SNP (Single Nucleotide Polymorphism) molecular marker primer for identifying male and female plants of actinidia valvata and application of SNP molecular marker primer

By designing SNP molecular marker primers kiwi-F/R and combining them with PCR amplification and agarose gel electrophoresis, the problem of long identification time for male and female plants of Actinidia cuspidatum was solved, enabling rapid identification during the seedling stage and shortening the breeding process, thereby improving breeding efficiency and grafting advantages.

CN121344236APending Publication Date: 2026-01-16SHAANXI SCI TECH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511576185.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-31
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

In existing technologies, the identification of male and female plants of Actinidia cuspidatum takes a long time in the process of new variety breeding and improvement, which affects the breeding process.

Method used

This invention provides an SNP molecular marker primer that, by designing specific upstream and downstream primers (kiwi-F and kiwi-R), combines PCR amplification and agarose gel electrophoresis techniques to rapidly and accurately identify male and female kiwi plants.

Benefits of technology

It enables rapid, simple, and accurate identification of male and female plants during the seedling stage, shortens the breeding process, improves breeding efficiency, constructs male paternal lineages, enhances grafting advantages, and is suitable for large-scale rapid testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344236A_ABST
    Figure CN121344236A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker primer for identifying male and female plants of actinidia valvata and application of the SNP molecular marker primer. The nucleotide sequences of the marker primer are shown as SEQ ID NO. 1 and SEQ ID NO. 2. The primer provided by the invention solves the problem that the male parent and male parent selection time is relatively long in the new variety cultivation and improved hybrid combination configuration process. The method can be used for identifying the sex of the actinidia valvata at the seedling stage; the method can be applied to molecular marker assisted breeding, it can be ensured that stocks with good affinity with scion varieties can be selected through identification, the grafting success rate is increased, the breeding cost is saved, and the stress resistance and adaptability of the scion varieties are improved. By identifying the hybrid combination of different male and female individuals in the early breeding stage, the male and male parent family is constructed, and the method has important significance in improving the grafting advantage and breeding efficiency and shortening the breeding process. Compared with polyacrylamide gel electrophoresis, the electrophoresis technology for detection is rapid, simple and convenient, and is safer to the environment and human bodies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to primers for sex identification of seedling materials of Actinidia cuspidatum, specifically to an SNP molecular marker primer for identifying male and female plants of Actinidia cuspidatum and its application. Background Technology

[0002] Actinidia chinensis (Kiwifruit) Actinidiavalvata It belongs to the genus Actinidiaceae (family Actinidiaceae). Actinidia Actinidis kiwifruit (Lindl.) is a unique wild germplasm resource, a large, perennial, dioecious deciduous vine. The genus *Actinidia* boasts high genetic diversity among dicotyledons, with its germplasm bank encompassing 54 species and 21 varieties. Interspecific differentiation is evident not only in morphological characteristics such as leaf shape and floral structure but also in significant polymorphism in fruit traits. This multidimensional pattern of genetic variation provides a material foundation for germplasm resource innovation and the construction of molecular marker-assisted breeding systems.

[0003] As a typical functional dioecious plant, the sex differentiation mechanism of kiwifruit has special biological significance: although female flowers retain degenerated anthers, male flowers have vestigial stigmas, and neither can complete self-pollination. This reproductive strategy of "morphological hermaphroditism, functional unisexuality" forms a co-evolutionary relationship with the advantages of male plants in stress resistance and rootstock adaptability.

[0004] Male kiwifruit plants exhibit significantly superior stress adaptability compared to female plants through enhanced antioxidant systems, accumulation of disease-resistant metabolites, and efficient expression of stress-response genes. When used as rootstock, their root vigor and material transport efficiency can significantly improve the stress resistance and productivity of grafted varieties. Currently, establishing male-specific molecular markers to guide the targeted breeding of rootstocks has become a core technological pathway for improving the quality and efficiency of the modern kiwifruit industry. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker primer that can be used to identify male and female plants of Actinidis cuspidatum, which can quickly and effectively distinguish female and male plants during the seedling stage, and solves the problem of long selection time for male male parents in the process of hybrid combination configuration for the breeding and improvement of existing new varieties.

[0006] To achieve the above objectives, the present invention provides SNP molecular marker primers for identifying male and female plants of Actinidia cuspidata, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0007] The marker primers provided by this invention can be used to identify different male and female hybrid combinations in the early stages of breeding; including the identification of male and female plants of Actinidis calyx; identification of different male and female hybrid combinations in the early stages of breeding; construction of male paternal families; improvement of grafting vigor and breeding efficiency; and shortening of the breeding process. It has significant application prospects in the field of Actinidis calyx cultivation.

[0008] This invention provides a method for identifying male and female *Actinidia cuspidatum* plants using SNP molecular marker primers as described above, the method comprising: Genomic DNA was extracted from *Actinidia cuspidatum* as a template; PCR amplification was performed using the upstream primer shown in SEQ ID NO.1 and the downstream primer shown in SEQ ID NO.2, and the PCR amplification products were detected by agarose gel electrophoresis; the sex of the *Actinidia cuspidatum* to be identified was determined based on the banding pattern of the agarose gel electrophoresis results: if the agarose gel electrophoresis results contained a 194bp band, the kiwifruit to be identified was a male plant; if there was no 194bp band, the kiwifruit to be identified was a female plant.

[0009] Preferably, the PCR amplification system comprises: 2×Taq PCR Master Mix (with Dye), primer kiwi-F, primer kiwi-R, template DNA, and ddH2O.

[0010] Preferably, the PCR amplification reaction conditions are: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min.

[0011] This invention provides a kit containing SNP molecular marker primers for identifying male and female *Actinidia cuspidatum* plants as described above. This kit can be applied in the cultivation of *Actinidia cuspidatum*, including: identification of male and female plants; identification of different hybridization combinations of male and female individuals in the early stages of breeding; and construction of male paternal lineages. It boasts high accuracy and significant practical value.

[0012] This invention provides a primer for identifying SNP molecular markers in male and female plants of Actinidia cuspidatum and its application, which solves the problem of long selection time for male paternal parents in the process of hybrid combination configuration for the breeding and improvement of existing new varieties, and has the following advantages: 1. The method of the present invention is used to identify the sex of kiwifruit seedlings. It has the advantages of being simple, fast and accurate. The marker can be used to identify the sex of the seedlings by taking a small amount of leaves (100mg) and does not cause damage to the plants. At the same time, the method can be applied to molecular marker-assisted breeding. By identifying different male and female individuals in the early stage of breeding, male paternal lineages can be constructed to improve grafting vigor, breeding efficiency and shorten the breeding process. 2. The method of this invention only requires a pair of primers for PCR amplification to identify male and female plants of Actinidia cuspidatum. Ordinary PCR reagents can meet the amplification requirements, and expensive high-fidelity enzymes are not required. Moreover, the simplest and fastest electrophoresis technique—agarose gel electrophoresis—is used for detection. The gel preparation process only takes 10 minutes, and the results can be directly observed after electrophoresis. The detection results are clear and easy to read, making it suitable for rapid identification of large batches of Actinidia cuspidatum. The electrophoresis technique used for detection is faster, simpler, and safer for the environment and human body than polyacrylamide gel electrophoresis. Attached Figure Description

[0013] Figure 1 The agarose gel electrophoresis results of 10 male and female *Actinidia cuspidata* plants were used to identify the SNP molecular marker primers of this invention.

[0014] Figure 2 The agarose gel electrophoresis results of six male kiwifruit plants were used to identify the SNP molecular marker primers of this invention.

[0015] Figure 3 The agarose gel electrophoresis results of six female *Actinidia cuspidatum* plants were used to identify the SNP molecular marker primers of this invention. Detailed Implementation

[0016] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0018] Example 1 The development of SNP molecular marker primers for identifying male and female *Actinidia cuspidata* plants includes the following: This SNP was identified using GBS-SNP-CROP software. The entire genome of male kiwifruit plants was extracted and sequenced. A Mock Reference was assembled using the sequencing reads from the male plants. The SNP loci of the male plants were then located in the Mock Reference, and the corresponding cluster sequence was found based on the SNP. Primers capable of distinguishing between male and female plants were designed using the SNP loci of the male plants. The specific verification is as follows: (1) Genomic DNA was extracted from the leaves of the seedling stage of Actinidia cuspidatum as a template, and a total of 20 male and female plants were selected.

[0019] (2) PCR amplification was performed using the open-source sex marker kiwi-F / R (specific primer sequences are as follows); kiwi-F (SEQ ID NO.1): GGTCCGACTTTCAGTCCTGTCTATTAG; kiwi-R (SEQ ID NO.2): TTGCCTGCGAAAAAAACTAAATATAATTAGG.

[0020] The PCR amplification system (20 μL) includes: 10 μL of 2×Taq PCR Master Mix (with Dye), 1 μL of primer kiwi-F, 1 μL of primer kiwi-R, 1 μL of template DNA, and 7 μL of ddH2O; The PCR reaction conditions were as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min.

[0021] (3) The PCR amplification products of 20 calyx kiwifruit were detected by agarose gel electrophoresis. The sex of the calyx kiwifruit could be directly determined based on the band pattern of the agarose gel electrophoresis results: if the agarose gel electrophoresis results contained a band of 194bp, the kiwifruit to be identified was a male plant; if there was no 194bp band, it was a female plant.

[0022] The agarose gel electrophoresis results of male and female *Actinidia cuspidata* plants identified using the SNP molecular marker primers provided above are as follows: Figure 1 As shown, A represents DNA markers ranging from 25 to 500 bp (from top to bottom: 500 bp, 400 bp, 300 bp, 200 bp, 150 bp, 100 bp, 75 bp, 50 bp, and 25 bp), and 1 to 10 represent 10 male and female kiwifruit samples, with ♀ representing female plants and ♂ representing male plants. Figure 1 It can be seen that the male plant showed a 194bp band, while the female plant did not show a 194bp band.

[0023] Further, from the 20 male and female samples, 6 male plants and 6 female plants were randomly selected, and their morphological characteristics were examined. The identification results are shown below. Figure 2 , 3As shown, the marker primer kiwi-F / R provided by this invention can be used to identify the sex characteristics of calyx kiwifruit. It can be used to identify different hybridization combinations of male and female individuals in the early stages of breeding, construct male paternal families, improve grafting vigor, breeding efficiency, and shorten the breeding process, showing potential application in the field of calyx kiwifruit cultivation.

[0024] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A SNP molecular marker primer for identifying female and male plants of Actinidia eriantha, characterized in that, The nucleotide sequence of the marker primer is shown as SEQ ID NO. 1 and 2.

2. The marker primer of claim 1 in the field of kiwifruit cultivation.

3. Use according to claim 2, characterized in that, The application comprises: identification of male and female kiwifruit plants; identification of different male and female individual hybrid combinations in early breeding; construction of male paternal family lines.

4. The method for identifying the SNP molecular marker primer for identifying the male and female plants of Actinidia callosa of claim 1, characterized in that, The method comprises: extracting kiwifruit genomic DNA as a template; performing PCR amplification with an upstream primer shown as SEQ ID NO. 1 and a downstream primer shown as SEQ ID NO. 2, and performing agarose gel electrophoresis detection on the PCR amplification product; determining the gender of the kiwifruit to be identified according to the band type of the agarose gel electrophoresis result: if the result of the agarose gel electrophoresis contains a 194bp band, the kiwifruit to be identified is a male plant; if there is no 194bp band, the kiwifruit to be identified is a female plant.

5. The method of claim 4, wherein, The PCR amplification system comprises: 2x Taq PCR Master Mix, primer kiwi-F, primer kiwi-R, template DNA and ddH2O.

6. The method of claim 4, wherein, The reaction conditions of the PCR amplification are: 95℃ pre-denaturation for 2min; 95℃ denaturation for 30s, 59℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; 72℃ extension for 5min.

7. A kit comprising the SNP molecular marker primer for identifying male and female kiwifruit plants of claim 1.

8. The kit of claim 7 in the field of kiwifruit cultivation.

9. Use according to claim 8, characterized in that, The application comprises: identification of male and female kiwifruit plants; identification of different male and female individual hybrid combinations in early breeding; construction of male paternal family lines.