of pigs, and has a decisive impact on the economic value of pigs. Backfat thickness is closely related to the meat production performance of pigs: the thicker the backfat, the lower the lean meat percentage; conversely, the thinner the backfat, the higher the lean meat percentage. Therefore, reducing backfat thickness and increasing carcass lean meat percentage are important breeding goals for pig breeding work both domestically and internationally.

[0003] Early pig breeding efforts primarily focused on phenotypic selection, which involved measuring backfat thickness in vivo or post-slaughter and using optimal linear unbiased prediction methods to estimate breeding values, selecting superior breeding pigs for propagation. While this method has contributed to the advancement of pig genetic improvement to some extent, it still has significant limitations: First, slaughter measurement leads to the loss of superior breeding pigs, making it impossible to directly retain candidate individuals for breeding; while in vivo ultrasound measurement is feasible, it is only meaningful when pigs reach a specific growth stage, making it impossible to obtain phenotypic data at early stages (such as birth or weaning), hindering early screening; second, phenotypic selection requires waiting for breeding pigs to reach a specific weight before measurement, prolonging the breeding cycle and slowing down genetic progress; third, traditional breeding methods have limited effectiveness for carcass traits that are difficult to measure directly, especially antagonistic traits (such as growth rate and backfat thickness), where traditional methods struggle to achieve synergistic improvement. With the rapid development of molecular genetics and genomics, pig breeding has entered a new era of marker-assisted selection. As a DNA-based genetic selection technology, molecular marker-assisted breeding has significant advantages such as early selection and high accuracy. Among various molecular markers, single nucleotide polymorphism (SNP) sites are considered third-generation genetic markers, possessing advantages such as abundant quantity, wide distribution, high stability, and ease of automated detection. They have become an ideal tool for genome analysis, automated bioinformatics detection, and livestock breeding marker research. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a molecular marker related to backfat thickness and birth weight in pigs and its application.

[0005] The role of the cysteine-rich secretory protein LCCLdomain-containing 2 (CRISPLD2) gene in porcine fat deposition is not fully elucidated, but some studies suggest it may be involved in adipocyte differentiation and energy metabolism regulation. This invention, through deep sequencing of the genomes of Large White pigs with thick and thin backfat, discovered SNP sites in the CRISPLD2 gene region closely related to the backfat thickness trait. The backfat thickness trait in pigs can be identified by detecting its genotype.

[0006] In a first aspect, the present invention provides a molecular marker comprising a nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the 9th position exhibits a polymorphism of A or G.

[0007] The nucleotide sequence shown in SEQ ID NO.1:

[0008] CCCAAGTTATCAAGTGTGACACCAAGATGAAGGACAAGTGTAAAGGGTCCACGTGTAACA.

[0009] The nucleotide sequence shown in SEQ ID NO.2:

[0010] CCCAAGTTGTCAAGTGTGACACCAAGATGAAGGACAAGTGTAAAGGGTCCACGTGTAACA.

[0011] Secondly, the present invention provides a primer pair for amplifying the aforementioned molecular marker.

[0012] The primer pair design method described in this invention can be a conventional method of this invention. Technicians can design primer pairs (including primer pairs or KASP primer combinations) of different lengths based on existing primer design rules and primer design software (such as Primer) to amplify the aforementioned molecular markers.

[0013] Thirdly, the present invention provides a primer pair comprising nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0014] The nucleotide sequence shown in SEQ ID NO.3:

[0015] TGAGTGAGGTATCCAGGGAGACAG.

[0016] The nucleotide sequence shown in SEQ ID NO.4:

[0017] AGGAATTTGGGGACGTTAGCCTG。

[0018] The sequence amplified by this primer pair, the nucleotide sequence shown as SEQ ID NO.5:

[0019] TGAGTGAGGTATCCAGGGAGACAGGGCTTCTGGAAAGAGGTGGCTCTGGGATTTGAACCTCACCCTACGCCTGCAGCCACTGCAGAACAATTCCAGAACATTCCAGAAAGTTCCTCAAAGCAGACAGTGGGATCTTCTCCCCCTTCTCGCTGTGACGTGTGTTTCTGCATTTCTCCCCAGCCCAAGTTATCAAGTGTGACACCAAGATGAAGGACAAGTGTAAAGGGTCCACGTGTAACAGGTAAGGGCTGCCCGTCCCTCTTGCCCGCCTGCAGCCCTCGAGGCACCTGCTCTGGGTCGTGGGTCACGCTGAGATCTGTCAGCTGAGAACCACCCGGCCCGAGACGGGTAGAAAGAAACCCACAGAAATGCCACTCTCTGTTTTTAGCACAGTTCTTGGGCCAGGCAGGAAGGGATCCTGCTCACTTCGTGTCACCTGTCAGGCTAACGTCCCCAAATTCCT。

[0020] The nucleotide sequence shown as SEQ ID NO.6:

[0021] TGAGTGAGGTATCCAGGGACAGGGCTTCTGGAAAGAGGTGGCTCTGGGATTTGAACCTCACCCTACGCCTGCAGCCACTGCAGAACAATTCCAGAACATTCCAGAAAGTTCCTCAAAGCAGACAGTGGGATCTTTCCCTTCTCGCTGTGACGTGTGTTTCCTGCATTTCTCCCCAGCCCAAGTTGTCAAGTGTGACACCAAGATGAAGGACAAGTGTAAAGGGTCCAC GTGTAACAGGTAAGGGCTGCCCGTCCCTCTTGCCCGCCTGCAGCCCTCGAGGCACCTGCTCTGGGTCGTGGGTCACGCTGAGATCTGTCAGCTGAGAACCACCCGGCCCGAGACGGGTAGAAAGAAACCCACAGAAATGCCACTCTCTGTTTTTAGCACAGTTCTTGGGCCAGGCAGGAAGGGATCCTGCTCACTTCGTGTCACCTGTCAGGCTAACGTCCCCAAATTCCT.

[0022] Fourthly, the present invention provides a kit comprising the aforementioned molecular markers or the aforementioned primer pairs.

[0023] Fifthly, the present invention provides the application of SNP sites as targets in any of the following:

[0024] (1) Predict or detect backfat thickness in pigs, or prepare a reagent for predicting or detecting backfat thickness in pigs;

[0025] (2) Identify or breed pig breeds with low backfat thickness, or prepare reagents for identifying or breeding pig breeds with low backfat thickness;

[0026] (3) Molecular marker-assisted breeding of pigs;

[0027] (4) Improvement of pig breeds related to backfat thickness;

[0028] (5) Improvement of pig germplasm resources;

[0029] Based on the genome version number Sscrofa11.1 GCF_000003025.6, the SNP site is located at the 8th bp of the 8th exon of the CRISPLD2 gene, and the polymorphism is A or G.

[0030] In a sixth aspect, the present invention provides the use of the aforementioned molecular markers, or the aforementioned primer pairs, or the aforementioned kits in any of the following:

[0031] (1) Predict or detect backfat thickness in pigs, or prepare a reagent for predicting or detecting backfat thickness in pigs;

[0032] (2) Identify or breed pig breeds with low backfat thickness, or prepare reagents for identifying or breeding pig breeds with low backfat thickness;

[0033] (3) Molecular marker-assisted breeding of pigs;

[0034] (4) Improvement of pig breeds related to backfat thickness;

[0035] (5) Improvement of pig germplasm resources.

[0036] In a seventh aspect, the present invention provides a method for identifying the backfat thickness of pigs, comprising:

[0037] The polymorphism of molecular markers was detected in the pig samples to be tested, and the backfat thickness of the pigs was determined based on the genotype detection results.

[0038] Furthermore, the detection method includes one or more of the following: gene sequencing, molecular probes, liquid phase capture, or mass spectrometry.

[0039] Furthermore, determining the backfat thickness of the pig under test based on the genotype detection results includes:

[0040] Pigs with the AA genotype have a lower back fat thickness compared to pigs with the AG or GG genotypes.

[0041] Eighthly, the present invention provides a method for breeding pig breeds with low backfat thickness, comprising:

[0042] In the process of pig breed selection, pigs with the genotype AA, as indicated by the aforementioned molecular markers, are retained for subsequent breeding processes.

[0043] The present invention has the following beneficial effects:

[0044] This invention provides a molecular marker associated with the backfat thickness trait in pigs. Pigs with the genotype AA of this marker have significantly lower backfat thickness than pigs with genotypes AG and GG. The molecular marker provided by this invention can be applied to breed pigs with specific backfat thickness traits, which is beneficial for meeting the continuous demand for efficient feed energy utilization in large-scale production. Attached Figure Description

[0045] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0046] Figure 1 The results are PCR amplification results of exon 8 of the porcine CRISPLD2 gene provided in Example 1 of this invention. M is DL10000, and lanes 1-6 are PCR amplification products of the Large White pig genome.

[0047] Figure 2 This is a sequence diagram of the sequencing results of three representative individuals with three genotypes of the large white pig CRISPLD2 gene exon 8 mutation site provided in Example 1 of this invention.

[0048] Figure 3 This is a peak diagram of sequencing results from three representative individuals with three genotypes of the Large White pig CRISPLD2 gene exon 8 mutation site provided in Example 1 of this invention. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0050] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0051] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0052] The CRISPLD2 gene-related information in the following examples is based on genome version Sscrofa11.1 GCF_000003025.6.

[0053] Example 1

[0054] I. Extraction of porcine genomic DNA

[0055] The experimental pig breed used in this application was Large White pig, and the samples were obtained from Shuangbaotai (Group) Co., Ltd. Genomic DNA was extracted from pig ear tissue using a commercially available kit, following the kit's instructions. The concentration and quality of the extracted DNA were tested and then stored at -20℃ for later use.

[0056] (1) Ear tissues were collected from 127 large white pigs. Hair on the ear margin tissue was removed with sterilized surgical scissors. The clean tissues were then cut into small pieces, ground, and placed in 1.5 mL centrifuge tubes.

[0057] (2) Add 200 μL of buffer GA to each sample, vortex and mix thoroughly.

[0058] (3) Add 20 μL proteinase K, vortex to mix, incubate in a water bath at 56 °C for 60 min until the tissue dissolves, and then briefly centrifuge.

[0059] (4) Add 200 μL of buffer GB, mix thoroughly by inverting, place at 70°C for 30 min until the solution becomes clear, and then centrifuge briefly.

[0060] (5) Add 200 μL of anhydrous ethanol, shake well for 15 seconds, and then briefly centrifuge after the flocculent precipitate appears.

[0061] (6) Add the solution and flocculent precipitate into the adsorption column CB3, then centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0062] (7) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0063] (8) Add 600 μL of washing solution PW to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0064] (9) Repeat step (8).

[0065] (10) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for a few minutes to dry the remaining rinsing liquid.

[0066] (11) Transfer the adsorption column CB3 into a clean centrifuge tube, add 70 μL of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 5 min, centrifuge at 12000 rpm for 2 min, and collect the solution into the centrifuge tube.

[0067] (12) Concentration determination, DNA quality detection, and DNA of all Large White pigs were obtained.

[0068] (13) The prepared DNA was aliquoted and stored at 4℃ and -20℃ respectively.

[0069] II. Obtaining the porcine CRISPLD2 gene fragment and detecting CRISPLD2 gene SNP sites

[0070] This invention provides 50 pig genomic DNA samples and commissions Beijing Novogene Technology Co., Ltd. to perform deep genome sequencing and subsequent bioinformatics analysis.

[0071] (1) Sample testing: The DNA quality of the sample is tested for purity, integrity and concentration in a routine manner to ensure that it meets the requirements for subsequent library construction and sequencing.

[0072] (2) Library construction: After the qualified DNA samples are randomly fragmented by mechanization, the end repair, adapter ligation and amplification purification are carried out using commercial library construction kits to prepare sequencing libraries.

[0073] (3) Sequencing: After library construction, the library concentration and fragment length are detected. Qualified libraries are subjected to paired-end high-throughput sequencing using the Illumina NovaSeq sequencing platform to obtain raw sequence data.

[0074] (4) Data quality control: The raw data obtained from sequencing undergoes quality control to remove low-quality reads and adapter contamination, thereby obtaining high-quality and effective data.

[0075] (5) Alignment analysis: The quality-controlled sequencing data were aligned to the pig reference genome using BWA software. The alignment results were processed to remove duplicate reads, and the sample alignment rate, average sequencing depth, and coverage were calculated to evaluate the sequencing quality.

[0076] (6) SNP detection was performed on the high-quality alignment results using SAMTOOLS software, and filtered using criteria such as deletion rate, sequencing depth, and minimum allele frequency to obtain a high-confidence SNP set. Subsequently, functional annotation of the SNP sites was performed using ANNOVAR software, including annotations of gene regions, functional regions, and variant types. Based on the annotation results, gene regions significantly associated with the backfat thickness trait in pigs were screened, and the key SNP site in the CRISPLD2 gene was finally identified, which showed a significant correlation with differences in backfat thickness.

[0077] Through the above sequencing and variant detection process, this application successfully identified the CRISPLD2 gene SNP site associated with backfat thickness in pigs, providing an important genetic basis for subsequent molecular marker-assisted breeding and research on fat deposition regulation mechanisms.

[0078] III. Obtaining the eighth exon fragment of the porcine CRISPLD2 gene

[0079] 1. PCR amplification

[0080] The following primer pairs were designed based on the CRISPLD2 gene sequence (Gene ID: 100625354 in the GeneBank database):

[0081] Forward primer CRISPLD2-F: TGAGTGAGGTATCCAGGGAGACAG (SEQ ID NO. 3),

[0082] Reverse primer CRISPLD2-R: AGGAATTTGGGGACGTTAGCCTG (SEQ ID NO. 4).

[0083] The above primers were used to amplify the genomic DNA of 127 Large White pigs. The PCR reaction system was 25 μL, and the concentrations of each component in the system were 50 ng template, 12.5 μL 2×phanta Max Mix, 1 μL each of the above forward and reverse primers, and 9.5 μL ddH2O.

[0084] The PCR procedure was as follows: preheating at 98℃ for 30 seconds; denaturation at 98℃ for 10 seconds, annealing at 61℃ for 5 seconds, extension at 72℃ for 30 seconds, for a total of 35 cycles; final extension at 72℃ for 1 minute; storage at 4℃. 5 μL of the PCR product was analyzed by 1% agarose gel electrophoresis, yielding an amplified product with a single target band length of 463 bp. See details... Figure 1 .

[0085] 2. Detection of variant sites in the eighth exon of the porcine CRISPLD2 gene

[0086] The obtained PCR amplification products were directly sent to Zhejiang Youkang Biotechnology Co., Ltd. for nanopore sequencing to obtain SEQ ID NO.5 and SEQ ID NO.6 sequences.

[0087] The sequence of the amplified product is shown in SEQ ID NO.5:

[0088] TGAGTGAGGTATCCAGGGAGACAGGGCTTCTGGAAAGAGGTGGCTCTGGGATTTGAACCTCACCCTACGCCTGCAGCCACTGCAGAACAATTCCAGAACATTCCAGAAAGTTCCTCAAAGCAGACAGTGGGATCTTCTCCCCCTTCTCGCTGTGACGTGTGTTTCTGCATTTCTCCCCAGCCCAAGTTATCAAGTGTGACACCAAGATGAAGGACAAGTGTAAAGGGTCCACGTGTAACAGGTAAGGGCTGCCCGTCCCTCTTGCCCGCCTGCAGCCCTCGAGGCACCTGCTCTGGGTCGTGGGTCACGCTGAGATCTGTCAGCTGAGAACCACCCGGCCCGAGACGGGTAGAAAGAAACCCACAGAAATGCCACTCTCTGTTTTTAGCACAGTTCTTGGGCCAGGCAGGAAGGGATCCTGCTCACTTCGTGTCACCTGTCAGGCTAACGTCCCCAAATTCCT。

[0089] or as shown in SEQ ID NO.6:

[0090] TGAGTGAGGTATCCAGGGAGACAGGGCTTCTGGAAAGAGGTGGCTCTGGGATTTGAACCTCACCCTACGCCTGCAGCCACTGCAGAACAATTCCAGAACATTCCAGAAAGTTCCTCAAAGCAGACAGTGGGATCTTCTCCCCCTTCTCGCTGTGACGTGTGTTTCTGCATTTCTCCCCAGCCCAAGTTGTCAAGTGTGACACCAAGATGAAGGACAAGTGTAAAGGGTCCACGTGTAACAGGTAAGGGCTGCCCGTCCCTCTTGCCCGCCTGCAGCCCTCGAGGCACCTGCTCTGGGTCGTGGGTCACGCTGAGATCTGTCAGCTGAGAACCACCCGGCCCGAGACGGGTAGAAAGAAACCCACAGAAATGCCACTCTCTGTTTTTAGCACAGTTCTTGGGCCAGGCAGGAAGGGATCCTGCTCACTTCGTGTCACCTGTCAGGCTAACGTCCCCAAATTCCT。

[0091] 3. Molecular marker typing

[0092] Genotyping was performed on the sequencing results of 127 pigs; see details below. Figure 2 (Sequence diagram of sequencing results) Figure 3 (Sequencing results peak diagram) and Table 1.

[0093] Table 1. Statistical results of genotype and allele frequencies at the rs3909944 locus of the CRISPLD2 gene on chromosome 6 in Large White pigs.

[0094]

[0095] 4. Correlation analysis and application of the molecular markers of this invention with backfat thickness in pigs

[0096] The experimental pig herd used for association analysis consisted of 127 Large White pigs. Polymorphism was detected using the direct sequencing method of PCR products provided in the above examples. Analysis of variance was performed using the GLM program in SAS statistical software to analyze the correlation between the three different genotypes of the pig CRISPLD2 gene and the backfat thickness trait. The model used was:

[0097]

[0098] in The phenotypic value for back fat thickness. The group mean This is a genotype effect. Due to the pig farm effect, For gender effect, The paternal effect, This represents a random residual effect. Results are expressed as least squares mean ± standard error, and P < 0.05 is considered statistically significant.

[0099] The association analysis results are shown in Table 2. The backfat thickness of individuals with the AA genotype was significantly lower than that of individuals with the AG and AA genotypes (P<0.05).

[0100] Table 2. Association analysis between the A>G mutation at locus rs3909944 on chromosome 6 of the pig genome and backfat thickness in pigs.

[0101]

[0102] Note: The shoulder mark is a marker of significant difference in the same quality among different genotypes.

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of SNP molecular markers as detection targets in any of the following: (1) Predict the backfat thickness of pigs, or prepare a reagent for predicting the backfat thickness of pigs; (2) Identify or breed pig breeds with low backfat thickness, or prepare reagents for identifying or breeding pig breeds with low backfat thickness; Based on genome version number Sscrofa11.1 GCF_000003025.6, the SNP is located at the 8th bp of the 8th exon of the CRISPLD2 gene, corresponding to the 9th position of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.

2. The polymorphism at this site is A or G. Pigs with genotype AA have lower backfat thickness compared to pigs with genotype AG or GG.

2. Application of primer pairs or kits for detecting SNP molecular markers in any of the following: (1) Predict the backfat thickness of pigs, or prepare a reagent for predicting the backfat thickness of pigs; (2) Identify or breed pig breeds with low backfat thickness, or prepare reagents for identifying or breeding pig breeds with low backfat thickness; The molecular marker includes a nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2, which has a polymorphism at position 9, either A or G. Pigs with genotype AA have a lower back fat thickness compared to pigs with genotype AG or GG. The primer pairs include forward and reverse primers with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; The kit includes the primer pair.

3. A method for determining the backfat thickness of pigs, characterized in that, include: The polymorphism of molecular markers was detected in the pig samples to be tested, and the backfat thickness of the pigs was determined based on the genotype detection results. The molecular marker comprises a nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the 9th position exhibits a polymorphism of A or G; The determination of the backfat thickness of the pig under test based on the genotype detection results includes: Pigs with the AA genotype have a lower back fat thickness compared to pigs with the AG or GG genotypes.

4. The method according to claim 3, characterized in that, The detection methods include one or more of gene sequencing, liquid phase capture, or mass spectrometry.

5. A method for breeding pig breeds with low backfat and thick backfat, characterized in that, include: In the process of pig breed selection, pigs with the molecular marker genotype AA are retained for subsequent breeding processes; The molecular marker comprises a nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the 9th position exhibits a polymorphism of A or G.

Images