Novel compound, composition comprising same, and use thereof

Abstract

The present invention provides novel compounds, compositions containing the same, and uses thereof. In particular, the present invention relates to bicyclic compounds and analogs and derivatives thereof, their use for the inhibition of Werner Syndrome RecQ DNAhelicase (WRN) and methods of using these compounds for the treatment of diseases, especially for the treatment of cancer.

Description

TECHNICAL FIELD

[0001] The present invention relates to the field of medicinal chemistry, in particular to provide bicyclic compounds and analogs and derivatives thereof, uses thereof for inhibiting Werner Syndrome RecQ DNA helicase (WRN) and methods of using the compounds to treat diseases, in particular for treating cancer, in particular for treating cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR), including colorectal, gastric and endometrial cancer. The present invention also provides uses of the compounds as research chemicals, intermediate compounds, combinations, methods and formulations.

[0002] Background of the study

[0003] Werner Syndrome RecQ DNA helicase (WRN) is a member of the RecQ DNA helicase subfamily (Croteau et al., 2014). RecQ helicases and WRN are involved in multiple DNA processing steps, including DNA replication, double-strand break repair, transcription and telomere maintenance, and are thus considered as “genome guardians” (Chu and Hickson, 2009). DNA mismatch repair (MMR) deficiency promotes the occurrence of microsatellite instability (MSI), which is characterized by frequent insertion or / and deletion mutations of repetitive nucleotide sequences. MSI-induced genomic instability contributes to the development of multiple cancers, including colorectal, gastric, endometrial and ovarian cancers (Kim et al., 2013; Kunitomi, H et al., 2017). Through large-scale experiments mediated by CRISPR-CAS9, it was found that WRN is selectively essential in microsatellite instability (MSI) models, but not in microsatellite stable models. Knocking out WRN in MSI models induces DNA double-strand breaks and selectively promotes apoptosis and cell cycle arrest (Chan et al., 2019). These findings suggest that WRN is a specific synthetic lethal drug target for MSI-associated cancers. SUMMARY

[0004] There remains a need for new therapeutic methods and therapies to treat cancer, particularly cancers characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR), including colorectal, gastric, or endometrial cancer. The present invention provides compounds, pharmaceutically acceptable salts thereof, pharmaceutical compositions thereof, and combinations thereof, which are inhibitors of Werner Syndrome RecQ DNA helicase (WRN). The present invention further provides methods of treating, preventing, or ameliorating a disease or disorder, comprising administering to a subject in need thereof an effective amount of a WRN inhibitor. The present invention also provides compounds, pharmaceutically acceptable salts thereof, pharmaceutical compositions thereof, and combinations thereof, which are useful for treating cancer, particularly cancers characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR). Compounds that bind to and / or inhibit WRN are also provided, and thus can be used as research chemicals, e.g., as chemical probes, and as tool compounds. Various embodiments of the present invention are described herein.

[0005] The present invention relates to a nitrogen-containing compound, pharmaceutical composition and use thereof, the compound of the present invention has good inhibition effect on WRN, and can be used as a helicase WRN inhibitor to treat cancer.

[0006] In a first aspect, the present invention provides a compound of Formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof,

[0007] stereoisomer, deuterated product, or tautomer:

[0008] wherein

[0009] A is a linker group selected from -C(O)-, -S(O)-, -S(O)2-, and

[0010] Y is N, C, or CH;

[0011] y is 0, 1, 2, 3, or 4;

[0012] Y means that Y is connected to the adjacent carbon atom by a single bond when Y is CH, or Y is connected to the adjacent carbon atom by a double bond when Y is C, and when Y is a single bond, Y is an unsubstituted carbon atom or a substituted carbon atom, the substituent being OH or F;

[0013] when Y is N, Y is a single bond;

[0014] J is N or CH;

[0015] when J is N, and A is a linking group selected from -C(O)-, -S(O)-, -S(O)2-, and when J is CH, and A is a linking group selected from -S(O)-, -S(O)2-, and

[0016] R5is independently selected from:

[0017] • H,

[0018] • -(C1-C4)alkyl,

[0019] • -(C3-C5)cycloalkyl,

[0020] • or two R5substituents can be linked together with the carbon atom to which they are attached to form a (C3-C4)cycloalkyl spiro ring or a 3 or 4 membered heterocyclic spiro ring, wherein the heterocyclic spiro ring contains ring carbon atoms and one ring heteroatom selected from O, N and S,

[0021] • when J is N, one R5substituent forms ring C:

[0022]

[0023] wherein ring C is a fused (C3-C6)cycloalkyl ring, a fused (C3-C6)heterocyclic ring containing ring carbon atoms and one ring heteroatom selected from O, N and S, or a fused phenyl ring,

[0024] • when J is CH, Y is N, is a single bond, and

[0025] A is a linking group selected from -S(O)-, -S(O)2-, and one R5substituent forms ring C:

[0026]

[0027] • when J is N, two R5substituents can be linked to form a (C1-C3)alkylene bridge or a heteroalkylene bridge, wherein the heteroalkylene

[0028] the bond is a heteroatom selected from N and O, or is -CH2-O-CH2-;

[0029] and wherein one or more hydrogen atoms on the ring:

[0030]

[0031] may be replaced with deuterium;

[0032] R1is selected from:

[0033] (C3-C4)cycloalkyl

[0034] (C3-C4)cycloalkyl is unsubstituted or substituted by 1 or 2 R 33 substituents, wherein R 33 is halogen, and wherein said (C3-C4)cycloalkyl or halogen-substituted (C3-C4)cycloalkyl is substituted by 0-2 R 15 substituents,

[0035] (C3-C4)cycloalkyl has 2 substituents on the same ring carbon atom which are joined to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring containing ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted by 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0036] (C3-C4)cycloalkyl is fused with a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5- or 6-membered heterocyclyl ring containing ring carbon atoms and 1-4 ring heteroatoms selected from O, N and S, wherein said cycloalkyl or heterocyclyl is substituted by 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0037] for C4cycloalkyl, which can be bridged by 1 or 2 carbon atoms, and wherein said bridged C4cycloalkyl is substituted by 0, 1 or 2 substituents independently selected from R

[0038] R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0039] or cycloalkenyl

[0040] • A partially unsaturated monocyclic ring containing 5 or 6 carbon atoms, substituted with 0-2 halogens, wherein the cyclic alkenyl group satisfies:

[0041] Contains one =CF2 substituent and 0-2 R groups 15 Substituents.

[0042] It contains one substitution, taken from =CCl2,-S(O)C 1-4 Alkyl, -S(O)2(C 1-4 Alkyl), CN, and containing 0-2 R 15 Substituent, R 15 It cannot be =CCl2,-S(O)C 1-4 alkyl,-S(O)2(C 1-4 alkyl), CN.

[0043] It has two substituents on the same ring carbon atom, which are linked to form a (C3-C6) cycloalkyl spirocycle, or a 3, 4, 5, or 6-membered heterocyclic spirocycle containing a ring carbon atom and one or two cyclic heteroatoms selected from O, N, and S, wherein said cycloalkyl or heterocyclic group is independently selected from R 15 R 16 R 17 R 18 R 19 R 20 R 22 and R 23 Substituents are substituted.

[0044] Fused to a (C3-C6) cycloalkyl ring, or a 3, 4, 5, or 6-membered heterocyclic ring containing a cyclic carbon atom and 1-4 cyclic heteroatoms selected from O, N, and S, wherein said cycloalkyl or heterocyclic group is composed of 0, 1, or 2 independently selected from R 15 R 16 R 17 ,

[0045] R 18 R 19 R 20 R 22 and R 23 Substituent substitution,

[0046] A bridging ring, wherein the bridge comprises one or two carbon atoms, and is independently selected from R by 0, 1, or 2. 15 R 16 R 17 R 18 ,

[0047] R 19 R 20 R 22 R 23 R

[0048] • the partially unsaturated monocyclic ring containing 7 ring carbon atoms is substituted with 0-2 R 15 substituents, which ring alkenyl satisfies:

[0049] contains 0 or 1 =CF2 substituent,

[0050] has 2 substituents on the same ring carbon atom which are joined to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring comprising the ring carbon atom and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 R 16 R 17 R 18 R 19 R 20 R 22 R 23 R

[0051] fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5- or 6-membered heterocyclyl ring comprising the ring carbon atom and 1-4 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 R 16 R 17 R 18 ,

[0052] R 19 R 20 R 22 R 23 R

[0053] or heterocyclyl

[0054] • heterocyclyl is a 4- or 7-membered fully saturated or partially unsaturated group comprising a ring carbon atom and 1 or 2 ring heteroatoms independently selected from N, O and S, wherein said heterocyclyl is unsubstituted or substituted with 1, 2, 3 or 4, preferably 1 or 2 R 33 wherein R 33 is halogen, wherein said heterocyclyl or halogen substituted heterocyclyl satisfies:

[0055] comprises 0-2 R 15substituents and 0 or 1 =CF2 substituents,

[0056] one substituent selected from the group consisting of CN, -S(O)C 1-4 alkyl and -S(O)2C 1-4 alkyl, and 0-2 substituents selected from the group consisting of halo, C 1-4 alkyl, C 1-4 haloalkyl and C 3-4 cycloalkyl,

[0057] two substituents on the same ring carbon atom which are joined together to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0058] fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5- or 6-membered heterocyclyl ring comprising ring carbon atoms and 1-4 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 ,

[0059] R 19 , R 20 , R 22 and R 23 ;

[0060] fused to a phenyl ring, wherein said phenyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0061] • heterocyclyl is a 5 or 6 membered fully saturated or partially unsaturated ring containing ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O and S, wherein said heterocyclyl is unsubstituted or substituted with 1, 2, 3 or 4, preferably 1 or 2, R 33 substituents, wherein R 33 is halogen, wherein said heterocyclyl or halogen substituted heterocyclyl

[0062] contains one =CF2 substituent and 0-2 R 15 substituents,

[0063] contains one substituent selected from =CCl2, CN, -S(O)2C 1-4 alkyl and 0-2 R 15 substituents, R 15 cannot be

[0064] =CCl2, CN, -S(O)2C 1-4 alkyl,

[0065] has 2 substituents on the same ring carbon atom which are joined to form a (C4-C7)cycloalkyl spiro ring, or a 4, 5, 6 or 7 membered heterocyclyl spiro ring containing ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is unsubstituted or substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0066] is fused to a (C4-C6)cycloalkyl ring, or a 4, 5, 6 membered heterocyclyl ring containing ring carbon atoms and 1-3 ring heteroatoms selected from N and S. Or a 5-6 membered heteroaromatic ring contains ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or 1 ring O atom and 1 or 2 ring heteroatoms selected from N and S; and wherein said cycloalkyl, heterocyclyl or heteroaromatic is unsubstituted or substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0067] R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ;

[0068] or heteroaryl,

[0069] wherein said heteroaryl is a 5 or 6 membered fully unsaturated monocyclic radical comprising ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms does not exceed 1 and the total number of ring O atoms does not exceed 1, said heteroaryl being substituted by one or more substituents selected from the group consisting of CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, R 25 (R 24 )N-, C 1-4 alkoxy and comprising 0-2 R 15 substituents, R 15 is not CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, R 25 (R 24 )N-, C 1-4 alkoxy;

[0070] or wherein said heteroaryl is a 5 or 6 membered fully unsaturated monocyclic radical comprising ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms does not exceed 1 and the total number of ring O atoms does not exceed 1 ; said heteroaryl containing 0-2 R 15 substituents and being fused to a 4, 5 or 6 membered heterocyclyl or 5-6 membered heteroaryl, wherein the heterocyclyl ring contains ring carbon atoms and 1-4 ring heteroatoms selected from N, O and S and the heteroaryl ring contains ring carbon atoms and 1, 2, 3 or 4 heteroatoms independently selected from N, O and S, and wherein the heterocyclyl and heteroaryl are substituted by 0, 1, 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ;

[0071] or phenyl,

[0072] wherein the phenyl is unsubstituted or substituted by 1 to 4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, and wherein the benzene or halogen-substituted phenyl contains 1 or 2 substituents selected from the group consisting of CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, -S(O)C 1-4 haloalkyl, -S(O)2C 1-4 haloalkyl, -S(O)C 3-6 cycloalkyl, -PO(C 1-4 alkyl)2,

[0073] or wherein the phenyl is unsubstituted or substituted by 1 to 4 R 15 substituents, and is fused to a 4-, 5- or 6-membered monocyclic or 6-, 7-, 8-, 9- or 10-membered bicyclic ring, wherein the 4-, 5-, 6-membered monocyclic or 6-, 8-, 8- or 10-membered bicyclic ring contains ring carbon atoms and 0-3 ring heteroatoms selected from N, O and S, and is substituted by 0, 1 or 2 substituents independently selected from the group consisting of R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ; wherein the 4-, 5- or 6-membered ring or 6-, 7-, 8-, 9- or 10-membered bicyclic ring is a saturated, partially saturated or unsaturated heterocyclic ring

[0074] or carbocyclic,

[0075] each R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 is independently selected from the group consisting of:

[0076] • halogen,

[0077] • CN,

[0078] • -S(O)2C 1-4 alkyl, unsubstituted or substituted by 1 to 3 halogen,

[0079] • -PO(C 1-4 alkyl)2,

[0080] • (C1-C4)alkyl-O-, unsubstituted or substituted by 1 to 3 halogen,

[0081] • (C1-C4)alkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogen,

[0082] • (C3-C4)cycloalkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogen,

[0083] • HOC(O)-(CH2) n

[0084] • H3C-C(O)(CH2) n

[0085] • (C1-C4)alkyl-O-C(O)(CH2) n

[0086] • =O,

[0087] • azetidinyl or pyrrolidinyl, wherein the azetidinyl and pyrrolidinyl are attached via the N atom to the rest of the molecule,

[0088] and each is unsubstituted or substituted with 1 or 2 fluorine,

[0089] • R 25 (R 24 )N-, wherein R 24 is hydrogen or (C1-C4)alkyl unsubstituted or substituted with 1, 2 or 3 halogen, R 25 is hydrogen or (C1-C4)alkyl unsubstituted or substituted with 1-3 halogen,

[0090] • =CF2,

[0091] • =CCl2,

[0092] • -S(O)C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen,

[0093] • -S(O)C 3-6 cycloalkyl,

[0094] • -S(O)2C 3-6 cycloalkyl,

[0095] wherein n is 0, 1, 2,

[0096] R 26 is CH3, H, halogen or deuterium;

[0097] R 27 is CH3, H, halogen or deuterium;

[0098] or R​​​26 and R 27 together with the carbon atom to which they are attached form a cyclopropyl ring;

[0099] R2is selected from the group consisting of:

[0100]

[0101] R6is selected from the group consisting of:

[0102] • H,

[0103] • halogen,

[0104] • (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens,

[0105] • (C3-C5)cycloalkyl, unsubstituted or substituted with 1-3 halogens,

[0106] • -0-(Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens,

[0107] • OH,

[0108] • CN;

[0109] R8is selected from the group consisting of H, halogen, (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens;

[0110] R9is selected from the group consisting of H, 0-CH3, OH, CN, CH3, halogen;

[0111] R 28 is selected from the group consisting of:

[0112] • SF 5，

[0113] • deuterium,

[0114] • H,

[0115] • -C(O)H,

[0116] • halogen,

[0117] • (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens or deuterium,

[0118] • (C2-C4)alkenyl,

[0119] • (C2-C4)alkynyl,

[0120] • (C3-C5)cycloalkyl, unsubstituted or substituted with 1-3 halogens or deuterium,

[0121] • OCF3;

[0122] X is selected from C-R7and N, wherein R7is hydrogen or halogen, or R7may be taken together with R 28 or R6and the atoms to which they are attached join to form a fused (C4-C6)cycloalkyl ring, wherein the fused (C4-C6)cycloalkyl ring is unsubstituted or substituted with 1-3 halogen,

[0123] or

[0124] R2is selected from:

[0125]

[0126] wherein

[0127] R 31 is selected from H, halogen, CH3,

[0128] R 32 is selected from H, halogen, CH3,

[0129] R3is selected from:

[0130] • O-CH3,

[0131] • N(CH3)2,

[0132] • S-CH3,

[0133] • (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogen or hydroxyl;

[0134] R4is taken from:

[0135]

[0136] wherein

[0137] R 10 , R 11 , R 12 , R 13 , R 14 are each taken from:

[0138] • H,

[0139] • deuterium,

[0140] • halogen,

[0141] • (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogen or deuterium

[0142] • (Ci-C2)alkyl, substituted with -0-(Ci-C2)alkyl or OH,

[0143] • -S-(Ci-C3)alkyl,

[0144] • -O-(Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogen or deuterium,

[0145] • OH,

[0146] • (C3-C5)cycloalkyl, wherein (C3-C5)cycloalkyl is unsubstituted or substituted with 1-2 halogen or deuterium,

[0147] • -O-(C3-C5)cycloalkyl,

[0148] • -NR 34 R 35 , wherein R 34 , R 35 are each taken from the group consisting of:

[0149] H,

[0150] deuterium,

[0151] (Ci-C4)alkyl, unsubstituted or substituted with hydroxyl or -O(Ci-C2)alkyl,

[0152] or R 34 and R 35 may be linked together with the atoms to which they are attached to form an azetidinyl, pyrrolidinyl or piperidinyl ring, wherein the azetidinyl, pyrrolidinyl and piperidinyl are unsubstituted or substituted with methyl;

[0153] • CN,

[0154] • -(C2-C4)alkenyl,

[0155] • -(C2-C4)alkynyl,

[0156] • -C(O)H,

[0157] • -C(O)(Ci-C4)alkyl;

[0158] and

[0159] * indicates the point of attachment.

[0160] In another preferred embodiment, R1is selected from

[0161]

[0162] wherein ring E is (C3-C4)cycloalkyl, comprising 0-2 R 15 substituents;

[0163] or E is substituted 5-6-membered cycloalkenyl or substituted 5-6-membered heterocyclyl =CF2, CN, -S(O)2C 1-4 alkyl, =CCl2, and 0-2 R 15 substituents, R 15 cannot be =CF2, CN, -S(O)2C 1-4 alkyl or =CCl2;

[0164] or E is phenyl having 1 or 2 substituents attached thereto selected from the group consisting of CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, -S(O)C 3-6 cycloalkyl, -S(O)C 1-4 haloalkane, -S(O)2C 1-4 haloalkane, -PO(C 1-4 alkane)2, and 0-2 R 15 substituents, R 15 cannot be CN, -S(O)2C 1-4 alkane, -S(O)C 1-4 alkane, -S(O)C 3-6 cycloalkane, -S(O)C 1-4 haloalkane, -S(O)2C 1-4 haloalkane or -PO(C 1-4 alkane)2;

[0165] or E is 5-6-membered heteroaryl having 1 or 2 substituents attached thereto selected from the group consisting of CN, R 25 (R 24 )N-, -OC 1-4 alkane, 0-2 R 15 substituents, R 15 cannot be CN, R 25 (R 24 )N-, -OC 1-4 alkyl;

[0166] ring E' is independently selected from the group consisting of partially unsaturated monocyclic C5-C7 cycloalkenyl;

[0167] ring E1' is independently selected from the group consisting of partially unsaturated monocyclic C7 cycloalkenyl;

[0168] ring E" is independently selected from the group consisting of 4- or 7-membered fully saturated or partially unsaturated heterocyclyl comprising ring carbon atoms and 1 or 2 ring heteroatoms independently selected from the group consisting of N, O, and S;

[0169] ring E'" is independently selected from the group consisting of 5- or 6-membered fully saturated or partially unsaturated heterocyclyl;

[0170] Ring E"" is independently selected from a 5-6 membered heteroaryl comprising ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms does not exceed 1 and the total number of ring O atoms does not exceed 1 ;

[0171] Ring E""' is independently selected from a phenyl ring;

[0172] Ring F is independently selected from (C3-C6)cycloalkyl, or a 3, 4, 5 or 6 membered heterocyclyl ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S;

[0173] Ring F' is independently selected from (C4-C5)cycloalkyl, or a 4, 5, 6 or 7 membered heterocyclyl ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S;

[0174] Ring G is independently selected from (C3-C6)cycloalkyl, or a 3, 4, 5 or 6 membered heterocyclyl ring comprising ring carbon atoms and 1 to 4 ring heteroatoms selected from O, N and S;

[0175] Ring G' is independently selected from (C4-C6)cycloalkyl, or a 4, 5 or 6 membered heterocyclyl ring comprising ring carbon atoms and 1 to 3 ring heteroatoms selected from N and S, or a 5-6 membered heteroaryl comprising ring carbon atoms and 1 to 3 ring heteroatoms selected from N and S, or 1 ring O atom and 1 or 2 ring heteroatoms selected from N and S;

[0176] Ring G" is independently selected from a 4, 5 or 6 membered heterocyclyl ring or a 5-6 membered heteroaryl, wherein the heterocyclyl ring contains ring carbon atoms and 1 to 4 ring heteroatoms selected from N, O and S, and the heteroaryl ring contains ring carbon atoms and 1, 2, 3 or 4 heteroatoms independently selected from N, O and S;

[0177] Ring G'" is independently selected from a 4, 5 or 6 membered ring comprising ring carbon atoms and 0 to 3 ring heteroatoms selected from N, O and S; preferably G'" is independently selected from (C4-C6)cycloalkyl, a 4, 5 or 6 membered heterocyclyl ring comprising ring carbon atoms and 1 to 3 ring heteroatoms selected from N and S, or 1 ring O atom and 1 or 2 ring heteroatoms selected from N and S, or a 5-6 membered heteroaryl comprising ring carbon atoms and 1 to 3 ring atoms selected from N or S;

[0178] R 33 is halogen;

[0179] R 15 and R 16 are independently selected from

[0180] • halogen,

[0181] • CN,

[0182] • -S(O)2C1-4 alkyl, unsubstituted or substituted by 1-3 halogen,

[0183] • -PO(C 1-4 alkyl)2,

[0184] • (C1-C4)alkyl-O-, unsubstituted or substituted by 1-3 halogen,

[0185] • (C1-C4)alkyl unsubstituted or substituted by deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogen,

[0186] • HOC(O)-(CH2) n -,

[0187] • H3C-C(O)(CH2) n -,

[0188] • (C1-C4)alkyl-O-C(O)(CH2) n ,

[0189] • =O,

[0190] • azetidinyl or pyrrolidinyl, wherein the azetidinyl and pyrrolidinyl are attached via the N atom to the rest of the molecule and are each unsubstituted or substituted by 1 or 2 F,

[0191] • R 25 (R 24 )N-, wherein R 24 is hydrogen or (C1-C4)alkyl unsubstituted or substituted by 1-3 halogen, R 25 is hydrogen or (C1-C4)alkyl unsubstituted or substituted by 1-3 halogen,

[0192] • =CF2,

[0193] • =CCl2,

[0194] • -S(O)C 1-4 alkyl, unsubstituted or substituted by 1-3 halogen,

[0195] • -S(O)C 3-6 cycloalkyl,

[0196] • -S(O)2C 3-6 cycloalkyl,

[0197] • wherein n is 0, 1, 2,

[0198] f1 is 0, 1, 2,

[0199] f2 is 0, 1, 2,

[0200] f3 is 0, 1, 2.

[0201] In another preferred embodiment, R1 is:

[0202] cycloalkenyl

[0203] • a partially unsaturated monocyclic ring containing 5 or 6 ring carbon atoms, containing 0, 1 or 2 R 33 substituents, wherein R 33 is halogen:

[0204] containing one =CF2 substituent and 0-2 R 15 substituents,

[0205] containing one substituent taken from =CCl2, -S(O)C 1-4 alkyl, -S(O)2(C 1-4 alkyl), CN, and containing 0-2 R 15 substituents, R 15 cannot be =CCl2, -S(O)C 1-4 alkyl, -S(O)2(C 1-4 alkyl), or CN,

[0206] having 2 substituents on the same ring carbon atom which are joined to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring containing a ring carbon atom and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0207] fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5- or 6-membered heterocyclyl ring containing a ring carbon atom and 1-4 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0208] bridged ring, and the bridge contains 1 or 2 carbon atoms, and is substituted with 0-2 substituents independently selected from R 15 16 17 18 19 20 22 23

[0209] • the partially unsaturated monocyclic ring containing 7 ring carbon atoms is substituted with 0-2 R 15 substituents;

[0210] contains 0 or 1 =CF2 substituent,

[0211] has 2 substituents on the same ring carbon atom which are joined to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl spiro ring containing ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is unsubstituted or substituted with 0, 1, or 2 substituents independently selected from R 15 16 17 18 19 20 22 23

[0212] fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl ring containing ring carbon atoms and 1-4 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is unsubstituted or substituted with 0, 1, or 2 substituents independently selected from R 15 16 17 18 19 20 22 23

[0213] or heterocyclyl

[0214] • heterocyclyl is a 4- or 7-membered fully saturated or partially unsaturated moiety containing ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O, and S, wherein said heterocyclyl is unsubstituted or substituted with 1-4, preferably 1-2, R 33 substituents, wherein R 33 is halogen, wherein said heterocyclyl or halogen-substituted heterocyclyl

[0215] ​​​​​​​​​​​​​​​​​​​​​​​​ 0-2 R 15 substituents and 0 or 1 =CF2 substituents,

[0216] one substituent selected from the group consisting of CN, -S(O)C 1-4 alkyl and -S(O)2C 1-4 alkyl, and 0-2 substituents selected from the group consisting of halo, C 1-4 alkyl, C 1-4 haloalkyl and C 3-4 cycloalkyl,

[0217] two substituents on the same ring carbon atom which are joined to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0218] fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5- or 6-membered heterocyclyl ring comprising ring carbon atoms and 1-4 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 ,

[0219] R 19 , R 20 , R 22 and R 23 ;

[0220] fused to a phenyl ring, wherein said phenyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0221] • heterocyclyl is a 5 or 6 membered fully saturated or partially unsaturated ring containing ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O and S, wherein said heterocyclyl is unsubstituted or substituted with 1 to 4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, wherein said heterocyclyl or halogen substituted heterocyclyl

[0222] contains one =CF2 substituent and 0-2 R 15 substituents,

[0223] contains one substituent selected from =CCl2, CN, -S(O)2C 1-4 alkyl and 0-2 R 15 substituents, substituents R 15 cannot be =CCl2, CN, -S(O)2C 1-4 alkyl,

[0224] have 2 substituents on the same ring carbon atom which are joined to form a (C4-C7)cycloalkyl spiro ring, or a 4, 5, 6 or 7 membered heterocyclyl spiro ring containing ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is unsubstituted or substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0225] are fused to a (C4-C6)cycloalkyl ring, or a 4, 5, 6 membered heterocyclyl ring containing ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or a 5-6 membered heteroaromatic ring containing ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or 1 ring O atom and

[0226] 1-2 ring heteroatoms selected from N and S; and wherein said cycloalkyl, heterocyclyl or heteroaromatic is unsubstituted or substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0227] fused with a phenyl group, wherein said phenyl group is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0228] or heteroaryl,

[0229] wherein said heteroaryl is a 5- or 6-membered fully unsaturated monocyclic group comprising ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms does not exceed 1 and the total number of ring O atoms does not exceed 1, said heteroaryl being substituted with one or more substituents selected from CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, R 25 (R 24 )N-, C 1-4 alkoxy and comprising 0-2 R 15 substituents, the substituents R 15 are not CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, R 25 (R 24 )N-, C 1-4 alkoxy;

[0230] or wherein said heteroaryl is a 5- or 6-membered fully unsaturated monocyclic group comprising ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms does not exceed 1 and the total number of ring O atoms does not exceed 1 ; said heteroaryl comprising 0-2 R 15 substituents and being fused with a 4-, 5- or 6-membered heterocyclyl group or a 5-6 membered heteroaryl group, wherein the heterocyclyl ring comprises ring carbon atoms and 1-4 ring heteroatoms selected from N, O and S, the heteroaryl ring comprises ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, and wherein the heterocyclyl and heteroaryl groups are substituted with 0, 1, 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ;

[0231] or phenyl,

[0232] wherein the phenyl is unsubstituted or substituted by 1 to 4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, and wherein the phenyl or halogen-substituted phenyl contains 1 or 2 substituents selected from the group consisting of CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, -S(O)C 1-4 haloalkyl, -S(O)2C 1-4 haloalkyl, -S(O)C 3-6 cycloalkyl, -PO(C 1-4 alkyl)2,

[0233] or wherein the phenyl is unsubstituted or substituted by 1 to 4 R 15 substituents, and is fused to a 4-, 5-, or 6-membered monocyclic or 6-, 7-, 8-, 9-, or 10-membered bicyclic ring, wherein the 4-, 5-, 6-membered monocyclic or 6-, 8-, 8-, or 10-membered bicyclic ring contains ring carbon atoms and 0-3 ring heteroatoms selected from N, O, and S, and is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; wherein the 4-, 5-, or 6-membered ring or 6-, 7-, 8-, 9-, or 10-membered bicyclic ring is a saturated, partially saturated, or unsaturated heterocycle or

[0234] carbocycle,

[0235] each R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 is independently selected from the group consisting of:

[0236] • halogen,

[0237] • CN,

[0238] • -S(O)2C 1-4 alkyl, unsubstituted or substituted with 1-3 halogens,

[0239] • -PO(C 1-4 alkyl)2,

[0240] • (C1-C4)alkyl-O-, unsubstituted or substituted with 1-3 halogens,

[0241] • (C1-C4)alkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogen,

[0242] • (C3-C4)cycloalkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogen,

[0243] • HOC(O)-(CH2) n

[0244] • H3C-C(O)(CH2) n

[0245] • (C1-C4)alkyl-O-C(O)(CH2) n

[0246] • =O,

[0247] • azetidinyl or pyrrolidinyl, wherein the azetidinyl and pyrrolidinyl are attached via a nitrogen atom to the rest of the molecule and are each unsubstituted or substituted with 1 or 2 fluorine,

[0248] • R 25 (R 24 )N-, wherein R 24 is hydrogen or (C1-C4)alkyl unsubstituted or substituted with 1-3 halogen, R 25 is hydrogen or (C1-C4)alkyl unsubstituted or substituted with 1-3 halogen,

[0249] • =CF2,

[0250] • =CCl2,

[0251] • -S(O)C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen,

[0252] • -S(O)C 3-6 cycloalkyl,

[0253] • -S(O)2C 3-6 cycloalkyl,

[0254] wherein n is 0, 1, 2,

[0255] In another preferred embodiment, R2is selected from:

[0256]

[0257] X is selected from: N, CH;

[0258] R6is selected from: ​​​

[0259] • H,

[0260] • halogen,

[0261] • (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens,

[0262] • (C3-C5)cycloalkyl, unsubstituted or substituted with 1-3 halogens,

[0263] • -O-(Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens,

[0264] • OH,

[0265] • CN;

[0266] R8is selected from H, halogen, (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens;

[0267] R9is selected from H, O-CH3, OH, CN, CH3, halogen;

[0268] R 28 is selected from:

[0269] • SF5,

[0270] • deuterium,

[0271] • H,

[0272] • -C(O)H,

[0273] • halogen,

[0274] • (Ci-C4)alkyl, unsubstituted or substituted with 1-3 halogens or deuterium,

[0275] • (C2-C4)alkenyl,

[0276] • (C2-C4)alkynyl,

[0277] • (C3-C5)cycloalkyl, unsubstituted or substituted with 1-3 halogens or deuterium,

[0278] • OCF3.

[0279] In another preferred embodiment, A is -C(O)-.

[0280] In another preferred embodiment, is

[0281] In another preferred embodiment, R 33 is F.

[0282] In another preferred embodiment, the compound has the structure (II) below

[0283]

[0284] wherein R1, R2, R3, R4, R 5， y is as defined above.

[0285] In another preferred embodiment, R4 is Preferably, R4 is

[0286] In another preferred embodiment, R2 is

[0287] In another preferred embodiment, R2 is

[0288] In another preferred embodiment, the compound has the structure (III) below

[0289]

[0290] wherein

[0291] M is N or CH;

[0292] Rf is selected from the group consisting of H, halogen, C 1-6 alkyl, halogenated C 1-6 alkyl; preferably Rf is halogen;

[0293] Rg is selected from the group consisting of H, halogen, C 1-6 alkyl, halogenated C 1-6 alkyl;

[0294] R1, R3, R 5， y is as defined above.

[0295] In another preferred embodiment, R3 is methyl, ethyl or propyl.

[0296] In another preferred embodiment, when M is N, the compound has the structure (III-A) below:

[0297]

[0298] wherein Rf, Rg, R1, R3, R 5， y is as defined above.

[0299] In another preferred embodiment, when M is CH, the compound has the structure (III-B) below:

[0300]

[0301] wherein Rf, Rg, R1, R3, R 5， y is as defined above.

[0302] In another preferred embodiment, Rf is selected from Cl, F.

[0303] In another preferred embodiment, Rg is selected from H, CH3, Cl, F, CHF2, CF3.

[0304] In another preferred embodiment, is selected from:

[0305] In another preferred embodiment R1 is independently selected from: wherein n1 and n2 are selected from 1, 2, or 3;

[0306] n3 is independently selected from 0, 1, 2;

[0307] R 15 is as defined above.

[0308] In another preferred embodiment, R1 is independently selected from oxepinyl, wherein said oxepinyl is unsubstituted or substituted with 1-4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen;

[0309] contains 0-2 R 15 substituents and 0 or 1 =CF2 substituents,

[0310] on the same ring carbon atom, which are joined to form a (C3-C6)cycloalkyl spiro ring, or a 3, 4, 5, 6 membered heterocyclyl spiro ring containing a ring carbon atom and one ring heteroatom selected from O, N and S. Wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ,

[0311] fused to a (C3-C6)cycloalkyl ring, or a 3, 4, 5, 6 membered heterocyclyl ring containing a ring carbon atom and one ring heteroatom selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16R 17 R 18 R 19 R 20 ,

[0312] R 22 and R 23 substituted.

[0313] In another preferred embodiment, R1is independently selected from:

[0314]

[0315]

[0316] In another preferred embodiment, R1is independently selected from:

[0317]

[0318] In another preferred embodiment, the compound is selected from:

[0319]

[0320]

[0321]

[0322]

[0323]

[0324]

[0325] In another preferred embodiment, the heterocyclyl and carbocyclyl groups can be saturated or partially unsaturated, or unsaturated, substituted or unsubstituted, aromatic or non-aromatic.

[0326] In some preferred embodiments, the heterocyclyl and carbocyclyl groups can be connected in a fused, bridged, or spirocyclic manner.

[0327] In another preferred embodiment, each group is the corresponding group in a particular compound of the Examples.

[0328] In another preferred embodiment, the compound is a compound prepared in Examples 1-328.

[0329] In another preferred embodiment, the compound is compound 1, 7, 45, 46, 51, 52, 77, 78, 127, 131, 200, 201, 202, 224, 232, 238, 245, 246, 250, 254, 256, 257, 259, 260, 264, 265, 270, 272, 273, 274, 276, 277, 278, 279a, 279b, 281, 282a, 282b, 283, 284, 285, 286a, 286b, 287a, 287b, 302, 304, 308, 311, 314, 316, 317, 325, 326, 327, 328 of the Examples.

[0330] In a second aspect, the present application relates to a pharmaceutical composition comprising a compound or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof of the first aspect of the present application and one or more pharmaceutically acceptable carriers or excipients.

[0331] In some embodiments, the pharmaceutical composition can be used to prepare a single unit dosage form. In some embodiments, the single agent single unit dosage forms provided herein are suitable for oral, mucosal, parenteral, topical, transdermal, or transcutaneous administration to a patient. Examples of dosage forms include, but are not limited to, tablets; dragees; capsules, such as soft elastic gelatin capsules; cachets; troches; lozenges; dispersions; suppositories; powders; aerosols; gels; liquid dosage forms suitable for oral or mucosal administration to a patient, including suspensions, solutions, and elixirs; liquid dosage forms suitable for parenteral administration to a patient; eye drops or other ophthalmic preparations suitable for topical administration; and reconstitutable sterile solids to provide liquid dosage forms suitable for parenteral administration to a patient. In some embodiments, the dosage form comprises an amount of a compound provided herein, or an enantiomer, stereoisomer, solvate, or pharmaceutically acceptable salt thereof, of from 1-1000 mg, from about 5-500 mg, from about 10-350 mg, or from about 50-200 mg. The specific amount of a compound provided herein, or an enantiomer, stereoisomer, solvate, or pharmaceutically acceptable salt thereof, will depend on the particular agent used, the disease or condition being treated or prevented.

[0332] The compounds of the present application of Formula (I) in free form or in pharmaceutically acceptable salt form exhibit valuable pharmacological properties, for example WRN inhibitory properties, as shown, for example, in the in vitro and in vivo tests provided in the next section, and are therefore suitable for use in therapy, or as research chemicals, for example as chemical probes, and as tool compounds.

[0333] In some embodiments, the pharmaceutical composition comprises a compound provided herein, or an enantiomer, stereoisomer, solvate, deuterated product, or a pharmaceutically acceptable salt thereof, and a second active agent optionally used in the treatment of cancer, in particular in the treatment of a cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR), including colorectal cancer, gastric cancer, and endometrial cancer.

[0334] In a third aspect, the present application relates to a method:

[0335] • modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof,

[0336] • inhibiting WRN in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof,

[0337] • treating a disorder or disease in a subject that can be treated by WRN inhibition, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof,

[0338] • treating a cancer in a subject, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof,

[0339] • treating a cancer in a subject, comprising administering a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein the cancer is characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR). In particular, the cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR) is selected from colorectal cancer, gastric cancer, prostate cancer, endometrial cancer, adrenocortical carcinoma, uterine cancer, cervical cancer, esophageal cancer, breast cancer, kidney cancer, and ovarian cancer. More particularly, the cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR) is selected from colorectal cancer, gastric cancer, prostate cancer, and endometrial cancer. Examples include uterine corpus endometrial carcinoma, colon adenocarcinoma, gastric adenocarcinoma, rectal adenocarcinoma, adrenocortical carcinoma, uterine carcinosarcoma, cervical squamous cell carcinoma, cervical adenocarcinoma, esophageal cancer, breast cancer, kidney clear cell carcinoma, prostate cancer, and ovarian serous cystadenocarcinoma.

[0340] In a fourth aspect, there is also provided a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof, for use as a medicament; in particular, the use is:

[0341] • for use in the treatment of a disease that is treated by WRN inhibition,

[0342] • for use in the treatment of a cancer,

[0343] • for use in the treatment of a cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR),

[0344] • for use in the treatment of a cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR), such as colorectal cancer, gastric cancer, prostate cancer, endometrial cancer, adrenocortical carcinoma, uterine cancer, cervical cancer, esophageal cancer, breast cancer, kidney cancer and ovarian cancer,

[0345] • for use in the treatment of a cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR) selected from colorectal cancer, gastric cancer, prostate cancer and endometrial cancer, or

[0346] • for use in the treatment of a cancer, wherein the cancer characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR) is selected from uterine corpus endometrial carcinoma, colon adenocarcinoma, gastric adenocarcinoma, rectal adenocarcinoma, adrenocortical carcinoma, uterine carcinosarcoma, cervical squamous cell carcinoma, cervical adenocarcinoma, esophageal carcinoma, breast carcinoma, kidney renal clear cell carcinoma, prostate adenocarcinoma and ovarian serous cystadenocarcinoma.

[0347] In a fifth aspect, there is also provided a use of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof:

[0348] • for use in therapy,

[0349] • for use in the manufacture of a medicament,

[0350] • for use in the manufacture of a medicament for the treatment of a cancer; in particular the cancer is characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR),

[0351] • for use in the manufacture of a medicament for the treatment of a disease that can be treated by WRN inhibition,

[0352] wherein in particular the cancer is characterized by microsatellite instability-high (MSI-H) or mismatch repair deficiency (dMMR), such as colorectal cancer, gastric cancer, prostate cancer, endometrial cancer, adrenocortical carcinoma, uterine cancer, cervical cancer, esophageal cancer, breast cancer, kidney cancer and ovarian cancer, in particular colorectal cancer, intestinal cancer, prostate cancer or endometrial cancer, or uterine corpus endometrial carcinoma, colon adenocarcinoma, gastric adenocarcinoma, rectal adenocarcinoma, adrenocortical carcinoma, uterine carcinosarcoma, cervical squamous cell carcinoma, cervical endocervical adenocarcinoma, esophageal carcinoma, breast carcinoma, kidney renal clear cell carcinoma and ovarian serous cystadenocarcinoma

[0353] In some embodiments, the subject has or is identified as having a microsatellite instability (MSI-H) cancer, e.g., relative to a control, e.g., a reference normal subject. In one embodiment, the subject has an MSI-H advanced solid tumor, cancer (CRC), endometrial, uterine, gastric or other MSI-H cancer. In some embodiments, the subject has a colorectal cancer (CRC), endometrial cancer or gastric cancer cancer that has or is identified as having microsatellite instability (MSI-H), e.g., relative to a control, e.g., a reference normal subject. Such identification techniques are known in the art.

[0354] In another aspect, the present application provides a combination, in particular a pharmaceutical combination, comprising a compound of the present application or a pharmaceutically acceptable salt, hydrate, solvate, deuterated product, prodrug, stereoisomer or tautomer thereof and one or more therapeutically active substances.

[0355] In another aspect, the present application provides a compound of the first aspect of the present application or a pharmaceutically acceptable salt, hydrate, solvate, deuterated product, prodrug, stereoisomer or tautomer thereof for use as a research chemical, e.g., as a chemical probe or tool compound.

[0356] In another aspect, the present application provides a solid form, method or intermediate as described herein.

[0357] Detailed description of the application

[0358] After long and intensive research, the inventors have surprisingly prepared a new class of compounds which can be used as WRN inhibitors for the treatment of cancer. On this basis, the inventors have completed the present application.

[0359] Terms

[0360] In the present application, the terms used have the general meaning known to a person skilled in the art, unless otherwise specified.

[0361] The term "alkyl" as used herein refers to a branched or straight-chain saturated aliphatic hydrocarbon group. In one embodiment, an alkyl group contains from 1 to about 12 (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms, more generally 1 to about 6 carbon atoms ((C1-C6) alkyl) or 1 to about 4 carbon atoms (C1-C4) alkyl). The specified ranges as used herein indicate alkyl groups having each member of the range as an independent species. For example, the term (C1-C4) alkyl as used herein indicates straight-chain or branched-chain alkyl groups having 1, 2, 3, or 4 carbon atoms, and is intended to indicate each of these groups as a separate species. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, sec-butyl, t-butyl. In one embodiment, an alkyl group is optionally substituted as described herein.

[0362] The term "alkenyl" as used herein refers to a branched or straight-chain aliphatic hydrocarbon group having one or more carbon-carbon double bonds, which can occur at any stable point along the chain. Non-limiting examples are (C2-C4) alkenyl (e.g., C2, C3, C4). The specified ranges as used herein indicate alkenyl groups having each member of the range as an independent species, as for alkyl moieties described herein. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, and butadienyl (including 1,2-butadienyl and 1,3-butadienyl). In one embodiment, an alkenyl group is optionally substituted as described herein.

[0363] The term "alkynyl" as used herein refers to a branched or straight-chain aliphatic hydrocarbon group having one or more carbon-carbon triple bonds, which can occur at any stable point along the chain, e.g., (C2-C4) alkynyl (e.g., C2, C3, C4). The specified ranges as used herein indicate alkynyl groups having each member of the range as a non-independent species, as described herein for alkyl moieties. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, 1-butynyl, 2-butynyl, and 3-butynyl. In one embodiment, an alkynyl group is optionally substituted as described herein.

[0364] The term "cycloalkyl" as used herein refers to a saturated cyclic alkyl group having a single ring or multiple rings, including fused, bridged, and spiro ring systems. As used herein, C 3-8 Cycloalkyl groups have from 3 to 8 ring carbon atoms (e.g., 3, 4, 5, 6, 7, or 8 ring atoms). Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl.

[0365] The term "cycloalkenyl" as used herein refers to a partially unsaturated monocyclic alkyl group having a single ring or multiple rings, including fused, bridged, and spiro ring systems, e.g., 5 or 6 ring carbon atoms. Examples of cycloalkenyl groups include, but are not limited to, cyclopentenyl and cyclohexenyl.

[0366] As used herein, the term "haloalkyl" refers to branched and straight chain alkyl groups substituted with one or more halogen atoms, up to the maximum number of permitted halogen atoms. Examples of haloalkyl include, but are not limited to, trifluoromethyl, monofluoromethyl, difluoromethyl, 2-fluoroethyl, and pentafluoroethyl.

[0367] As used herein, the term "halogen" or "halo" independently refers to any one of fluorine, chlorine, bromine, and iodine.

[0368] As used herein, the term "heterocyclyl" refers to a saturated or partially unsaturated (i.e., having one or more double and / or triple bonds within the ring, without aromaticity) monocyclic or bicyclic radical of 4, 5, 6, 7, 8, 9, or 10 ring atoms, wherein at least one ring atom is a heteroatom selected from nitrogen, oxygen, and sulfur, the remainder of the ring atoms being C, wherein one or more ring atoms are optionally independently substituted with one or more of the above recited substituents. In one embodiment, the only heteroatom is oxygen. The heterocyclyl can be a monocyclic ring having 4 to 7 ring members (2 to 6 carbon atoms and 1 to 4 heteroatoms selected from N, O, and S) or a bicycle having 6 to 10 ring members (4 to 9 carbon atoms, 1 to 6 selected from N, O, and S), for example: bicyclo[4,5], [5,5], [5], 6], or [6,6] systems. In one embodiment, the only heteroatom is sulfur. Examples of heterocycles include, but are not limited to, pyrrolidinyl, dihydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, dihydropyranyl, and tetrahydrothiopyranyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thienyl, homopiperidinyl, oxolanyl, thienoyl, oxazolyl, diazolyl, thiazolyl, diazolyl, 2-pyrrolinyl, 3-pyrrolinyl, and indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1,3-dioxolanyl, pyrazolinyl, dithienyl, dihydrofuranyl, dihydroxyisoquinolinyl, tetrahydroisoquinolinyl, pyrazolidinyl imidazolinyl, 2-oxa-5-azabicyclo[2.2.2]octane, 3-oxa-8-azabicyclo[3.2.1]octane, 8-oxa-3-azabicyclo[3.2.1]octane, 6-oxa-3-oxabicyclo[3.1.1]heptane, 2-oxa-5-azabicyclo[2.2.1]heptane, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, azabicyclo[2.2.2]hexyl, 3H-indolyl, quinolizinyl, N-pyridinylurea, and pyrrolopyrimidine. Spirocyclic moieties are also included within the scope of this definition. Examples of heterocyclyl groups in which 1 or 2 ring carbon atoms are substituted with an oxo (=0) moiety are pyrimidinyl and 1,1-dioxothiomorpholinyl. The heterocyclyl groups herein are optionally independently substituted with one or more substituents described herein.

[0369] The term "substituted" as used herein means that any one or more hydrogens on the designated atom or group is replaced with a selection from the indicated group, provided that the designated atom's normal valency is not exceeded.

[0370] Unless otherwise indicated, it is assumed that any heteroatom of low valency has sufficient hydrogen atoms to complete its valency.

[0371] Active ingredient

[0372] As used herein, "compound of the present invention" means a compound represented by Formula (I), and also includes pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers thereof.

[0373] Accordingly, the present invention provides a compound of Formula (I):

[0374]

[0375] The term "compound of the present invention" or "compound of the invention" or is "compound of Formula (I)" means one or more compounds of Formula (I), subformulae thereof, example compounds, and salts thereof, as well as all zwitterions, stereoisomers (including diastereomers and enantiomers), rotamers, tautomers, and isotopically labeled compounds (including deuterium substitutions), and inherently formed moieties, as well as combinations or mixtures of the foregoing aspects, unless otherwise specified.

[0376] Various (enumerated) embodiments of the present invention are described herein. It will be recognized that features specified in each embodiment can be combined with other specified features to provide other embodiments of the present invention.

[0377] Embodiment 1. A compound of Formula (I) as described above, or a pharmaceutically acceptable salt thereof.

[0378] Embodiment 2: A compound of Formula (I) according to Embodiment 1, or a pharmaceutically acceptable salt thereof, wherein when R1is a ring:

[0379] • each R1ring atom adjacent to the R1ring atom to which the R1ring is attached to the remainder of the molecule is independently unsubstituted or substituted only with halogen, in particular is independently unsubstituted or substituted with one fluoro substituent, and

[0380] • R1is a 3-, 4-, 5-, 6-, or 7-membered ring, the R1ring is attached to the remainder of the molecule through an R1ring nitrogen atom, or through an R1ring carbon atom to an adjacent ring atom. Optionally, the R1ring carbon atom has one double bond.

[0381] It will be appreciated that the compounds of the present invention are not limited to the compounds listed above.

[0382] Salts that can form the compounds of this invention are also within the scope of this invention. Unless otherwise stated, compounds in this invention should be understood to include their salts. The term "salt" as used herein refers to a salt formed by an inorganic or organic acid and a base in the form of an acid or base. Furthermore, this includes salts when the compounds of this invention contain a base fragment including, but not limited to, pyridine or imidazole, or an acid fragment including, but not limited to, carboxylic acids. Zwitterions that can form "internal salts" are included within the scope of the term "salt." Pharmaceutically acceptable (i.e., non-toxic and physiologically acceptable) salts are preferred, although other salts are also useful and can be used, for example, in the separation or purification steps of a preparation process. The compounds of this invention can form salts, for example, by reacting compound (I) with a certain amount (e.g., equivalent) of an acid or base and precipitating it in a medium, or by freeze-drying it in an aqueous solution.

[0383] The compounds containing a base fragment in this invention, including but not limited to amines, pyridines, or imidazole rings, can form salts with organic or inorganic acids. Typical acids that form salts include acetates (such as acetates or trihaloacetic acids, such as trifluoroacetic acid), adipates, alginates, ascorbic acid salts, aspartates, benzoates, benzenesulfonates, disulfates, borates, butates, citrates, camphorates, camphor sulfonates, cyclopentanepropionates, diethyl glycolate, dodecyl sulfate, ethanesulfonates, fumarates, gluconate, glyceryl phosphates, hemisulfates, heptaate, hexanoates, hydrochlorides, hydrobromates, hydroiodates, hydroxyethanesulfonates (such as 2-hydroxyethanesulfonate), lactates, maleates, methanesulfonates, naphthalenesulfonates (such as -2-naphthalenesulfonate), nicotinates, nitrates, oxalates, pectin persulfate, phenyl propionate (such as 3-phenylpropionate), phosphates, picrates, neopentanoates, propionates, salicylates, succinates, sulfates (such as those that form with sulfuric acid), sulfonates, tartrates, thiocyanates, toluenesulfonates (such as toluenesulfonate), dodecyl esters, etc.

[0384] Some compounds of this invention may contain acidic fragments, including but not limited to carboxylic acids, which can form salts with various organic or inorganic bases. Salts formed by typical bases include ammonium salts, alkali metal salts (such as sodium, lithium, and potassium salts), alkaline earth metal salts (such as calcium and magnesium salts), and salts formed by organic bases (such as organic amines), such as benzylamine, dicyclohexylamine, hydrazine (a salt formed with N,N-bis(dehydroabisulfonic acid)ethylenediamine), N-methyl-D-glucosamine, N-methyl-D-glucosamide, tert-butylamine, and salts formed with amino acids such as arginine and lysine. Basic nitrogen-containing groups can form quaternary ammonium salts with halides, such as small alkyl halides (e.g., chlorides, bromides, and iodides of methyl, ethyl, propyl, and butyl), dialkyl sulfates (e.g., dimethyl sulfate, diethyl sulfate, dibutyl sulfate, and dipentyl sulfate), long-chain halides (e.g., chlorides, iodides, and bromides of decyl, dodecyl, tetradecyl, and tetradecyl), and aralkyl halides (e.g., bromides of benzyl and phenyl).

[0385] Prodrugs and solvates of the compounds of the present application are also within the scope of the present application. The term "prodrug" herein refers to a compound which, upon metabolism or chemical

[0386] The compounds, salts or solvates of the present application can exist in tautomeric forms, such as amide and imino ether. All such tautomers are part of the present application.

[0387] All stereoisomers (for example, those which can arise from various substituents on asymmetric carbon atoms) of the compounds, including enantiomeric forms, and diastereomeric forms, are intended to be within the scope of the present application. Individual stereoisomers of the compounds of the present application can be obtained by the application of art- recognized techniques of chiral synthesis, or resolution. The chiral centers of the present application have the S or R configuration as defined by the IUPAC conventions. The racemic form can be resolved by physical methods such as fractional crystallization, or by separation of diastereomeric derivatives, or by chromatographic techniques. Individual optical isomers can be obtained from racemic mixtures by appropriate methods, including but not limited to conventional procedures such as salt formation with an optically active acid, followed by crystallization and subsequent anion exchange.

[0388] The compounds of the present application obtained by preparation, isolation and purification successively have a weight content of equal to or greater than 90%, for example equal to or greater than 95%, equal to or greater than 99% ("very pure" compounds), and are listed in the text description. In addition, the "very pure" compounds of the present application are also part of the present application.

[0389] All configurational isomers of the compounds of the present application are within the scope, whether in mixture, pure form or very pure form. The definition of the compounds of the present application includes cis (Z) and trans (E) olefin isomers, as well as cis and trans isomers of carbocyclic and heterocyclic rings.

[0390] Throughout the specification, groups and substituents can be chosen to provide stable moieties and compounds.

[0391] Definitions of specific functional groups and chemical terms are described in detail in the detailed description. For purposes of this application, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd. Additionally, specific functional groups are described in more detail in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito: 1999, and March's Advanced Organic Chemistry, 5thEd., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are incorporated herein by reference.

[0392] Some compounds of the application can exist in particular geometric or stereoisomeric forms. The present application contemplates all such compounds, including cis- and trans-isomers, R and S enantiomers, diastereomers, (D) and (L) isomers, racemic mixtures and other mixtures. In addition, asymmetric carbon atoms can represent a substituent, such as an alkyl group. The present application includes all isomers and mixtures thereof.

[0393] According to the present application, mixtures of isomers can comprise isomers in various proportions. For example, a mixture containing only two isomers can have the following combinations: 50:50, 60:40, 70:30, 80:20, 90:10, 95:5, 96:4, 97:3, 98:2, 99:1, or 100:0, all proportions of isomers being within the scope of the present application. Similar ratios and more complex ratios of mixtures of isomers will be readily understood by those of ordinary skill in the art to be within the scope of the present application.

[0394] The present application also includes isotopically-labelled compounds, which are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having the atomic mass or mass number different from the atomic mass or mass number most commonly found in nature. Examples of compounds that can be labelled include isotopes and isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, and chlorine, for example, 2 H, 3 H, 13 C, 11 C, 14 C, 15 N, 18 O, 17 O, 31 P, 32 P, 35 S, 18 F, and 36 Cl. The compounds or enantiomers, diastereomers, isomers, or pharmaceutically acceptable salts or solvates thereof, the above-mentioned compounds containing isotopes or other isotopic atoms are within the scope of the present application. Some isotopically-labelled compounds of the present application, for example, 3 H, and 14Radioisotopes of C, also included, are useful in drug and substrate tissue distribution experiments. Tritium ( 3 H) and C-14( 14 C) are relatively easy to prepare and detect. In addition, heavier isotopes such as deuterium, i.e. 2 H, can have advantages in certain therapeutic applications because of their mass-dependent physical

[0395] If the synthesis of a compound of the application is to be designed, it can be prepared by asymmetric synthesis, or derivatized with a chiral auxiliary reagent, separating the resulting mixture of diastereomers and removing the chiral auxiliary to obtain the pure enantiomer. In addition, if the molecule contains a basic functionality, such as an amino acid, or an acidic functionality, such as a carboxyl group, diastereomeric salts can be formed with a suitable optically active acid or base, which can be separated by conventional means, such as crystallization or chromatography, to give the pure enantiomer.

[0396] As described herein, the compounds in the present application can be substituted with any number of substituents or functional groups to expand the scope of the application. In general, the generic formulae of the compounds of the present application that contain substituents refer to substitution of a hydrogen radical by a particular structural substituent, regardless of whether the term "substituted" precedes the term "optionally." When a particular structure is substituted with multiple instances of a particular substituent, each instance of the substituent can be the same or different. The term "substituted" as used herein includes all substitutions that are allowed for organic compounds. Broadly, allowed substituents include acyclic, cyclic, branched, unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic organic compounds. In the present application, for example, the heteroatom nitrogen can be supplemented by a hydrogen substituent or any of the above-mentioned allowed organic compounds. Furthermore, the present application is not intended to be limited to substituted organic compounds. The present application recognizes that combinations of substituents and variables are advantageous for treating diseases (such as infectious diseases or hypertrophic diseases) in the form of stable compounds. The term "stable" as used herein refers to a stable compound that is sufficient to maintain the integrity of the compound structure for a sufficiently long period of time, preferably a long enough period of time to be useful for the purposes described above.

[0397] Metabolites of compounds of the present application, and prodrugs of the compounds of the present application, which break down in the human or animal body to form the compounds of the present application, and pharmaceutically acceptable salts thereof, are also included within the scope of the claims.

[0398] Methods of preparation

[0399] Methods of preparing the compounds of the present application of Formula (I) are described in more detail below, but these specific methods do not constitute any limitation of the scope of the application. The compounds of the present application can also be conveniently prepared optionally by combining the various synthetic methods described in this specification or known in the art, as such combinations can readily be accomplished by one of ordinary skill in the art to which the present application pertains.

[0400] Generally, the compounds of the present application are prepared as follows, where the starting materials and reagents used are commercially available unless otherwise stated.

[0401] The general procedure for preparing the claimed inhibitors is shown below.

[0402] Scheme 1:

[0403]

[0404] Scheme 2:

[0405]

[0406] Step 1: Compound I-4 is cyclized with tert-butyl 4-(1-ethoxy-1,3-dioxopentan-2- yl)piperazine-1-carboxylate (Compound I-5) to give Compound I-6.

[0407] Step 2: Compound I-6 is alkylated with various intermediates under basic conditions to give Compound I-7.

[0408] Step 3: Compound I-7 is then deprotected and the resulting amine is coupled with the corresponding acid to give the final Compound I-8.

[0409] Scheme 3:

[0410]

[0411] Pharmaceutical compositions and methods of administration

[0412] The pharmaceutical compositions of the present application are used for the prevention and / or treatment of cancer.

[0413] The compounds of Formula (I) can be used in combination with other drugs that are known to treat or ameliorate similar diseases. When given in combination, the original mode of administration of the drugs can remain unchanged, while the compound of Formula (I) can be administered simultaneously or sequentially. Pharmaceutical compositions containing one or several known drugs and the compound of Formula (I) can be preferred when administered in combination with one or more other drugs. Pharmaceutical combinations also include administration of the compound of Formula (I) and the other known drug(s) at overlapping times. When the compound of Formula (I) is used in combination with other drug(s), the dosage of the compound or the known drug(s) can be lower than when given alone.

[0414] In some embodiments, the compounds provided herein, or an enantiomer, stereoisomer, solvate, or pharmaceutically acceptable salt thereof, are administered in conjunction with another drug ("second active agent") or treatment. Second active agents include small molecules and large molecules (e.g., proteins and antibodies). Other therapies that can be used in conjunction with the compounds provided herein include, but are not limited to, surgery, immunotherapy, biological therapy, radiation therapy, and other non-drug therapies useful in the treatment or prevention of the various diseases described herein.

[0415] Dosage forms of the pharmaceutical compositions of the present application include, but are not limited to, injections, tablets, capsules, aerosols, suppositories, films, pills, topical liniments, controlled or sustained release or nanoformulations.

[0416] The pharmaceutical compositions of the present application comprise a safe and effective amount of a compound of the present application or a pharmaceutically acceptable salt and a pharmaceutically acceptable excipient or carrier. By "safe and effective amount" is meant an amount of the compound sufficient to significantly improve the condition, without causing serious side effects. Typically, the pharmaceutical composition contains 1-2000 mg of the compound of the present application per dose, preferably 10-1000 mg of the compound of the present application per dose. Preferably, the "dosage" is a capsule or pill.

[0417] "Pharmaceutically acceptable carrier" means one or more compatible solid or liquid filler or gel materials, which are suitable for human use, must be sufficiently pure and low toxicity. "Compatibility" herein means that each component of the composition can be mixed with the compound of the present application, and can be mixed with each other without significantly reducing the efficacy of the compound. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium dodecyl sulfate), colorants, flavorings, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0418] The administration of the compounds or pharmaceutical compositions of the present application is not particularly limited, and representative administration methods include, but are not limited to, oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous) and topical administration.

[0419] Oral solid dosage forms include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is admixed with at least one conventional inert excipient (or carrier) such as sodium citrate or dicalcium phosphate or any of the following: (a) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders, such as hydroxymethylcellulose, alginic acid, gelatin, polyvinylpyrrolidone, sucrose, and acacia; (c) humectants, such as glycerol; (d) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) solution retarders, such as paraffin; (f) absorption accelerators, such as quaternary ammonium compounds; (g) moisturizing agents, such as glycerol and sorbitol; (h) respiration agents, such as kaolin and bentonite clay; and (i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets, and pills, the dosage form can also contain buffering agents.

[0420] Solid dosage forms, such as tablets, dragees, capsules, pills, and granules, can be prepared using coatings and shells such as enteric coatings and other materials known in the art. They can contain opacifying agents. The release of the active compound or compounds in the composition can be delayed by the use of agents in the dosage form, such as alginates or polypeptides. Examples of embedding compositions include polymeric substances and waxes. The active compound and one or more excipients can be formed into microencapsules, if desired.

[0421] Oral liquid dosage forms include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or elixirs. In addition to the active compound, the liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, and

[0422] In addition to such inert diluents, the composition can also include additives, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0423] Suspensions, in addition to the active compound, can contain suspending agents, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, and agar-agar, or combinations thereof.

[0424] Compositions for parenteral injection can include physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, and sterile powders that can be reconstituted into sterile injectable solutions or dispersions just before use. Suitable aqueous and nonaqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and any suitable mixtures thereof.

[0425] Dosage forms for topical administration of a compound of this application include ointments, powders, patches, aerosols, and inhalers. In sterile containers, the active compound is mixed with a physiologically acceptable carrier, and any preservatives, buffers, or propellants as can be required.

[0426] The compounds of the present application can be administered alone or in combination with any other pharmaceutically acceptable compounds.

[0427] When a pharmaceutical composition is used, a safe and effective amount of a compound of the present application is administered to a mammal (e.g., a human) in need thereof, wherein the administered dose is a pharmaceutically effective dose. For a human of 60 kg body weight, the daily dose is usually 1-2000 mg, preferably 50-1000 mg. The specific dose will, of course, depend on a variety of factors, e.g., the route of administration, the patient’s health, and should be decided according to the judgment of a skilled medical practitioner.

[0428] The present application also provides a method of preparing a pharmaceutical composition, comprising the step of mixing a pharmaceutically acceptable carrier with a compound of Formula (I) of the present application or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0429] The main advantages of the present application include:

[0430] 1. The compounds of the present application are a new class of Werner syndrome helicase inhibitors.

[0431] 2. The compounds of the present application show good inhibitory effect on Werner syndrome helicase, and can be used as Werner syndrome helicase (WRN) inhibitors to treat cancer.

[0432] 3. The compounds of the present application have good drugability (including but not limited to: solubility, safety, etc.). Examples

[0433] Certain embodiments of the claimed subject matter are illustrated by the following non-limiting examples.

[0434] The disclosed compounds can generally be synthesized by the general procedures described above or by appropriate combinations of generally known synthetic methods. Based on the present disclosure, techniques to synthesize these compounds will be apparent to those skilled in the art and are available. Many of the optionally substituted starting compounds and other reactants are commercially available or can be readily prepared by synthetic methods commonly known to those skilled in the art.

[0435] The following examples are intended to illustrate certain methods of making the disclosed compounds and are not intended to limit the scope of reactions or reaction sequences that can be used in preparing the compounds provided herein.

[0436] Example 1: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)piperidin-1-yl)-5- ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-7-oxo-[1,2,4]triazolo[1,5- a]pyrimidin-4(7H)-yl)acetamide

[0437]

[0438] Step 1: To a solution of tert-butyl 4-oxopiperidine-1-carboxylate (1.25 g, 6.2 mmol) and 2-(difluoromethane)sulfonylpyridine (1 g, 5.2 mmol) in DMF (30 mL) was added a solution of t-BuOK (1.05 g, 9.3 mmol) in DMSO (10 mL) dropwise at -40 °C. The mixture was then stirred at -40 °C for 2 h under nitrogen. The reaction mixture was heated to room temperature, poured into water (50 mL), the pH was adjusted to 3 with 2N HCl, then extracted with ethyl acetate (50 mL*3). The organic layer was washed with brine (50 mL*2), dried over anhydrous sodium sulfate, concentrated in vacuum to give the crude product. The crude product was purified by flash silica gel chromatography (elution gradient: 0 to 20% ethyl acetate in hexanes, v / v) to give tert-butyl 4-(difluoromethyl)piperidine-1-carboxylate (1.1 g, 4.7 mmol, yield: 90.4%) as colorless oil. 1 H NMR (400 MHz, CDCl3) d ppm 3.38-3.37 (m, 4H), 2.12-2.10 (m, 4H), 1.42 (s, 9H). MS (ESI) m / z = 178.2 [M-56] + .

[0439] Step 2: To a stirred solution of tert-butyl 4-(difluoromethyl)piperidine-1-carboxylate (1.1 g, 4.7 mmol) in DCM (10 mL) was added a solution of 4M HCl in dioxane (10 mL, 40 mmol) dropwise under nitrogen. The reaction mixture was stirred at 25 °C for 2 h. The mixture was concentrated under reduced pressure to give 4-(difluoromethyl)piperidine hydrochloride (0.6 g, 3.5 mmol, yield: 74.47%) as white solid. The product was used directly without further purification. 1 H NMR (400 MHz, DMSO-d6) d ppm 9.31-9.17 (m, 2H), 3.06-3.05 (m, 4H), 2.38-2.37 (m, 4H).

[0440] Step 3: A mixture of 4-(difluoromethylidene)piperidine hydrochloride (133 mg, 1 mmol), [bis(methylsulfanyl)methylene](cyano)amine (146 mg, 1 mmol) and TEA (106 mg, 1.04 mmol) in MeCN (5 mL) was stirred at 90 °C for 16 h. Then cooled to 0 °C. Hydrazine hydrate (625.12 mg, 10 mmol) was added dropwise, the resulting mixture was stirred at 90 °C for 20 h. The mixture was concentrated under vacuum and purified by flash chromatography (MeOH DCM = 0-10%) to give the product 3-(4-(difluoromethylidene)piperidin-l-yl)-lH-l,2,4-triazol-5-amine (215 mg, 1 mmol, 100% yield) as yellow oil. MS (ESI) m / z = 216.1 [M+H] + .

[0441] Step 4: To a solution of ethyl 3-oxopentanoate (30 g, 208.1 mmol) in DCM (200 mL) was added N-bromosuccinimide (38.89 g, 218.5 mmol) and TsOH.H2O (7.91 g, 41.6 mmol). The mixture was stirred at room temperature for 2.5 h. The mixture was diluted with water (200 mL) and extracted with DCM (200 mL*3). The combined organic layers were washed with brine (200 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (ethyl acetate / hexane = 0-1%) to give the product ethyl 2-bromo-3-oxopentanoate (19 g, 85.2 mmol, yield: 40%) as colorless oil. 1 H NMR (400 MHz, CDC13) δ 4.80 (s, 1H), 4.28 (t, J = 7.1 Hz, 2H), 2.80 (q, J = 7.2 Hz, 2H), 1.31 (t, J = 7.1 Hz, 3H), 1.14 (t, J = 7.2 Hz, 3H).

[0442] Step 5: A mixture of ethyl 2-bromo-3-oxopentanoate (19 g, 85.2 mmol), tert-butyl piperazine-1-carboxylate (31.74 g, 170.4 mmol) and potassium carbonate (35.33 g, 0.25 mmol) in acetonitrile (100 mL) was stirred at 50 °C for 2 h. The mixture was filtered, the filter cake was washed with acetonitrile. The filtrate was concentrated under vacuum and purified by flash chromatography (ethyl acetate-hexane = 0-3%) to give the product tert-butyl 4-(l-ethoxy-l,3-dioxopentan-2-yl)piperazine-l-carboxylate (18 g, 54.8 mmol, yield: 64%) as yellow oil. MS (ESI) m / z = 329.1 [M+H] + .

[0443] Step 6: To a solution of 5-[4-(difluoromethyl)piperidin-l-yl]-2H-l,2,4-triazol-3-amine (215 mg, 1 mmol) in ethanol (10 mL) was added 4-(l-ethoxy-l,3-dioxopentan-2-yl)piperazine-l- carboxylate (328.11 mg, 1 mmol) and phosphoric acid (293.74 mg, 3 mmol). The reaction mixture was stirred at 80 °C for 72 h under nitrogen. The mixture was basified with sodium bicarbonate to pH = 9, diluted with water, extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated under vacuum and purified by flash chromatography (5% NH3-H2O in MeOH DCM = 0-20%) to give the product 2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-7(4H)-one (140 mg, 0.369 mmol, 36% yield) as off-white solid. MS (ESI) m / z = 380.2 [M+H] + .

[0444] Step 7: To a solution of 2-[4-(difluoromethyl)piperidin-l-yl]-5-ethyl-6-(piperazin-l-yl)-4H- [l,2,4]triazolo[l,5-a]pyrimidin-7-one (140 mg, 0.37 mmol) in DCM (10 mL) was added Boc20 (96.64 mg, 0.44 mmol) and TEA (112.02 mg, 1.1 mmol). The mixture was stirred at room temperature for 16 h. The mixture was concentrated under vacuum and the residue was purified by flash chromatography (ethyl acetate hexanes = 0-60%) to give the product 4-(2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (120 mg, 0.22 mmol, 61% yield) as light yellow solid. 1 H NMR (400 MHz, CD3OD) d 4.05 (d, J = 12.5 Hz, 2H), 3.64 - 3.59 (m, 4H), 3.55 (t, J = 11.5 Hz, 2H), 3.01 (s, 2H), 2.86 (q, J = 7.6 Hz, 2H), 2.68 (d, J = 11.0 Hz, 2H), 2.28 (t, J = 5.5 Hz, 4H), 1.51 (s, 9H), 1.28 (t, J = 7.6 Hz, 3H). MS (ESI) m / z = 480.2 [M+H] +

[0445] Step 8: To a solution of 2-chloro-4-(trifluoromethyl)aniline (10 g, 50.9 mmol) in DCM (50 mL) was added DIPEA (19.73 g, 152.7 mmol) and 2-bromoacetyl bromide (30.82 g, 152.7 mmol) at 0 °C. The mixture was stirred at room temperature for 16 h. The mixture was diluted with water (50 mL) and extracted with DCM (50 mL*3). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate, concentrated in vacuo and purified by flash chromatography (ethyl acetate-Hxanes = 0-20%) to give the product 2-bromo-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (12 g, 37.8 mmol, 74% yield) as a yellow solid. MS (ESI) m / z = 315.9, 317.9 [M+H] + .

[0446] Step 9: To a solution of tert-butyl 4-{2-[4-(difluoromethyl)piperidin-l-yl]-5- ethyl-7-oxo-4H-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl}piperazine-l-carboxylate (120 mg, 0.25 mmol) in DMF (10 mL) was added 2-bromo-N-[2-chloro-4- (trifluoromethyl)phenyl]acetamide (79 mg, 0.25 mol) and DIPEA (97 mg, 0.75 mmol). The mixture was stirred at room temperature for 4 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuo, purified by flash chromatography (MeOH / DCM = 0-1%) to give the product tert-butyl 4-(4-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-2-(4- (difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5- a]pyrimidin-6-yl)piperazine-l-carboxylate (133 mg, 0.186 mmol, 74% yield) as a colorless oil. MS (ESI) m / z = 715.2, 717.2 [M+H] + .

[0447] Step 10: To a solution of tert-butyl 4-[4-({[2-chloro-4-(trifluoromethyl)phenyl] carbamoyl}methyl)-2-[4-(difluoromethyl)piperidin-l-yl]-5-ethyl-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl]piperazine-l-carboxylate (133 mg, 0.186 mmol) in DCM (5 mL) was added a solution of HC1 in dioxane (4 mL). The mixture was stirred at room temperature for 2 hours. The mixture was concentrated under vacuum to give the crude product N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide hydrochloride (110 mg, 0.1789 mmol, 98% yield) as off-white solid. MS (ESI) m / z = 615.3, 617.3 [M+H] + .

[0448] Step 11: A mixture of 4,6-dichloro-5-methoxypyrimidine (20 g, 111.7 mmol), methyl borane diol (10.03 g, 167.55 mmol), Pd(dppf)Cl2(3.27 g, 4.46 mmol) and potassium phosphate (47.42 g, 223.4 mmol) in toluene (60 mL), dioxane (8 mL) and pure water (20 mL) was stirred at 105 °C for 16 hours under nitrogen atmosphere. The mixture was diluted with water (100 mL) and extracted with ethyl acetate (100 mL*3). The combined organic layers were washed with brine (100 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by chromatography (ethyl acetate / hexane = 0-20%) to give the product 4-chloro-5-methoxy-6-methylpyrimidine (9.8 g, 61.8 mmol, 55% yield) as colorless oil. 1 H NMR (400 MHz, CDC13) δ 8.61 (s, 1H), 3.91 (s, 3H), 2.56 (s, 3H). MS (ESI) m / z = 159.0, 161.0 [M+H] + .

[0449] Step 12: To a solution of 4-chloro-5-methoxy-6-methylpyrimidine (9.8 g, 61.8 mmol) in methanol (100 mL) was added Pd(dppf)Cl2(2.24 g, 3 mmol) and TEA (18.76 g, 185.4 mmol). The reaction mixture was stirred at 60 °C under CO for 48 h. The mixture was concentrated under vacuum, purified with silica (ethyl acetate / hexane = 0-30%) to give the product 5-methoxy-6-methylpyrimidine-4-carboxylic acid methyl ester (7.9 g, 43.4 mmol, 70% yield) as yellow oil. MS (ESI) m / z = 183.1 [M+H] + .

[0450] Step 13: A mixture of 5-methoxy-6-methylpyrimidine-4-carboxylic acid methyl ester (7.9 g, 43.4 mmol) in HBr (25 mL, 48 wt.% in pure water) was stirred at 40 °C for 16 h. Then HI (25 mL, 55-57 wt.% in water) was added to the solution and stirred for 16 h, quenched with NaOH (50% in water) at 0-20 °C. The mixture was filtered to give the product 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (3.1 g, 20.1 mmol, 46% yield) as yellow solid. 1 H NMR (400 MHz, DMSO-d6) d 8.50 (s, 1H), 6.31 (s, 3H), 2.42 (s, 3H).

[0451] Step 14: To a solution of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (27.06 mg, 0.17 mmol) in DCM (5 mL) was added (1-chloro-2-methylprop-1-en-1-yl)dimethylamine (29.32 mg, 0.22 mmol). The mixture was stirred at room temperature for 30 min. Then N-[2-chloro-4-(trifluoromethyl)phenyl]-2-{2-[4-(difluoromethyl)piperidin-1-yl]-5-ethyl-7-oxo-6-(piperazin-1-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4-yl}acetamide hydrochloride (90 mg, 0.146 mmol) was added, the resulting mixture was stirred at room temperature for 30 min, then a solution of DIPEA (56.72 mg, 0.43 mmol) in DCM (1 mL) was added dropwise, the resulting mixture was stirred at room temperature for 1 h. The mixture was diluted with water (10 mL) and extracted with DCM (10 mL*3). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate, then concentrated under vacuum, purified by flash chromatography (MeOH / DCM = 0-2%) to give the product N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)piperidin-1-yl)-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (24.1 mg, 0.03 mmol, 20% yield) as a white solid. 1 H NMR (400 MHz, CD3OD) δ 8.54 (s, 1H), 8.13 (d, J = 8.6 Hz, 1H), 7.79 (s, 1H), 7.59 (d, J = 8.6 Hz, 1H), 5.26 (s, 2H), 4.66 (d, J = 12.0 Hz, 1H), 4.06 (d, J = 11.1 Hz, 1H), 3.70 (t, J = 13.4 Hz, 2H), 3.62 - 3.52 (m, 4H), 3.39 (t, J = 11.1 Hz, 1H), 3.16 - 2.96 (m, 3H), 2.88 (d, J = 10.4 Hz, 1H), 2.73 (d, J = 11.2 Hz, 1H), 2.49 (s, 3H), 2.21 (s, 4H), 1.26 (t, J = 7.4 Hz, 3H). MS (ESI) m / z = 751.1 [M+H] + .

[0452] Example 6: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-1-yl)-2-(1,4-oxazolidin-4-yl)-7-oxo- [1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide

[0453]

[0454] Step 1: To a solution of ethyl 3-oxopentanoate (30 g, 208.1 mmol) in DCM (200 mL) was added N-bromosuccinimide (38.89 g, 218.5 mmol) and TsOH.H2O (7.91 g, 41.6 mmol). The mixture was stirred at room temperature for 2.5 h. The mixture was diluted with water (200 mL) and extracted with DCM (200 mL*3). The combined organic layers were washed with brine (200 mL), dried over anhydrous sodium sulfate, concentrated in vacuo and purified by flash chromatography (ethyl acetate / hexane = 0-1%) to give the product ethyl 2-bromo-3-oxopentanoate (19 g, 85.2 mmol, yield: 40%) as colorless oil. 1 H NMR (400 MHz, CDCl3) δ 4.80 (s, 1H), 4.28 (t, J = 7.1 Hz, 2H), 2.80 (q, J = 7.2 Hz, 2H), 1.31 (t, J = 7.1 Hz, 3H), 1.14 (t, J = 7.2 Hz, 3H).

[0455] Step 2: A mixture of ethyl 2-bromo-3-oxopentanoate (19 g, 85.2 mmol), tert-butyl piperazine-1-carboxylate (31.74 g, 170.4 mmol) and potassium carbonate (35.33 g, 0.25 mmol) in acetonitrile (100 mL) was stirred at 50 °C for 2 h. The mixture was filtered and the filter cake was washed with acetonitrile. The filtrate was concentrated in vacuo and purified by flash chromatography (ethyl acetate / hexane = 0-3%) to give the product tert-butyl 4-(1-ethoxy-1,3-dioxopentan-2-yl)piperazine-1-carboxylate (18 g, 54.8 mmol, yield: 64%) as yellow oil. MS (ESI) m / z = 329.1 [M+H] + .

[0456] Step 3: To a solution of tert-butyl 4-(l-ethoxy-l,3-diketopentan-2-yl)piperazine-l- carboxylate (3 g, 9.1 mmol) in ethanol (20 mL) was added 5-bromo-4H-l,2,4-triazol-3- amine (1.48 g, 9.1 mol) and phosphoric acid (1.78 g, 18.2 mmol). The reaction mixture was stirred at 80 °C under nitrogen protection for 16 h. The mixture was basified with sodium bicarbonate solution to pH = 9, diluted with water, extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (MeOH / DCM = 0-3%) to give the product tert-butyl 4-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l- carboxylate (310 mg, 0.7 mmol, yield: 7%) as a yellow solid. MS (ESI) m / z = 427.1, 429.1 [M+H] + .

[0457] Step 4: To a solution of tert-butyl 4-{2-bromo-5-ethyl-7-oxo-4H-[l,2,4]triazolo[l,5-a]pyrimidin-6- yl}piperazine-l-carboxylate (310 mg, 0.72 mmol) in DMF (6 mL) was added 2-bromo-N-[2- chloro-4-(trifluoromethyl)phenyl]acetamide (252.58 mg, 0.79 mmol) and DIPEA (281.29 mg, 2.17 mmol). The mixture was stirred at room temperature for 16 h. The mixture was diluted with water (20 mL), extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (ethyl acetate / hexane = 0-60%) to give the product tert-butyl 4-(2-bromo-4-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo- 4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (350 mg, 0.52 mmol, yield: 72%) as a yellow solid. MS (ESI) m / z = 606.0, 608.0 [M+H-56] + .

[0458] Step 5: A mixture of 4-[2-bromo-4-({[2-chloro-4-(trifluoromethyl)phenyl] carbamoyl}methyl)-5-ethyl-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl]piperazine- 1-carboxylic acid tert-butyl ester (100 mg, 0.15 mmol), l,4-oxazepane hydrochloride (208 mg, 1.5 mmol) and DIEA (97 mg, 0.75 mmol) in DMSO (5 mL) was stirred at 100 °C for 48 h. The reaction mixture was quenched with water (5 mL), extracted with ethyl acetate (10 mL*3). The organic layers were combined, washed with brine (80 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give the crude product which was purified by flash chromatography (methanol / DCM: 0~10%) to give compound 4-(4-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-5- ethyl-2-(l,4-oxazepan-4-yl)-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine- 1-carboxylic acid tert-butyl ester (20 mg, 0.03 mmol, yield: 19.4%). MS (ESI) m / z = 627.3 [M+H] + .

[0459] Step 6: To a solution of 4-(4-(2-((2-chloro-4-(trifluoromethyl)phenyl)amino)-2- oxoethyl)-5-ethyl-2-(l,4-oxazepan-4-yl)-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin- 6-yl)piperazine-l-carboxylic acid tert-butyl ester (20 mg, 0.03 mmol) in DCM (3 mL) was added HC1 / dioxane (1 mL). The mixture was stirred at room temperature for 1 h, then concentrated in vacuo to give the crude product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-2-(l,4-oxazepan-4-yl)-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (20 mg, 0.03 mmol, yield: 117%) as a yellow solid. MS (ESI) m / z = 583.3 [M+H] + .

[0460] Step 7: To a solution of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (7 mg, 0.04 mmol) in DCM (2 mL) was added l-chloro-N,N,2-trimethyl-l-propen-l-amine (7 mg, 0.05 mmol) and stirred at room temperature for 30 min, then N-[2-chloro-4-(trifluoromethyl)phenyl]-2-[5-ethyl-2-(l,4-oxazepan-4-yl)-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4-yl]acetamide (20 mg, 0.03 mmol) was added and the mixture was stirred at room temperature for 30 min. A solution of DIEA (13 mg, 0.1 mmol) in DCM (1 mL) was added dropwise and the resulting mixture was stirred at room temperature for 1 h. The mixture was concentrated and purified by preparative TLC (methanol / DCM: 0~10%) to give white product N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carboxyl)piperazin-l-yl)-2-(l,4-oxazepan-4-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (3.6 mg, 0.005 mmol, 16.6% yield) solid. 1 H NMR (400 MHz, CD3OD) δ 8.59 (s, 1H), 8.16 (d, J = 8.5 Hz, 1H), 7.83 (s, 1H), 7.64 (d, J = 8.5 Hz, 1H), 5.30 (s, 2H), 4.71 (d, J = 11.9 Hz, 1H), 4.10 (d, J = 13.0 Hz, 1H), 3.83 - 3.70 (m, 10H), 3.44 (t, J = 10.7 Hz, 1H), 3.08 (d, J = 7.7 Hz, 3H), 2.92 (d, J = 11.8 Hz, 1H), 2.78 (d, J = 10.7 Hz, 1H), 2.54 (s, 3H), 2.00 - 1.92 (m, 2H), 1.29 (d, J = 7.5 Hz, 3H). MS (ESI) m / z = 719.3 [M+H] + .

[0461] Example 7: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethylidene)cyclohex-l-en- 1-yl)-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0462]

[0463] Step 1: t-BuOK (6466 mg, 57.6 mmol) was added to a DMF (20 mL) solution of 1,4-dioxaspirin[4.5]decane-8-one (5000 mg, 32.0 mmol) and DFMPS (5565 mg, 28.8 mmol) stirred at -60 °C under nitrogen. The reaction mixture was stirred at -60 to -25 °C for 2 hours. The reaction was quenched with water (20 mL). The crude mixture was extracted with ethyl acetate (50 mL x 3), the combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to give a colorless oily product 8-(difluoromethylene)-1,4-dioxaspirin[4.5]decane (2000 mg, 10.5 mmol, yield: 32.8%). 1 H NMR (400MHz, CDCl3) δ3.96 (s, 4H), 2.27-2.22 (m, 4H), 1.72-1.61 (m, 4H).

[0464] Step 2: Add 10 mL of 3N HCl to a THF (10 mL) solution of 2000 mg (10.5 mmol) of 8-(difluoromethylene)-1,4-dioxaspiro[4.5]decane. Stir the reaction mixture at room temperature for 16 hours. Extract the crude mixture with DCM (50 mL x 3), wash the combined organic layers with brine (20 mL), dry with anhydrous sodium sulfate, filter and concentrate under vacuum to give the crude product. Then purify by rapid chromatography (elution gradient: ethyl acetate / hexane, 0-3%) to give the colorless oily product 4-(difluoromethylene)cyclohexane-1-one (600 mg, 4.1 mmol, yield: 39.0%). 1 H NMR (400MHz, CDCl3) δ2.55-2.46(m,4H),2.46-2.37(m,4H).

[0465] Step 3: To a stirred solution of 4-(difluoromethyl)cyclohexan-l-one (600 mg, 4.1 mmol) in THF (20 mL) at -78 °C was added LDA (2 M, 4.1 mL, 8.2 mmol). The solution was stirred at -78 °C for 30 min under nitrogen protection. Then N-phenyl-O-((trifluoromethyl)sulfonyl)-N-((trifluoromethyl)sulfonyl)oxy)hydroxylamine (1591 mg, 4.1 mmol) was added to the solution. The mixture was stirred at room temperature for 16 h. The reaction was quenched with NH4CI. The crude mixture was extracted with DCM (50 mL*3), the combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give the crude product. Then purified by flash chromatography (elution gradient: hexane) to give the product 4-(difluoromethyl)cyclohex-l-en-l-yl trifluoromethanesulfonate (350 mg, 1.25 mmol, yield: 30.5%) as colorless oil. 1 H NMR (400 MHz, CDC13) δ 5.77 (s, 1H), 2.89 (s, 2H), 2.43 (s, 4H).

[0466] Step 4: To a solution of 4-(difluoromethyl)cyclohex-l-en-l-yl trifluoromethanesulfonate (350 mg, 1.25 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(l,3,2-dioxaborolane) (383 mg, 1.5 mmol) and KOAc (247 mg, 2.5 mmol) in dioxane (3 mL) was added Pd(dppf)Cl2(92 mg, 0.12 mmol). The reaction mixture was stirred at 80 °C for 5 h under nitrogen protection. The mixture was concentrated in vacuo, purified by flash chromatography (elution gradient: ethyl acetate hexane, 0-5%) to give the product 2-(4-(difluoromethyl)cyclohex-l-en-l-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane (90 mg, 0.35 mmol, yield: 28.0%) as yellow oil. 1 H NMR (400 MHz, CDC13) δ 6.51 (s, 1H), 2.78 (s, 2H), 2.20 (s, 4H), 1.26 (s, 12H).

[0467] Step 5: To a solution of 2-(4-(difluoromethyl)cyclohex-l-en-l-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane (90 mg, 0.35 mmol), 4-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5- a]pyrimidin-6-yl)piperazine- 1 -carboxylic acid tert-butyl ester (165 mg, 0.38 mmol) and sodium carbonate in dioxane (3 mL) / pure water (0.5 mL) was added Pd(dppf)Cl2(25.17 mg, 0.1 mmol). The mixture was stirred at 100 °C for 16 h under nitrogen atmosphere. The mixture was concentrated in vacuum, purified by flash chromatography (elution gradient: MeOH / DCM, 0-3%) to give the product 4-(2-(4-(difluoromethyl)cyclohex-l-en-l-yl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylic acid tert-butyl ester (95 mg, 0.20 mmol, yield: 57.1%) as yellow oil. MS (ESI) m / z = 477.3 [M+H] + .

[0468] Step 6: To a solution of 4-(2-(4-(difluoromethyl)cyclohex-l-en-l-yl)-5-ethyl-7-oxo-4,7- dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylic acid tert-butyl ester (95 mg, 0.20 mmol), 2-bromo-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (80 mg, 0.25 mmol) in DMF (3 mL) was added DIEA (81 mg, 0.63 mmol). The mixture was stirred at room temperature for 16 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The organic layers were combined, washed with brine (30 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuum to give the crude product which was purified by flash chromatography (elution gradient: MeOH / DCM = 0-20%) to give compound 4-(4-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-2-(4- (difluoromethyl)cyclohex-l-en-l-yl)-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5- a]pyrimidin-6-yl)piperazine-l-carboxylic acid tert-butyl ester (100 mg, 0.14 mmol, yield: 70.0%) as yellow solid. MS (ESI) m / z = 656.3 [M+H-56] + .

[0469] Step 7: To a solution of 4-(4-(2-((2-chloro-4-(trifluoromethyl)phenyl)amino)-2- oxoethyl)-2-(4-(difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-7-oxo-4,7-dihydro- [1,2,4]triazolo[1,5-A]pyrimidin-6-yl)piperazine-1-carboxylic acid tert-butyl ester (100 mg, 0.14 mmol) in DCM (1 mL) was added HC1 / dioxane (4 M, 1 mL). The mixture was stirred at room temperature for 16 hours. The mixture was concentrated under vacuum to give the product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-7-oxo- 6-(piperazin-1-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (70 mg, 0.11 mmol, 78.6% yield) as a white solid. MS (ESI) m / z = 612.3 [M+H] + .

[0470] Step 8: To a solution of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (20 mg, 0.13 mmol) in DCM (3 mL) was added (1-chloro-2-methylprop-1-en-1-yl)dimethylamine (22 mg, 0.17 mmol). The mixture was stirred at room temperature for 30 minutes. Then N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-7-oxo-6-(piperazin-1-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (70 mg, 0.11 mmol) was added and the mixture was stirred at room temperature for 30 minutes. Then DIPEA (42 mg, 0.33 mmol) in DCM (1 mL) was added dropwise and the mixture was stirred at room temperature for 1 hour. The mixture was diluted with water (10 mL) and extracted with DCM (10 mL*3). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate, then concentrated under vacuum and purified by preparative TLC (PE / EtOAc = 1 / 1) to give the product N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (2.1 mg, 0.003 mmol, 2.7% yield) as a white solid. 1H NMR (400 MHz, CD3OD) δ 8.59 (s, 1H), 8.18 (d, J = 8.6 Hz, 1H), 7.84 (s, 1H), 7.64 (d, J = 7.2 Hz, 1H), 6.99 (s, 1H), 5.40 (s, 2H), 4.72 (d, J = 12.0 Hz, 1H), 4.10 (d, J = 13.0 Hz, 1H), 3.76 (t, J = 13.0 Hz, 2H), 3.45 (t, J = 11.3 Hz, 1H), 3.22 - 3.08 (m, 3H), 2.96 (d, J = 19.3 Hz, 3H), 2.80 (d, J = 11.2 Hz, 1H), 2.68 (s, 2H), 2.54 (s, 3H), 2.42 (t, J = 6.4 Hz, 2H), 1.34 (d, J = 7.5 Hz, 3H). MS (ESI) m / z = 748.2 [M+H] + .

[0471] Example 8: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-2-(2,5,6,7-tetrahydrooxepin-3-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0472]

[0473] Step 1: To a solution of NaH (1.68 g, 60%, 0.04 mol) in Et20 (30 mL) was added dropwise pent-4-en-l-ol (3 g, 0.035 mol) at 30 °C. The reaction mixture was stirred for 1 h. 3-Bromoprop-l-yne was added dropwise at room temperature and the reaction mixture was refluxed overnight. The mixture was quenched with ice water (20 mL) and extracted with ethyl acetate (20 mL*3). The organic layers were combined, washed with brine (80 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give the crude product which was purified by flash chromatography (ethyl acetate / hexane: 0~5%) to give compound 5-(prop-2-yn-l-yloxy)pent-l-en (2 g, 0.016 mol, yield: 45.7%) as yellow oil. 1 H NMR (400 MHz, CDCl3) δ 5.83 - 5.77 (m, 1H), 5.05 - 4.93 (m, 2H), 4.17 - 4.07 (m, 2H), 3.51 (t, J = 6.5 Hz, 2H), 2.40 (t, J = 2.4 Hz, 1H), 2.22 - 2.05 (m, 2H), 1.72 - 1.64 (m, 2H).

[0474] Step 2: To a solution of 5-(prop-2-yn-1-yloxy)pent-1-ene (2 g, 0.016 mol) in toluene (10 mL) was added 4,4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2- dioxaborolane (4.91 g, 0.019 mol), CuCl (0.16 g, 1.61 mmol), NaOtBu (0.46 g, 4.83 mmol) and (tBu)3PHBF4(0.56 g, 1.93 mmol) at room temperature under argon, then methanol (2 mL) was added, the reaction mixture was stirred at room temperature for 3 hours. Then concentrated under vacuum to get the crude product, which was purified by flash chromatography (ethyl acetate / hexane: 0-10%) to give compound 4,4,5,5-tetramethyl-2-(3-(pent-4-en-1-yloxy)prop-1-en-2-yl)-1,3,2-dioxaborolane (1.1 g, 4.36 mmol, yield: 27.2%) as yellow oil. MS (ESI) m / z = 253.3 [M+H] + .

[0475] Step 3: A solution of 4,4,5,5-tetramethyl-2-[3-(pent-4-en-1-yloxy)prop-1-en-2-yl]-1,3,2- dioxolane (1.1 g, 4.4 mmol) in toluene (10 mL) was refluxed under argon for 1 hour, then cooled to room temperature. Grubbs second generation catalyst (190 mg, 0.2 mmol) was added, the reaction mixture was refluxed overnight. Then concentrated under vacuum to get the crude product, which was purified by flash chromatography (ethyl acetate / hexane: 0-10%) to give compound 4,4,5,5-tetramethyl-2-(2,5,6,7-tetrahydrooxepin-3-yl)-1,3,2-dioxaborolane (700 mg, 3.125 mmol, yield: 71.02%) as yellow oil. 1 H NMR (400 MHz, CDCl3) δ 6.73 (s, 1H), 4.27 (d, J = 1.1 Hz, 2H), 3.83 (t, J = 5.7 Hz, 2H), 2.39 (d, J = 5.8 Hz, 2H), 1.80 (m, 2H), 1.22 (s, 12H).

[0476] Step 4: A mixture of 4,4,5,5-tetramethyl-2-(2,5,6,7-tetrahydrooxepin-3-yl)-1,3,2- dioxolane (100 mg, 0.44 mmol), 4-{2-bromo-5-ethyl-7-oxo-4H-[1,2,4]triazolo[1,5- a]pyrimidin-6-yl}piperazine-1-carboxylic acid tert-butyl ester (190 mg, 0.44 mmol), sodium carbonate (94 mg, 0.89 mmol) and Pd(dppf)Cl2(16 mg, 0.022 mmol) in dioxane / pure water = 5:1 (4 mL) was stirred at 100 °C for 16 h. Then concentrated under vacuum to get the crude product, which was purified by flash purification chromatography (methanol / DCM: 0~10%) to get compound 4-(5-ethyl-7-oxo-2-(2,5,6,7-tetrahydrooxepin-3-yl)-4,7-dihydro- [1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylic acid tert-butyl ester (80 mg, 0.18 mmol, yield: 40.95%) as yellow oil. MS (ESI) m / z = 445.3 [M+H] + .

[0477] Step 5: A mixture of 4-[5-ethyl-7-oxo-2-(2,5,6,7-tetrahydrooxepin-3-yl)-4H- [1,2,4]triazolo[1,5-a]pyrimidin-6-yl]piperazine-1-carboxylic acid tert-butyl ester (80 mg, 0.18 mmol), 2-bromo-N-[2-chloro-4-(trifluoromethyl)phenyl]acetamide (68 mg, 0.21 mmol) and DIEA (70 mg, 0.54 mmol) in DMF (5 mL) was stirred at room temperature for 16 h. The mixture was quenched with ice water (20 mL), extracted with ethyl acetate (10 mL*3). The organic layers were combined, washed with brine (30 mL), dried over anhydrous sodium sulfate, filtered and concentrated under vacuum to get the crude product, which was purified by flash chromatography (methanol / DCM 0~10%) to get compound 4-(4-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-5- ethyl-7-oxo-2-(2,5,6,7-tetrahydrooxepin-3-yl)-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin- 6-yl)piperazine-1-carboxylic acid tert-butyl ester (100 mg, 0.14 mmol, yield: 81.8%) as yellow oil. MS (ESI) m / z = 624.1 [M+H] + .

[0478] Step 6: To a solution of tert-butyl 4-[4-({[2-chloro-4-(trifluoromethyl)phenyl] carbamoyl}methyl)-5-ethyl-7-oxo-2-(2,5,6,7-tetrahydrooxepan-3-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl]piperazine-l-carboxylate (100 mg, 0.14 mmol) in DCM (2 mL) was added HC1 / dioxane (1 mL) and stirred at room temperature for 1 h. Then concentrated under vacuum to give the crude product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-l-yl)-2-(2,5-6,7-tetrahydro- oxepan-3-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (80 mg, 0.138 mmol, 98.69%) as a light yellow solid. MS (ESI) m / z = 580.3 [M+H] + .

[0479] Step 7: To a solution of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (32 mg, 0.2 mmol) in DCM (3 mL) was added l-chloro-N,N,2-trimethyl-l-propen-l-amine (35 mg, 0.25 mmol), the mixture was stirred at room temperature for 30 min, then N-[2-chloro-4- (trifluoromethyl)phenyl]-2-[5-ethyl-7-oxo-6-(piperazin-l-yl)-2-(2,5,6,7- tetrahydrooxepan-3-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4-yl]acetamide (100 mg, 0.17 mmol) was added and the mixture was stirred at room temperature for 30 min. DIEA (67 mg, 0.51 mmol) in DCM (1 mL) was added dropwise, the resulting mixture was stirred at room temperature for 1 h. The mixture was concentrated and purified by flash chromatography (methanol / DCM = 0-2%) and preparative high performance liquid chromatography (Gemini-C18 150*21.2 mm 5um: ACN-H20 (0.1% FA): 55-85) to give the product N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-2-(2,5,6,7-tetrahydrooxepan-3-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (2 mg, 0.0026 mmol, yield: 1.51%) 1H NMR (400 MHz, CD3OD) δ 8.51 (d, J = 24.4 Hz, 2H), 8.17 (d, J = 8.4 Hz, 1H), 7.84 (s, 1H), 7.64 (d, J = 8.3 Hz, 1H), 7.23 (t, J = 5.7 Hz, 1H), 5.39 (s, 2H), 4.77 (s, 2H), 4.07 (s, 1H), 3.95 (s, 2H), 3.73 (s, 2H), 3.43 (d, J = 53.4 Hz, 2H), 3.24 - 3.06 (m, 3H), 2.96 (s, 1H), 2.81 (s, 1H), 2.53 (s, 3H), 2.05 (s, 1H), 1.92 (d, J = 4.8 Hz, 2H), 1.62 (s, 1H), 1.31 (s, 3H). MS (ESI) m / z = 716.3 [M+H] + .

[0480] Example 9 and Example 10: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5- hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-2-(2,3,6,7- tetrahydrooxepin-4-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide and N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l- yl)-7-oxo-2-(2,5,6,7-tetrahydrooxepin-4-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0481]

[0482] Step 1: To a stirred solution of 3,4-dihydro-2H-pyran (1.0 g, 10.0 mmol) in DCM (10 mL) was added acetic acid (1.0 mL, 17.5 mmol) under nitrogen at room temperature. The reaction mixture was stirred at room temperature for 30 min. Then, the reaction mixture was cooled to 0 °C and added to a solution of 2-bromoacetaldehyde (1.0 g, 7.5 mmol) in DCM (10 mL) dropwise. The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with water (20 mL). The crude mixture was extracted with DCM (50 mL*3), the combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo, then purified by flash chromatography (ethyl acetate / hexane = 0-10%) to give 3,4-dihydro-2H-pyran-2-yl acetaldehyde (1.0 g, 7.5 mmol, yield: 75.0%) as a colorless oil. 1 H NMR (400 MHz, CDC13) δ 6.16 (dt, J = 9.3, 5.3 Hz, 1H), 4.03 (dt, J = 4.6, 1.6 Hz, 0.6H), 3.84 - 3.76 (m, 1H), 3.70 (dd, J = 10.0, 4.6 Hz, 2H), 3.58 (dd, J = 5.5, 4.2 Hz, 0.3H), 2.92 - 2.68 (m, 2H), 2.28 - 2.24 (m, 1H), 1.97 - 1.86 (m, 1H).

[0483] Step 2: To a mixture solution of 5-bromo-2,3,4,7-tetrahydrooxepine and 4-bromo- 2,3,6,7-tetrahydrooxepine (150 mg, 0.847 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5- tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2-dioxaborolane (322.74 mg, 1.271 mmol) and [l,l'-bis(diphenylphosphino)ferrocene]dichloropalladium(ll) (61.49 mg, 0.085 mmol) in dioxane (10 mL) was added KOAc (166.31 mg, 1.695 mmol). The reaction mixture was stirred at 80 °C for 10 h under nitrogen. The mixture was concentrated under vacuum. Then purified by flash chromatography (ethyl acetate / hexanes = 0-3%) to give a mixture of 4,4,5,5-tetramethyl-2-(2,5,6,7- tetrahydrooxepin-4-yl)-l,3,2-dioxaborolane; 4,4,5,5-tetramethyl-2-(2,3,6,7- tetrahydrooxepin-4-yl)-l,3,2-dioxolane (160 mg, 0.714 mmol, 84.3% yield). MS (ESI) m / z = 225.3 [M+H] + .

[0484] Step 3: To a solution of 4,4,5,5-tetramethyl-2-(2,3,6,7-tetrahydrooxepan-4-yl)-1,3,2- dioxaborinane and 4,4,5,5-5-tetramethyl-2-(2,5,6,7-tetrahydrooxepan-4-yl)-1,3,4- dioxolane (160 mg, 0.714 mmol), 4-{2-bromo-5-ethyl-7-oxo-4H-[1,2,4]triazolo[1,5- a]pyrimidin-6-yl}piperazine-1-carboxylic acid tert-butyl ester (152.61 mg, 0.357 mmol) and sodium carbonate (151.41 mg, 1.429 mmol) in dioxane (6 mL) / pure water (1 mL) was added Pd(dppf)Cl2(0.5 mg, 0.0714 mmol). The reaction mixture was stirred at 100 °C under nitrogen for 16 h. The mixture was concentrated in vacuo and purified by flash chromatography (MeOH / DCM = 0-5%) to give 4-(5-ethyl-7-oxo-2-(2,5,6,7-tetrahydrooxepan-4-yl)-4,7-dihydro- [1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylic acid tert-butyl ester and 4-(5- ethyl-7-oxo-2-(2,3,6,7-tetrahydrooxepan-4-yl)-4.7-dihydro-[1,2,4-triazolo[1,5-a]pyrimidin- 6-yl)piperazine-1-carboxylic acid tert-butyl ester (120 mg, 0.270 mmol, yield: 37.8%) as yellow oil. MS (ESI) m / z = 445.3 [M+H] + .

[0485] Step 4: To a solution of 4-[5-ethyl-7-oxo-2-(2,3,6,7-tetrahydrooxepin-4-yl)-4H- [1,2,4]triazolo[1,5-a]pyrimidin-6-yl]piperazine-1-carboxylic acid tert-butyl ester and 4-[5- ethyl-7-oxo-2-DIPEA (104.65 mg, 0.810 mmol) in DCM (3 mL) was added HC1 in 1,4- dioxane (4 N, 1 mL). The reaction mixture was stirred at 25 °C for 16 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered, concentrated in vacuo and purified by flash chromatography (ethyl acetate / hexane = 50-80%) to give 4-(4-(2-(2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-2-(2,5,6,7-tetrahydrooxepin-4-yl)- 4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylic acid tert-butyl ester and 4-(4-)-5-ethyl-7-oxo-2-(2,3,6,7-tetrahydrooxepin-4-yl)-4,7-dihydro- [1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylic acid salt (30 mg, 0.044 mmol, yield: 16.3%). MS (ESI) m / z = 680.2 [M+H] + .

[0486] Step 5: To a solution of 4-[4-({[2-chloro-4-(trifluoromethyl)phenyl]carbamoyl}methyl)-5- ethyl-7-oxo-2-(2,3,6,7-tetrahydrooxepin-4-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl]piperazine-1- carboxylic acid tert-butyl ester and 4-[4-({[2-chloro-4-(trifluoromethyl)phenyl]carbamoyl}methyl)- 5-ethyl-7-oxo-2- in DCM (3 mL) was added HC1 in 1,4-dioxane (4 N, 1 mL). The reaction mixture was stirred at 25 °C for 3 h. The mixture was concentrated in vacuo to give a mixture of N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-1-yl)-2-(2,5,6,7-tetrahydrooxepin-4-yl)- [1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide and N-(2-fluoro-4- (trifluoromethyl)phenylpyrimidin-4(7H)-yl)acetamide (35 mg, 0.042 mmol, yield: 95.7%). MS (ESI) m / z = 580.3 [M+H] + .

[0487] Step 6: To a solution of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (11.15 mg, 0.072 mmol) in DCM (4 mL) was added (1-chloro-2-methylprop-1-en-1-yl)dimethylamine (12.09 mg, 0.0904 mmol). The mixture was stirred at room temperature for 30 minutes. Then N-[2-chloro-4-(trifluoromethyl)phenyl]-2-[5-ethyl-7-oxo-6-(piperazin-1-yl)-2-(2,3,6,7- tetrahydropyran-4-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4-yl]acetamide and N-[2-fluoro-4- (trifluoromethyl)phenyl]-2-[5-ethyl-7-keto-6-(piperazin 1-yl)-2-temperature was kept at room temperature for 30 minutes. Then a solution of DIPEA (23.38 mg, 0.181 mmol) in DCM (1 mL) was added dropwise and the mixture was stirred at room temperature for 1 hour. The mixture was diluted with water (10 mL) and extracted with DCM (10 mL*3). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate, then concentrated under vacuum, purified by flash chromatography (MeOH / DCM = 0-2%) and preparative HPLC (Gemini-C18 150*21.2 mm 5um: ACN-H2O (0.1% FA): 55-85) to give a mixture of N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carboxyl)piperazin-1-yl)-7-oxo-2-(2,3,6,7-tetrahydropyran-4-yl)-[1,2,4]triazolo[1,5-a]pyrimidin- 4(7H)-yl)acetamide and N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carboxyl)piperazin-1-yl)-7-oxo-2-(2,5,6,7-tetrahydropyran-4-yl)- [1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (11.7 mg, 0.016 mmol, 27.0% yield). 1H NMR (400 MHz, CD3OD) δ 8.49 (s, 1H), 8.13 (d, J = 7.8 Hz, 1H), 7.79 (s, 1H), 7.59 (d, J = 6.7 Hz, 1H), 7.23 (d, J = 5.3 Hz, 0.6H), 7.00 (s, 0.2H), 5.35 (s, 2H), 4.67 (d, J = 11.4 Hz, 1H), 4.30 (s, 0.4H), 4.03 (d, J = 9.0 Hz, 1H), 3.88 (t, J = 5.0 Hz, 0.4H), 3.71 (d, J = 17.5 Hz, 4.5H), 3.41 (t, J = 12.0 Hz, 1H), 3.16 - 2.82 (m, 6H), 2.75 (d, J = 8.9 Hz, 1H), 2.51 (s, 1H), 2.48 (s, 3H), 2.04 - 1.85 (m, 0.8H), 1.57 (s, 0.2H), 1.28 (s, 2H), 1.27 (d, J = 6.5 Hz, 3H). MS (ESI) m / z = 716.3 [M+H] + .

[0488] Example 11: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-2-(spiro[2.5]oct-5-en-6-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0489]

[0490] Step 1: To a solution of tert-butyl 4-(2-bromo-4-(2-((2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (480 mg, 0.72 mmol) in DCM (5 mL) was added HC1 / dioxane (2 mL) and stirred at room temperature for 1 hour. Then concentrated under vacuum to give the crude 2-(2-bromo-5- ethyl-7-oxo-6-(piperazin-l-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (450 mg, crude) as solid. MS (ESI) m / z = 562.0 [M+H] + .

[0491] Step 2: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (248 mg, 1.6 mmol), HOAt (163 mg, 1.2 mmol) and EDCI (229 mg, 1.2 mmol) in ACN (10 mL) was stirred at room temperature under argon for 1 h, then 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (450 mg, 0.8 mmol) and DIEA (310 mg, 2.4 mmol) in ACN (5 mL) was added and the mixture was stirred at room temperature for 1 h. The mixture was concentrated and purified by flash chromatography (methanol / DCM = 0-10%) to give the product 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (360 mg, 0.51 mmol, 64.4% yield) as a white solid. MS (ESI) m / z = 698.0 / 700.0 [M] + / [M+2] + .

[0492] Step 3: A mixture of 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (90 mg, 0.13 mmol), 4,4,5,5-tetramethyl-2-{spiro[2.5]oct-5- en-6-yl}-l,3,2-dioxaborolane (45 mg, 0.19 mmol), Pd(dppf)Cl2(9 mg, 0.013 mmol) and sodium carbonate (41 mg, 0.39 mmol) in dioxane / water = 10: 1 (4 mL) was stirred at 90 °C under nitrogen overnight. The mixture was then concentrated under vacuum to give the crude product which was purified by preparative HPLC (HPLC (mobile phase: ACN-H20 (0.1% FA), 45 / 55-85 / 15) to give compound N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-2-(spiro[2.5]oct-5-en-6-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (18 mg, 0.025 mmol, 19.2% yield) as a white solid. 1H NMR (400 MHz, CD3OD) δ 8.59 (s, 1H), 8.18 (d, J = 8.6 Hz, 1H), 7.82 (s, 1H), 7.63 (d, J = 7.3 Hz, 1H), 7.04 (s, 1H), 5.40 (s, 2H), 4.72 (d, J = 12.3 Hz, 1H), 4.12 (d, J = 12.7 Hz, 1H), 3.76 (t, J = 11.5 Hz, 2H), 3.51 - 3.39 (m, 1H), 3.22 - 3.05 (m, 3H), 2.95 (d, J = 11.4 Hz, 1H), 2.80 (d, J = 11.0 Hz, 1H), 2.64 (s, 2H), 2.55 (s, 3H), 2.14 (s, 2H), 1.56 (t, J = 6.1 Hz, 2H), 1.33 (t, J = 7.5 Hz, 3H), 0.44 - 0.34 (m, 4H). MS (ESI) m / z = 726.2 [M+H] + .

[0493] Example 12: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-2-(2-oxaspiro[3.5]non-6-en-7-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0494]

[0495] Step 1: To a solution of 2-oxaspiro[3.5]nonan-7-one (200 mg, 1.42 mmol) and phenyl [(trifluoromethane)sulfonyloxy]aminotrifluoromethanesulfonate (555 mg, 1.42 mmol) in THF (5 mL) was added LDA (1.5 mL, 3 mmol) at -78 °C. The mixture was stirred at room temperature under argon for 16 h, then concentrated under vacuum to give a crude product, which was purified by flash chromatography (ethyl acetate / hexanes: 0-5%) to give compound 2-oxaspiro[3.5]non-6-en-7-yl trifluoromethanesulfonate (200 mg, 0.73 mmol, yield: 51.7%) as a yellow oil. 1 H NMR NMR (400 MHz, CDCl3) δ 5.70-5.65 (m, 1H), 4.47 (d, J = 6.0 Hz, 2H), 4.43 (d, J = 6.0 Hz, 2H), 2.55-2.50 (m, 2H), 2.39 (dtd, J = 6.4, 4.0, 2.0 Hz, 2H), 2.10-2.05 (m, 2H).

[0496] Step 2: A mixture of 2-oxaspiro[3.5]non-6-ene-7-yl trifluoromethanesulfonate (200 mg, 0.73 mmol), 4,4,5,5-tetramethyl-2-(4,4,4,5,5-4-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2- dioxaborolane (205 mg, 0.8 mmol), Pd(dppf)Cl2(52 mg, 0.07 mmol) and KOAc (144 mg, 1.46 mmol) in dioxane (5 mL) was stirred at 80 °C for 16 h under argon, then concentrated in vacuo to give a crude product, which was purified by flash chromatography (ethyl acetate / hexanes: 0~5%) to give compound 4,4,4,,55- tetraoxaborolan-2-(2-oxaspiro[3.5]non-6-ene-7-yl)-l,3,2-dioxaborolane (100 mg, 0.4 mmol, 54.7% yield) as a light yellow solid. 1 H NMR (400 MHz, CDC13) δ 6.45 (d, J = 1.8 Hz, 1H), 4.40 (dd, J = 19.2, 5.7 Hz, 4H), 2.45-2.40 (m, 2H), 2.18 (d, J = 2.3 Hz, 2H), 1.85 (t, J = 6.3 Hz, 2H), 1.24 (s, 12H).

[0497] Step 3: A mixture of 4,4,5,5-tetramethyl-2-(2-oxaspiro[3.5]non-6-ene-7-yl)-l,3,2- dioxaborolane (60 mg, 0.24 mmol), tert-butyl 4-{2-bromo-5-ethyl-7-oxo-4H- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl}piperazine-l-carboxylate (68 mg, 0.16 mmol), X-Phos Pd G2 (12 mg, 0.016 mmol) and potassium phosphate (101 mg, 0.48 mmol) in DMF (5 mL) and pure water (0.5 mL) was stirred at 110 °C for 16 h under argon. The mixture was quenched with ice water (20 mL), extracted with ethyl acetate (10 mL*3). The organic layers were combined, washed with brine (30 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give a crude product, which was purified by flash chromatography (methanol / DCM: 0~10%) to give compound tert-butyl 4-(5-ethyl-7-oxo-2-(2-oxaspiro[3.5]non-6-ene-7-yl)-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (30 mg, 0.06 mmol, 39.8% yield) as a yellow oil. MS (ESI) m / z = 471.4 [M+H] + .

[0498] Step 4: A mixture of 4-(5-ethyl-7-oxo-2-(2-oxaspiro[3.5]non-6-en-7-yl)-4,7- dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylic acid tert-butyl ester (30 mg, 0.06 mmol), 2-bromo-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (23 mg, 0.07 mmol) and DIPEA (23 mg, 0.18 mmol) in DMF (3 mL) was stirred at room temperature for 6 hours. The mixture was quenched with ice water (20 mL), extracted with ethyl acetate (10 mL*3). The organic layers were combined, washed with brine (30 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuum to give the crude product which was purified by flash chromatography (methanol / DCM: 0~10%) to give compound 4-(4-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-5- ethyl-7-oxo-2-(2-oxaspiro[3.5]non-6-en-7-yl)-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin- 6-yl)piperazine-l-carboxylic acid tert-butyl ester (20 mg, 0.03 mmol, yield: 47.2%) as yellow oil. MS (ESI) m / z = 650.3 [M-56+H] + .

[0499] Step 5: To a solution of 4-(4-(2-((2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)- 5-ethyl-7-oxo-2-(2-oxaspiro[3.5]non-6-en-7-yl)-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin- 6-yl)piperazine-l-carboxylic acid tert-butyl ester (20 mg, 0.03 mmol) in DCM (2 mL) was added TFA (1 mL) and stirred at room temperature for 1 hour. The mixture was quenched with sodium bicarbonate, extracted with ethyl acetate (10 mL*3). The organic layers were combined, washed with brine (30 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuum to give the crude product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-l-yl)-2-(2-oxaspiro[3.5]non-6-en-7-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (15 mg, 0.024 mmol, yield: 82.6%) as light yellow solid. MS (ESI) m / z = 606.0 [M+H] + .

[0500] Step 6: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (8 mg, 0.048 mmol), HOAt (5 mg, 0.036 mmol) and EDCI (7 mg, 0.036 mol) in ACN (5 mL) was stirred at room temperature under argon for 1 h, then N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-1-yl)-2-(2-oxaspiro[3.5]non-6-en-7-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (15 mg, 0.024 mmol) and DIEA (10 mg, 0.07 mmol) in ACN (3 mL) was added, the mixture was stirred at room temperature for 1 h. The mixture was concentrated and purified by flash chromatography (methanol / DCM = 0-2%) and preparative HPLC (Gemini-C18 150 x 21.2 mm 5um: ACN-H2O (0.1% FA): 55-85) to give the product N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-7-oxo-2-(2-oxaspiro[3.5]non-6-en-7-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (6.4 mg, 0.008 mmol, 35.9% yield) as a white solid. 1 H NMR (400 MHz, CD3OD) δ 8.46 (s, 1H), 8.05 (d, J = 8.5 Hz, 1H), 7.71 (s, 1H), 7.51 (d, J = 7.3 Hz, 1H), 6.82 (s, 1H), 5.27 (s, 2H), 4.60 (d, J = 12.4 Hz, 1H), 4.42 (d, J = 5.8 Hz, 2H), 4.33 (d, J = 5.8 Hz, 2H), 4.00 (d, J = 12.4 Hz, 1H), 3.63 (s, 2H), 3.33 (t, J = 11.5 Hz, 1H), 3.20-3.10 (m, 3H), 2.82 (d, J = 10.5 Hz, 1H), 2.68 (d, J = 10.5 Hz, 1H), 2.51 (d, J = 11.3 Hz, 4H), 2.42 (s, 3H), 1.95 (t, J = 6.2 Hz, 2H), 1.20 (t, J = 7.4 Hz, 3H). MS (ESI) m / z = 742.3 [M+H] + .

[0501] Example 14: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-cyclopropyl-5-ethyl-6-(4-(5- hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5- a]pyrimidin-4(7H)-yl)acetamide

[0502]

[0503] Step 1: A mixture of cyclopropanecarboxylic acid (2.5 g, 29 mmol), aminoguanidine bicarbonate (3.95 g, 29 mmol) in toluene (40 mL) was stirred at 110 °C for 16 hours under a dean-stark apparatus. The mixture was concentrated and flash purified (MeOH:DCM = 0-10%) to give the product 5-cyclopropyl-2H-l,2,4-triazol-3-amine (0.44 g, 2.8 mmol, yield: 9.66%) as an oil. 1 H NMR (400 MHz, DMSO-d6) δ 11.82 (s, 1H), 5.51 (s, 2H), 1.77-1.70 (m, 1H), 0.82-0.76 (m, 4H).

[0504] Steps 2 and 3: To a solution of 5-cyclopropyl-2H-l,2,4-triazol-3-amine (150 mg, 1.2 mmol) in ethanol (5 mL) was added tert-butyl 4-(l-ethoxy-l,3-diketopentan-2-yl)piperazine-l- carboxylate (397 mg, 1.2 mmol) and phosphoric acid (355 mg, 3.6 mmol). The reaction mixture was stirred at 80 °C for 72 hours under nitrogen. To the mixture was then added saturated sodium carbonate and Boc20 (1.3 g, 6.0 mmol) to pH = 10. The mixture was stirred at 25 °C for 3 hours. The mixture was concentrated under vacuum and purified by flash chromatography (MeOH:DCM = 0-3%) to give the product tert-butyl 4-{2-cyclopropyl-5-ethyl-7-oxo-4H- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl}piperazine-l-carboxylate (50 mg, 0.12 mmol, yield: 10.1%) as a colorless oil. MS (ESI) m / z = 389.1 [M+H] + .

[0505] Step 4: To a solution of tert-butyl 4-{2-cyclopropyl-5-ethyl-7-oxo-4H- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl}piperazine-l-carboxylate (50 mg, 0.13 mmol) in DMF (4 mL) was added 2-bromo-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (49 mg, 0.15 mmol) and DIPEA (50 mg, 0.39 mmol). The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and concentrated in vacuum, purified by flash chromatography (MeOH-DCM=0~3%) to give the product tert-butyl 4-[4-({[2-chloro-4- (trifluoromethyl)phenyl]carbamoyl}methyl)-2-cyclopropyl-5-ethyl-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl]piperazine-l-carboxylate (50 mg, 0.064 mmol, yield: 49.8%) as a yellow solid. MS (ESI) m / z = 624.0 [M+H] + .

[0506] Step 5: tert-Butyl 4-[4-({[2-chloro-4-(trifluoromethyl)phenyl]carbamoyl}methyl)-2- cyclopropyl-5-ethyl-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl]piperazine-l-carboxylate (50 mg, 0.08 mmol) in HC1 / dioxane (1 mL) and DCM (1 mL) was added acetic amide (40 mg, crude). MS (ESI) m / z = 524.0 [M+H] + .

[0507] Step 6: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (18 mg, 0.11 mmol), HOAt (10 mg, 0.076 mmol) and EDCI (22 mg, 0.11 mmol) was stirred in ACN at 25 °C for 1 h, then N-[2-chloro-4-(trifluoromethyl)phenyl]-2-[2-cyclopropyl-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4-yl]acetamide (40 mg, 0.076 mmol) and DIEA (49 mg, 0.38 mmol) were added and further stirred for 15 h. The mixture was concentrated and purified by prep-HPLC (Gemini-C18 150*21.2 mm, 5 um: ACN-H20 (0.1% FA): 45-75) to give the product N-[2-chloro-4-(trifluoromethyl)phenyl]-2-(2-cyclopropyl-5-ethyl-6-{4-[(5-hydroxy-6- methylpyrimidin-4-yl)carbonyl]piperazin-l-yl}-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4- yl]acetamide (6.0 mg, 0.009 mmol, yield: 11.8%) as a white solid. 1 H NMR (400 MHz, CD3OD) δ 8.51 (s, 1H), 8.13 (d, J = 8.5 Hz, 1H), 7.81 (d, J = 1.1 Hz, 1H), 7.61 (d, J = 8.7 Hz, 1H), 5.31 (s, 2H), 4.69 (d, J = 12.4 Hz, 1H), 4.13 - 3.94 (m, 1H), 3.78 - 3.62 (m, 2H), 3.52 - 3.36 (m, 1H), 3.15 - 2.92 (m, 3H), 2.95 - 2.72 (m, 2H), 2.50 (s, 3H), 2.09 - 2.02 (m, 1H), 1.33 - 1.17 (m, 5H), 1.03 - 0.98 (m, 2H). MS (ESI) m / z = 660.2 [M+H] + .

[0508] The following compounds were synthesized using methods analogous to the procedures described above or referenced, starting materials being either commercially available or internally prepared.

[0509]

[0510]

[0511]

[0512]

[0513]

[0514]

[0515] Example 200: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-1-yl)-7-oxo-2-(pyrazolo[1,5-a]pyridine-5-yl)- [1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide

[0516]

[0517] Step 1 : A mixture of 5-bromopyrazolo[1,5-a]pyridine (200 mg, 1 mmol), (BPin)2(309 mg, 1.22 mmol), KOAc (299 mg, 3.04 mmol) and Pd(dppf)Cl2(74 mg, 0.1 mmol) in dioxane (5 mL) was stirred at 90 °C for 16 h under nitrogen atmosphere. The mixture was concentrated under vacuum and purified by flash chromatography to give the product 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazolo[1,5-a]pyridine (100 mg, 0.41 mmol, 41 % yield) as yellow oil. MS (ESI) m / z = 245.2 [M+H] + .

[0518] Step 2: A mixture of 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carbonyl)piperazin-1-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (70 mg, 0.1 mmol), 5-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)pyrazolo[1,5-a]pyridine (37 mg, 0.15 mmol), Pd(PPh3)4(12 mg, 0.01 mmol) and sodium carbonate (32 mg, 0.3 mmol) in dioxane (5 mL) and pure water (0.5 mL) was stirred at 90 °C for 16 h under nitrogen atmosphere. The mixture was concentrated under vacuum, purified by flash chromatography (DCM / MeOH = 0-3%) then prep-HPLC to give the product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-7-oxo-2-(pyrazolo[1,5-a]pyridine-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)- yl)acetamide (8.3 mg, 0.011 mmol, 11.2% yield) as white solid.1 H NMR (400 MHz, CD3OD) δ 8.58 (d, J = 7.4 Hz, 1H), 8.55-8.45 (m, 2H), 8.40 (s, 1H), 8.15 (d, J = 8.3 Hz, 1H), 7.97 (d, J = 2.1 Hz, 1H), 7.81 (s, 1H), 7.65-7.55 (m, 2H), 6.73 (s, 1H), 5.46 (s, 2H), 4.71 (d, J = 11.6 Hz, 1H), 4.08 (d, J = 15.0 Hz, 1H), 3.80-3.70 (m, 2H), 3.43 (d, J = 11.6 Hz, 1H), 3.12 (d, J = 7.5 Hz, 3H), 2.95 (d, J = 9.6 Hz, 1H), 2.80 (d, J = 11.1 Hz, 1H), 2.49 (s, 3H), 1.40-1.30 (m, 3H). MS (ESI) m / z = 736.2 [M+H] + .

[0519] Example 201 and Example 202: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5- ethyl-6-((lS,6S)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5- diazabicyclo[4.2.0]oct-2-yl)-7-oxo-2-(pyrazolo[l,5-a]pyridine-5-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide and N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-((lR,6R)-5-(5-hydroxy-6- methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-2- (pyrazolo[l,5-a]pyridine-5-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)- yl)acetamide

[0520]

[0521] Step 1: A mixture of 2-bromo-3-oxopentanoic acid ethyl ester (800 mg, 3.60 mmol), 2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (761 mg, 3.58 mmol) and potassium carbonate (1.48 g, 10.75 mmol) in acetonitrile (20 mL) was stirred at 50 °C for 2 h. The mixture was filtered, the filter cake was washed with acetonitrile. The filtrate was concentrated under vacuum and purified by flash chromatography (PE / EtOAc = 0-5%) to give the product 5-(1-ethoxy-1,3-diketopentan-2-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (1 g, 2.82 mmol, 78% yield) as yellow oil. MS (ESI) m / z = 355.1 [M+H] + .

[0522] Step 2 & Step 3: To a solution of 5-(1-ethoxy-1,3-dioxopentan-2-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (500 mg, 1.41 mmol) in ethanol (10 mL) was added 5-bromo-4H-1,2,4-triazol-3-amine (344 mg, 2.11 mmol) and phosphoric acid (1.38 g, 14.1 mmol). The reaction mixture was stirred at 85 °C under nitrogen protection for 48 h at room temperature. Then to the mixture was added saturated sodium carbonate to pH = 10 and Boc20 (1.54 g, 7.05 mmol). The mixture was stirred at 25 °C for 2 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated under vacuum and purified by flash chromatography (MeOH / DCM = 0-3%) to give the product 5-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (157 mg, 0.34 mmol, 25% yield) as yellow solid. MS (ESI) m / z = 453.0, 455.0 [M+H] + .

[0523] Step 4: To a solution of 5-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5- a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (157 mg, 0.34 mmol) in MeCN (10 mL) was added 2-bromo-N-[2-chloro-4- (trifluoromethyl)phenyl]acetamide (164 mg, 0.51 mmol) and DIPEA (137 mg, 1.03 mmol). The mixture was stirred at 25 °C for 16 h. The mixture was concentrated under vacuum and purified by flash chromatography (PE / EtOAc = 0-45%) to give the product 5-(2-bromo-4-(2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5- a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (130 mg, 0.188 mmol, 55% yield). MS (ESI) m / z = 632.0, 633.9 [M+H-56] + .

[0524] Step 5: To a solution of 5-(2-bromo-4-(2-(2-chloro-4-(trifluoromethyl)phenyl)amino)- 2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)-2,5- diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (130 mg, 0.1887 mmol) in DCM (5 mL) was added HCl in dioxane (2 mL, 4 M). The mixture was stirred at room temperature for 1 h. The mixture was concentrated under vacuum to give the crude product trans-2-(6-(2,5-diazabicyclo[4.2.0]octan-2-yl)-2-bromo-5-ethyl-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (110 mg, 0.187 mmol, 99% yield) as a white solid. MS (ESI) m / z = 587.9, 590.0 [M+H] + .

[0525] Step 6: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (54 mg, 0.35 mmol), HOAt (60 mg, 0.44 mmol) and EDCI (84 mg, 0.43 mmol) in MeCN (80 mL) was stirred at room temperature under argon for 1 h, then trans-2-(6-(2,5-diazabicyclo[4.2.0]oct-2-yl)-2-bromo-5-ethyl-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (110 mg, 0.187 mmol) and DIEA (136 mg, 1.05 mmol) were added in MeCN (20 mL), the mixture was stirred at room temperature for 1 h. The mixture was concentrated to remove MeCN, diluted with water (20 ml), extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum, purified by flash chromatography (MeOH DCM = 0-3%) to give the product trans-2-(2-bromo-5-ethyl-6-(5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5- diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (90 mg, 0.124 mmol, 66.3% yield). MS (ESI) m / z = 723.8, 725.9 [M+H] +

[0526] Step 7: A mixture of trans-2-(2-bromo-5-ethyl-6-(5-(5-hydroxy-6-methylpyrimidine-4- carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)- yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (90 mg, 0.124 mmol), 5-(4,4,5,5- tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazolo[1,5-a]pyridine (45.48 mg, 0.1863 mmol), Pd(PPh3)4 (14.35 mg, 0.0124 mmol) under Ar2atmosphere, a solution of sodium carbonate (39.49 mg, 0.37 mmol) in dioxane (10 mL) and pure water (1 mL) was stirred at 90 °C for 16 h. The mixture was concentrated under vacuum and purified by Prep HPLC to give the racemic product. The product was purified by SFC (separation condition: apparatus: SFC-Thar-prep 80, column: CHIRALPAK AD-H 250 mm 20 mm, 5 μm, modifier: 40% isopropyl alcohol (NH4OH 0.2%): 60% carbon dioxide, total flow: 40 g / min) to give N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-(1S,6S)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)- 2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-2-(pyrazolo[1,5-a]pyridin-5-yl)-[1,2,4]triazolo[1,5- a]pyrimidin-4(7H)-yl)acetamide and N-(2-fluoro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6- ((1R,6R)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7- oxo-2-(pyrazolo[1,5-a]pyridin-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide as white solid.

[0527] First peak SFC (Rt = 2.46 min, 17.3 mg, 0.022 mmol, 18% yield):

[0528] 1H NMR (400 MHz, CD3OD) δ 8.64 (d, J = 7.1 Hz, 1H), 8.52 (s, 2H), 8.20 (d, J = 8.7 Hz, 1H), 8.02 (d, J = 2.1 Hz, 1H), 7.85 (s, 1H), 7.65 (dd, J = 17.0, 7.9 Hz, 2H), 6.78 (s, 1H), 5.50 (s, 2H), 4.69 (s, 1H), 3.93 (s, 1H), 3.79 - 3.43 (m, 4H), 3.28 - 3.20 (m, 1H), 3.16 - 3.06 (m, 1H), 2.52 (s, 3H), 1.90 - 1.49 (m, 4H), 1.37 (t, J = 7.5 Hz, 3H). MS (ESI) m / z = 762.1, 764.2 [M+H] + .

[0529] Second peak SFC (Rt = 6.65 min, 11.3 mg, 0.0145 mmol, 11% yield):

[0530] 1 H NMR (400 MHz, CD3OD) δ 8.64 (d, J = 7.1 Hz, 1H), 8.52 (s, 2H), 8.20 (d, J = 8.7 Hz, 1H), 8.02 (d, J = 2.1 Hz, 1H), 7.85 (s, 1H), 7.65 (dd, J = 17.0, 7.9 Hz, 2H), 6.78 (s, 1H), 5.50 (s, 2H), 4.69 (s, 1H), 3.93 (s, 1H), 3.79 - 3.43 (m, 4H), 3.28 - 3.20 (m, 1H), 3.16 - 3.06 (m, 1H), 2.52 (s, 3H), 1.90 - 1.49 (m, 4H), 1.37 (t, J = 7.5 Hz, 3H). MS (ESI) m / z = 762.1, 764.2 [M+H] + .

[0531] Example 46 and Example 52: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4- (difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-6-((1S,6S)-5-(5-hydroxy-6-methylpyrimidine- 4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)- yl)acetamide and N-)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0] oct-2-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide

[0532]

[0533] Step 1: A mixture of trans-2-(2-bromo-5-ethyl-6-(5-(5-hydroxy-6-methylpyrimidine-4- carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)- N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (97 mg, 0.1338 mmol), 2-[4- (difluoromethyl)cyclohex-l-en-l-yl]-4,4,5,5-tetramethyl-l,3,2-dioxaborolane (51.4 mg, 0.2 mmol), Pd(dppf)Cl2(9.79 mg, 0.0133 mmol) and sodium carbonate (42.54 mg, 0.4 mmol) in dioxane (10 mL) and pure water (1 mL) was stirred at 90 °C under N2atmosphere for 16 h. The mixture was concentrated under vacuum and purified by prep-HPLC to give white solid trans product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)cyclohex-l-en-l-yl)-5-ethyl-6-(5-(5- hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (25 mg, 0.032 mmol, 24% yield). 1 H NMR (400 MHz, CD3OD) d 8.43 (d, J = 8.3 Hz, 1H), 8.08 (d, J = 8.6 Hz, 1H), 7.74 (d, J = 1.5 Hz, 1H), 7.57 - 7.49 (m, 1H), 6.89 (d, J = 2.1 Hz, 1H), 5.30 (d, J = 1.7 Hz, 2H), 4.58 (s, 1H), 3.79 (s, 1H), 3.52 (dd, J = 65.1, 22.2 Hz, 4H), 3.18 - 3.07 (m, 1H), 2.97 (dd, J = 13.9, 7.3 Hz, 1H), 2.89 (s, 2H), 2.59 (s, 2H), 2.43 (s, 3H), 2.33 (t, J = 6.2 Hz, 2H), 1.64 (d, J = 31.0 Hz, 2H), 1.42 (s, 1H), 1.27 - 1.22 (m, 4H). MS (ESI) m / z = 774.2, 776.3 [M+H] + .

[0534] Step 2: trans-N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-6-(5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (25 mg, 0.032 mmol) was purified by SFC (device: SFC-Thar Prep 80, column: CHIRALPAK AD-H 250 mm*20 mm, 5 pm, modifier: 40% isopropanol (NH4OH 0.2%): 60% carbon dioxide, total flow: 40 g / min) to give N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-6-((1S,6S)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide and N-(2-fluoro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)cyclohex-1-en-1-yl)-5-ethyl-6-((1R,6R)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide.

[0535] First peak SFC (Rt = 3.00 min, 10.7 mg, 0.013 mmol, 43% yield):

[0536] 1 H NMR (400 MHz, CD3OD) δ 8.54 (s, 1H), 8.17 (d, J = 8.6 Hz, 1H), 7.83 (s, 1H), 7.63 (d, J = 8.3 Hz, 1H), 6.98 (s, 1H), 5.39 (s, 2H), 4.67 (s, 1H), 3.90 (s, 1H), 3.70 (d, J = 23.4 Hz, 2H), 3.53 (d, J = 19.1 Hz, 2H), 3.22 (dd, J = 13.8, 7.3 Hz, 1H), 3.07 (dd, J = 13.7, 7.1 Hz, 1H), 2.98 (s, 2H), 2.74 - 2.62 (m, 2H), 2.52 (s, 3H), 2.45 - 2.37 (m, 2H), 1.74 (d, J = 25.4 Hz, 2H), 1.51 (s, 1H), 1.33 (t, J = 7.5 Hz, 4H). MS (ESI) m / z = 774.1, 776.1 [M+H]+ .

[0537] Second peak SFC (Rt = 9.46 min, 5.3 mg, 0.0068 mmol, 21% yield):

[0538] 1 H NMR (400 MHz, CD3OD) δ 8.39 (s, 1H), 8.05 (d, J = 8.6 Hz, 1H), 7.71 (s, 1H), 7.51 (d, J = 8.7 Hz, 1H), 6.86 (s, 1H), 5.27 (s, 2H), 4.55 (s, 1H), 3.77 (d, J = 10.8 Hz, 1H), 3.49 (dd, J = 66.2, 19.4 Hz, 4H), 3.10 (dd, J = 13.9, 7.5 Hz, 1H), 2.95 (dd, J = 13.8, 7.4 Hz, 1H), 2.86 (s, 2H), 2.56 (s, 2H), 2.40 (s, 3H), 2.30 (t, J = 6.1 Hz, 2H), 1.60 (d, J = 32.3 Hz, 2H), 1.39 (s, 1H), 1.23 - 1.18 (m, 4H). MS (ESI) m / z = 774.1, 776.0 [M+H] + .

[0539] Example 45 and Example 51 : N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4- (difluoromethyl)piperidin-l-yl)-5-ethyl-6-((lS,6S)-5-(5-hydroxy-6-methylpyrimidine-4- carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)- yl)acetamide & N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)piperidin- l-yl)-5-ethyl-6-((lR,6R)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5- diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0540]

[0541] Step 1: To a solution of 5-(l-ethoxy-l,3-dioxopentan-2-yl)-2,5-diazabicyclo[4.2.0]octane-2- carboxylic acid trans-tert-butyl ester (66 mg, 0.186 mmol) in ethanol (5 mL) was added 5-[4- (difluoromethyl)piperidin-l-yl]-4H-l,2,4-triazol-3-amine (40 mg, 0.18 mmol) and phosphoric acid (182.48 mg, 1.86 mmol). The reaction mixture was stirred at 85 °C for 48 h under nitrogen protection. Then to the mixture was added saturated sodium carbonate to pH = 10, and to it was added Boc20 (203.19 mg, 0.93 mmol). The resulting mixture was stirred at 25 °C for another 2 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum, and purified by flash chromatography (MeOH / DCM = 0-3%) to give the product 5-(2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans- tert-butyl ester (20 mg, 0.04 mmol, 21% yield) as a yellow solid. MS (ESI) m / z = 506.2 [M+H] + .

[0542] Step 2: To a solution of 5-(2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans- tert-butyl ester (20 mg, 0.04 mmol) in MeCN (10 mL) was added 2-bromo-N-[2-chloro-4- (trifluoromethyl)phenyl]acetamide (18.86 mg, 0.06 mmol) and DIPEA (15.35 mg, 0.11 mmol). The mixture was stirred at 25 °C for 16 h. The mixture was concentrated in vacuum, and the crude residue was purified by flash chromatography (ethyl acetate / hexanes = 0-65%) to give the product 5-(4-(2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo- 4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans-tert-butyl ester (21 mg, 0.028 mmol, 71% yield) as a yellow solid. MS (ESI) m / z = 741.2, 743.0 [M+H] + .

[0543] Step 3: To a solution of 5-(4-(2-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2- oxoethyl)-2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylic acid trans tert-butyl ester (21 mg, 0.0283 mmol) in DCM (5 mL) was added a solution of HC1 in dioxane (2 mL, 4 M). The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under vacuum to give the crude product trans-2-(6-(2,5-diazabicyclo[4.2.0]octan-2-yl)-2-(4- (difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)- N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide as a yellow solid (19 mg, 0.028 mmol, 98% yield). MS (ESI) m / z = 641.0, 643.2 [M+H] + .

[0544] Step 4: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (97.13 mg, 0.63 mmol), HOAt (107.22 mg, 0.78 mmol) and EDCI (151.01 mg, 0.77 mmol) in MeCN (80 mL) was stirred at room temperature under argon for 1 hour, then reagent trans 2-(6-(2,5-diazabicyclo[4.2.0]octan-2-yl)-2-(4- (difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2- chloro-4-(trifluoromethyl)phenyl)acetamide was added to a solution of de (202 mg, 0.31 mmol) and DIEA (407.24 mg, 3.15 mmol) in MeCN (10 mL), the mixture was stirred at room temperature for 1 hour. The mixture was concentrated to remove MeCN, diluted with water (20 mL), extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum, the residue was purified by flash chromatography (MeOH / DCM = 0-3%) to give the trans product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-6-(5-(5-hydroxy-6- methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]octan-2-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide as a yellow solid. 1H NMR (400 MHz, CD3OD) δ 8.51 (d, J = 12.1 Hz, 1H), 8.39 (s, 1H), 8.13 (s, 1H), 7.80 (s, 1H), 7.60 (s, 1H), 5.25 (s, 2H), 3.82 (s, 1H), 3.75 - 3.35 (m, 8H), 3.05 (d, J = 43.6 Hz, 3H), 2.48 (s, 3H), 2.21 (s, 5H), 1.64 (d, J = 48.6 Hz, 2H), 1.45 (d, J = 10.5 Hz, 1H), 1.26 (s, 3H). MS (ESI) m / z = 777.1, 779.2 [M+H] +

[0545] The product was then purified by SFC (separation conditions: apparatus: SFC-Thar-prep 80, column: CHIRALPAK AD-H 250 mm 20 mm, 5 pm, modifier: 40% isopropanol (NH4OH 0.2%): 60% carbon dioxide, total flow: 40 g / min) to give N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-(difluoromethyl)piperidin-l-yl)-5- ethyl-6-((lS,6S)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide and N-(2-fluoro-4-(trifluoromethyl))phenyl)-2-(2-(4- (difluoromethyl)piperidin-l-yl)-5-ethyl-6-((lR,6R)-5-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5- diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide.

[0546] First peak (Rt = 4.08 min, 38.7 mg, 0.05 mmol, 15% yield): 1H NMR (400 MHz, CD3OD) δ 8.51 (s, 1H), 8.12 (d, J = 8.5 Hz, 1H), 7.79 (s, 1H), 7.60 (d, J = 8.7 Hz, 1H), 5.25 (s, 2H), 4.62 (s, 1H), 3.84 (d, J = 7.6 Hz, 1H), 3.73 - 3.34 (m, 8H), 3.17-3.07 (m, 1H), 3.04-2.92 (m, 1H), 2.48 (s, 3H), 2.25-2.16 (m, 4H), 1.68 (d, J = 28.3 Hz, 2H), 1.53 - 1.40 (m, 1H), 1.36-1.22 (m, 4H). MS (ESI) m / z = 777.2, 779.2 [M+H] +

[0547] Second peak (Rt = 15.25 min, 25.1 mg, 0.03 mmol, 10% yield): 1 H NMR (400 MHz, CD3OD) δ 8.48 (s, 1H), 8.12 (d, J = 8.6 Hz, 1H), 7.79 (s, 1H), 7.59 (d, J = 8.8 Hz, 1H), 5.35 - 5.19 (m, 2H), 4.63 (s, 1H), 3.83 (d, J = 7.0 Hz, 1H), 3.74 - 3.35 (m, 8H), 3.11 (dt, J = 14.7, 7.4 Hz, 1H), 2.99 (dd, J = 13.9, 7.3 Hz, 1H), 2.47 (s, 3H), 2.25-2.15 (m, 4H), 1.67 (d, J = 29.0 Hz, 2H), 1.45 (s, 1H), 1.29-1.22 (m, 4H). MS (ESI) m / z = 777.2, 779.2 [M+H] +

[0548] The following compounds were synthesized using methods analogous to the procedures described above or referenced. Starting materials were either commercially available or prepared in-house.

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555]

[0556]

[0557]

[0558]

[0559] Example 273: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5- hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-2-(2-methyl-2H-indazol-5-yl)-7- oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0560]

[0561] To a solution of 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (100 mg, 0.143 mmol), 2-methyl-5-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)-2H-indazole (48 mg, 0.186 mmol) and sodium carbonate (46 mg, 0.429 mmol) in dioxane / pure water (6 mL / 1 mL) was added Pd(dppf)Cl2(11 mg 0.014 mmol). The reaction mixture was stirred at 90 °C under nitrogen for 2 hours. The mixture was concentrated in vacuo and purified by flash chromatography (MeOH / DCM = 0-5%) to give the product N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin- 1-yl)-2-(2-methyl-2H-indazol-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (18.3 mg, 0.024 mmol, 22.8% yield). 1H NMR (400 MHz, DMSO) δ 10.43 (s, 1H), 10.25 (s, 1H), 8.59 (s, 1H), 8.51 (d, J = 7.0 Hz, 2H), 8.08 (d, J = 8.5 Hz, 1H), 7.97 (d, J = 7.0 Hz, 2H), 7.71 (t, J = 8.0 Hz, 2H), 5.42 (s, 2H), 4.55 (d, J = 11.9 Hz, 1H), 4.20 (s, 3H), 3.62 - 3.48 (m, 3H), 3.26 (d, J = 12.1 Hz, 1H), 3.03 (d, J = 7.9 Hz, 3H), 2.85 (d, J = 10.4 Hz, 1H), 2.68 (d, J = 9.1 Hz, 1H), 2.45 (s, 3H), 1.22 (t, J = 7.4 Hz, 3H). MS (ESI) m / z = 749.9 [M+H] + .

[0562] Example 275: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-l-yl)-2-(l-(methyl-d3)-lH-indazol-5-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0563]

[0564] Step 1: To a solution of 5-bromo-lH-indazole (5.0 g, 25.38 mmol) in DMF (50 mL) was added cesium carbonate (16.54 g, 50.76 mmol) at room temperature. After stirring at room temperature for 30 min, 4-(bromomethyl)-3-methoxybenzene (4.41 g, 30.46 mmol) was added to the reaction mixture at room temperature for 12 h. The reaction mixture was quenched by the addition of pure water (200 mL) and extracted with ethyl acetate (100 mL*3). The combined organic layers were washed with brine (50 mL*2), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by column chromatography on gel silica (PE / EtOAc = 4: 1) to give two isomers:

[0565] 5-bromo-l-(methyl-d3)-lH-indazole (3.3 g, 15.4 mmol, 60.7% yield) as an orange solid. 1 H NMR (400 MHz, DMSO-d6) δ 8.04 (s, 1H), 7.99 (s, 1H), 7.64 (d, J = 8.0 Hz, 1H), 7.51 (d, J = 8.0 Hz, 1H). MS (ESI, m / z): [M+H] += 214.0, 216.0.

[0566] 5-Bromo-2-(methyl-d3)-2H-indazole (1.5 g, 7.0 mmol, 27.6% yield) as a yellow solid. 1 HNMR (400 MHz, DMSO-d6) δ 8.34 (s, 1H), 7.96 (s, 1H), 7.58 (d, J = 12.0 Hz, 1H), 7.31 (d, J = 8.0 Hz, 1H). MS (ESI, m / z): [M+H] + = 214.0, 216.0.

[0567] Step 2: To a mixture of 5-bromo-l-(methyl-d3)-H-indazole (1.0 g, 4.67 mmol) in 1,4-dioxane (30.0 mL) was added potassium acetate (1.37 g, 14.01 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(l,3,2-dioxaborolane) (1.30 g, 5.14 mmol) and Pd(dppf)Cl2(190 mg, 0.23 mmol) in portions under nitrogen. The resulting mixture was stirred at 100 °C for 16 h under nitrogen. The solution was concentrated in vacuo and the residue was purified by column chromatography on gel silica (EtOAc / PE = 1-10%) to give l-(methyl-d3)-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-lH-indazole (1.1 g, 4.21 mmol, 90.1% yield) as a yellow solid. MS (ESI, m / z): [M+H] + = 262.1.

[0568] Step 3: 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin- 1-yl)-7-oxo-4H,7H-[1,2,4]triazolo[1,5-a]pyrimidin-4-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (100 mg, 0.14 mmol), 1-(methyl-d3)-5-(4,4,4,5,5- tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-indazole (73 mg, 0.28 mmol), Pd(PPh3)4 (16 mg, 0.014 mmol) and sodium carbonate (45 mg, 0.42 mmol) in dioxane (12 mL) and pure water (1 mL) was stirred at 90 °C under N2for 16 h. The mixture was concentrated in vacuum and purified by prep-HPLC to give N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin- 1-yl)-2-(1-(methyl-d3)-1H-indazol-5-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (18 mg, 0.024 mmol, 16.37% yield) as a white solid. 1 H NMR (400 MHz, CD3OD-d4) δ 8.63 (s, 1H), 8.58 (s, 1H), 8.28 (d, J = 10.4 Hz, 1H), 8.17 (d, J = 8.4 Hz, 1H), 8.09 (s, 1H), 7.82 (s, 1H), 7.59-7.65 (m, 2H), 5.49 (s, 2H), 4.70-4.74 (m, 1H), 4.09-4.13 (m, 1H), 3.74-3.80 (m, 2H), 3.47-3.38 (m, 1H), 3.11–3.16 (m, 3H), 2.95–2.98 (m, 1H), 2.81-2.83 (m, 1H), 2.53 (s, 3H), 1.35 (t, J = 7.5 Hz, 3H). MS (ESI, m / z): [M+H] + = 753.3.

[0569] Example 276: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-1-yl)-2-(2-(methyl-d3)-2H-indazol-5-yl)-7-oxo- [1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide

[0570]

[0571] Step 1: To a mixture of 5-bromo-2-(methyl-d3)-2H-indazole (1.0 g, 4.67 mmol) in 1,4-dioxane (30.0 mL) was added potassium acetate (1.37 g, 14.01 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(l,3,2-dioxaborolane) (1.30 g, 5.14 mmol) and Pd(dppf)Cl2(190 mg, 0.23 mmol) at room temperature under nitrogen. The resulting mixture was stirred at 100 °C for 16 h under nitrogen. The mixture was concentrated in vacuum, the resulting residue was purified by silica gel column chromatography (EtOAc / PE = 1 / 10) to give 2-(methyl-d3)-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-2H-indazole (1.1 g, 4.21 mmol, 90% yield) as a yellow solid. MS (ESI, m / z): [M+H] + = 262.1.

[0572] Step 2: 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (100 mg, 0.14 mmol), 2-(methyl-d3)-5-(4,4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-2H-indazole (73 mg, 0.28 mmol), Pd(PPh3)4(16 mg, 0.014 mmol) and sodium carbonate (45 mg, 0.42 mmol) in dioxane (12 mL) and pure water (1 mL) was stirred at 90 °C under N2for 16 h. The mixture was concentrated in vacuum and purified by prep-HPLC to give N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-2-(2-(methyl-d3)-2H-indazol-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (33 mg, 0.044 mmol, 31.3% yield) as a white solid. 1H NMR (400 MHz, CD3OD-d4) δ 8.61 (s, 1H), 8.58 (s, 1H), 8.2 (s, 1H), 8.13-8.18 (m, 2H), 7.82 (s, 1H), 7.59-7.68 (m, 2H), 5.47 (s, 2H), 4.70-4.74 (m, 1H), 4.09-4.13 (m, 1H), 3.74-3.80 (m, 2H), 3.47-3.38 (m, 1H), 3.11-3.18 (m, 3H), 2.95-2.98 (m, 1H), 2.81-2.83 (m, 1H), 2.53 (s, 3H), 1.34 (t, J = 7.5 Hz, 3H). MS (ESI, m / z): [M+H] + = 753.3.

[0573] Example 277: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(2-(4-cyano-5-methylthiophen-2-yl)-5- ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5- a]pyrimidin-4(7H)-yl)acetamide

[0574]

[0575] Step 1: To a solution of methyl 2-methylthiophene-3-carboxylate (5 g, 32.01 mmol) in DMF (24 mL) was added NBS (5.70 g, 32.01 mmol) at room temperature and stirred for 16 h. LCMS indicated the reaction was complete. The reaction mixture was diluted with water (100 mL) and extracted with PE (50 mL*3). The organic layer was washed with saturated aqueous sodium bicarbonate and brine and dried over anhydrous sodium sulfate. After filtration, the solvent was concentrated under reduced pressure to give compound as yellow oil, to give 5-bromo-2-methylthiophene-3-carboxylate (7.3 g, 31.1 mmol, 97% yield) as yellow oil. MS (ESI, m / z): [M+H] + = 237.0

[0576] Step 2: To a mixture of methyl 5-bromo-2-methylthiophene-3-carboxylate (7.3 g, 31.1 mmol) in THF (50 mL) and water (5 mL) was added lithium hydroxide hydrate (2.61 g, 62.1 mmol) and stirred at room temperature for 16 hours. The mixture was quenched with aqueous HC1 (1 M) and adjusted to pH = 3. The mixture was diluted with ethyl acetate (200 mL) and extracted with water (100 mL*3). The combined organic layers were dried over anhydrous sodium sulfate. After filtration, the filtrate was concentrated under vacuum to give 5-bromo-2-methylthiophene-3-carboxylic acid (6.3 g, 28.6 mmol, 92.2% yield) as a white solid. MS (ESI, m / z): [M+H] + = 221.0.

[0577] Step 3: To a solution of 5-bromo-2-methylthiophene-3-carboxylic acid (6.3 g, 28.5 mmol), HATU (16.2 g, 42.8 mmol) and DIEA (7.37 g, 57 mmol) in DMF (60 mL) was added NH4CI (2.29 g, 42.8 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with water (10 mL) and extracted with ethyl acetate (50 mL*3). The combined organic layers were washed with brine (50 mL*2), dried over anhydrous sodium sulfate and concentrated in vacuum. The crude product was purified by flash silica gel chromatography (EtOAc / PE = 0-10%) to give 5-bromo-2-methylthiophene-3-carboxamide (5 g, 22.7 mmol, 79.72% yield) as a white solid. MS (ESI, m / z): [M+H] + = 220.0.

[0578] Step 4: To a solution of 5-bromo-2-methylthiophene-3-carboxamide (2 g, 9.09 mmol) in THF (30 mL) was added pyridine (2.75 g, 34.81 mmol) and trifluoroacetic anhydride (3.40 g, 16.18 mmol) at 0 °C. The mixture was stirred at room temperature for 24 hours. The mixture was concentrated, diluted with water (100 mL) and extracted with DCM (300 mL*3). The combined organic layers were washed with brine (50 mL*3), dried over anhydrous sodium sulfate and concentrated in vacuum. The crude product was purified by flash silica gel chromatography (EtOAc / PE = 0-10%) to give 5-bromo-2-methylthiophene-3-carbonitrile (1.6 g, 7.9 mmol, 87.13% yield) as a white solid. 1 HNMR (400 MHz, CDCb) d 7.05 (s, 1H), 2.60 (s, 3H).

[0579] Step 5: A mixture of 5-bromo-2-methylthiophene-3-carbonitrile (500 mg, 2.47 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(l,3,2-dioxaborolane) (820 mg, 3.21 mmol), potassium acetate (800 mg, 8.2 mmol) and Pd(dppf)Cl2(130 mg, 0.17 mmol) in anhydrous dioxane (10 mL) was stirred at 100 °C for 16 h under nitrogen. The reaction mixture was concentrated in vacuum and purified by silica gel column chromatography (PE / EtOAc = 4 / 1) to give 2-methyl-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)thiophene-3-carbonitrile (410 g, 1.65 mmol, 66.5% yield) as a white solid. 1 H NMR (400 MHz, CDC13) δ 7.59 (s, 1H), 2.68 (s, 3H), 1.33 (s, 12H).

[0580] Step 6: A mixture of 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (100 mg, 0.14 mmol), 2-methyl-5-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)thiophene-3-carbonitrile (25 mg, 0.21 mmol), Pd(dppf)Cl2(14 mg, 0.014 mmol) and sodium carbonate (44.25 mg, 0.42 mmol) in dioxane (10 mL) and pure water (1 mL) was stirred at 90 °C for 16 h under N2. The mixture was concentrated under vacuum and purified by Prep HPLC eluting with MeCN in pure water (0.1% FA) to give N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(2-(4-cyano-5-methylthiophen-2-yl)-5-ethyl-6-(4-(5-hydroxy-6- methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)- yl)acetamide (22.16 mg, 0.03 mmol, 20.6% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 10.39 (s, 1H), 8.55 (s, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.97 (s, 1H), 7.91 (s, 1H), 7.71 (d, J = 8.7 Hz, 1H), 5.34 (s, 2H), 4.53 (d, J = 11.9 Hz, 1H), 3.50 (d, J = 11.1 Hz, 3H), 3.25 (s, 2H), 3.00 (s, 3H), 2.83 (d, J = 10.3 Hz, 1H), 2.68 (s, 3H), 2.44 (s, 3H), 1.19 (t, J = 7.4 Hz, 3H). MS (ESI, m / z): [M+H] + = 740.8.

[0581] Example 278: 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-7-oxo-2- (pyrazolo[l,5-a]pyridin-5-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide

[0582]

[0583] Step 1: A mixture of 4-chloro-3-methoxypyridine-2-carboxylic acid (100 mg, 0.53 mmol) and aqueous hydrogen chloride (1 mL) was stirred at 100 °C for 16 hours. The resulting mixture was concentrated under vacuum to give 4-chloro-3-hydroxypyridine carboxylic acid (88 mg, 0.50 mmol, 95.6% yield) as a white solid. The crude product was used directly in the next step without further purification. MS (ESI, m / z): [M+H] + = 173.5

[0584] Step 2: A mixture of 4-chloro-3-hydroxypyridine carboxylic acid (88 mg, 0.51 mmol), HOAt (69 mg, 0.51 mmol) and EDCI (98 mg, 0.51 ml) in ACN (40 mL) was stirred at room temperature under N2for 1 h, then N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-1-yl)-2-(pyrazolo[1,5- a]pyridine-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (100 mg, 0.17 mmol) and DIEA (0.17 mL, 1.02 mmol) (10 mL) was stirred at room temperature for 12 h. The mixture was concentrated, diluted with water (10 mL), extracted with ethyl acetate (10 mL*3). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate. The mixture was concentrated in vacuum and purified by prep-HPLC eluted with MeCN in pure water (0.1% FA) to give 2-(6-(4-(4-chloro-3-hydroxypyridyl)piperazin-1-yl)-5-ethyl-7-oxo-2-(pyrazolo[1,5- a]pyridine-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (19.3 mg, 0.025 mmol, 15.3% yield) as a white solid. 1 H NMR (400 MHz, DMSO-d6) d 10.44 (s, 1H), 8.80 (d, J = 7.3 Hz, 1H), 8.43 (s, 1H), 8.12 - 8.05 (m, 2H), 8.04 - 7.95 (m, 2H), 7.75 - 7.68 (m, 1H), 7.56 - 7.47 (m, 2H), 6.82 (d, J = 1.7 Hz, 1H), 5.42 (s, 2H), 4.57 (d, J = 11.6 Hz, 1H), 3.57 (dd, J = 30.4, 11.7 Hz, 3H), 3.28 - 3.23 (m, 1H), 3.04 (d, J = 7.5 Hz, 3H), 2.91 - 2.81 (m, 1H), 2.74 - 2.64 (m, 1H), 1.20 (dt, J = 19.3, 7.2 Hz, 4H). MS (ESI, m / z): [M+H] + = 755.3.

[0585] Example 279a and 279b: (S)-N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5- hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-2-(4-(methylsulfinyl)phenyl)-7- oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide and (R)-N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin- 1-yl)-2-(4-(methylsulfinyl)phenyl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide

[0586]

[0587] Step 1: Isolate 4,4,5,5-tetramethyl-2-(4-(methylsulfinyl)phenyl)-1,3,2-dioxaborolane (300 mg, 1.13 mmol) by chiral SFC (Column: Chiralpak® IA 10% IPA DEA C1 WHELK) to give (S)-4,4,5,5-tetramethyl-2- as a white solid.

[0588] Compound Peak 1: (Rt = 2.204 min, 130 mg, 0.49 mmol) (S)-4,4,5,5-tetramethyl-2-(4- (methylsulfinyl)phenyl)-1,3,2-dioxaborolane or (R)-4,4,5-5-tetramethyl-2-(4- (methylsulfinyl)phenyl)-1,3,2-dioxaborolane. MS (ESI, m / z): [M+H] + = 267.2.

[0589] Compound Peak 2: (Rt = 2.816 min, 130 mg, 0.49 mmol) (R)-4,4,5,5-tetramethyl-2-(4- (methylsulfinyl)phenyl)-1,3,2-dioxaborolane or (S)-4,4,5-5-tetramethyl-2-(4- (methylsulfinyl)phenyl)-1,3,2-dioxaborolane. MS (ESI, m / z): [M+H] + = 267.2.

[0590] Step 2: 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin- 1-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (60 mg, 0.086 mmol), mixture of (S)-4,4,5,5- tetramethyl-2-(4-(methylsulfanyl)phenyl)-1,3,2-dioxaborolane or (R)-4,4,5,5- tetramethyl-2-(4-(methylsulfinyl)phenyl)-1,3,2-dioxaborolane (23 mg, 0.086 mmol), Pd(dppf)Cl2(6 mg, 0.009 mmol) and potassium carbonate (36 mg, 0.260 mmol) in dioxane (10 mL) and pure water (1 mL) was stirred at 85 °C under nitrogen for 16 h. The mixture was filtered, concentrated in vacuo, purified with Prep HPLC eluted with MeCN in pure water (0.1% FA) to give (S)-N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-2-(4-(methylsulfanyl)phenyl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide or (R)-N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-2-(4-(methylsulfinyl)phenyl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide as a white solid.

[0591] Example 27 9a (12.77 mg, 0.017 mmol, 19.6% yield) was synthesized from the compound of peak 1 using the procedure described above. 1 H NMR (400 MHz, MeOD-d4) δ 8.57 (s, 1H), 8.46 - 8.37 (m, 2H), 8.16 (d, J = 8.5 Hz, 1H), 7.89 - 7.77 (m, 3H), 7.61 (dd, J = 8.6, 1.6 Hz, 1H), 5.48 (s, 2H), 4.72 (d, J = 12.6 Hz, 1H), 4.11 (d, J = 12.6 Hz, 1H), 3.75 (d, J = 11.5 Hz, 2H), 3.52 - 3.40 (m, 1H), 3.14 (dd, J = 6.8, 5.1 Hz, 3H), 2.97 (d, J = 11.1 Hz, 1H), 2.82 (d, J = 13.8 Hz, 4H), 2.53 (s, 3H), 1.34 (t, J = 7.5 Hz, 3H). MS (ESI, m / z): [M+H] += 758.4.

[0592] Example 279b (32.39 mg, 0.043 mmol, 49.8% yield) was synthesized from the compound of peak 1 using the procedure described above. 1 H NMR (400 MHz, MeOD-d4) δ 8.58 (s, 1H), 8.42 (d, J = 8.5 Hz, 2H), 8.16 (d, J = 8.6 Hz, 1H), 7.82 (dd, J = 5.2, 3.3 Hz, 3H), 7.61 (dd, J = 8.7, 1.6 Hz, 1H), 5.48 (s, 2H), 4.72 (d, J = 13.0 Hz, 1H), 4.12 (d, J = 12.4 Hz, 1H), 3.83 - 3.69 (m, 2H), 3.51 - 3.43 (m, 1H), 3.19 - 3.09 (m, 3H), 2.97 (d, J = 11.0 Hz, 1H), 2.82 (d, J = 13.4 Hz, 4H), 2.53 (s, 3H), 1.34 (t, J = 7.4 Hz, 3H). MS (ESI, m / z): [M+H] + = 758.4.

[0593] Example 280: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(3- hydroxypyridinecarbonyl)piperazin-l-yl)-7-oxo-2-(pyrazolo[l,5-a]pyridine-5-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide

[0594]

[0595] Step 1: A mixture of 3-hydroxypicolinic acid (71 mg, 0.51 mmol), HOAt (69 mg, 0.51 mmol) and EDCI (98 mg, 0.51 ml) in ACN (40 mL) was stirred at room temperature under N2for 1 h, then N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-1-yl)-2-(pyrazolo[1,5- a]pyridin-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (100 mg, 0.17 mmol) and DIEA (0.17 mL, 1.02 mmol) in ACN (10 mL) was stirred for 1 h. The mixture was stirred at room temperature for 12 h. Then the mixture was concentrated, diluted with water (10 mL), extracted with ethyl acetate (10 mL*3). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate. The mixture was concentrated in vacuum and purified by prep-HPLC eluted with MeCN in pure water (0.1% FA) to give N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(4-(3-hydroxypyridinecarbonyl)piperazin-1-yl)-7-oxo-2-(pyrazolo[1,5-a]pyridin-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide (24 mg, 0.033 mmol, 19.9% yield) as a white solid. 1 H NMR (400 MHz, DMSO-d6) d 10.41 (s, 2H), 8.80 (d, J = 7.3 Hz, 1H), 8.43 (s, 1H), 8.11 - 8.04 (m, 3H), 7.98 (s, 1H), 7.71 (d, J = 7.3 Hz, 1H), 7.50 (dd, J = 7.3, 1.8 Hz, 1H), 7.30 (d, J = 2.1 Hz, 2H), 6.82 (d, J = 2.1 Hz, 1H), 5.41 (s, 2H), 4.57 (d, J = 11.1 Hz, 1H), 3.47 (dd, J = 32.2, 11.4 Hz, 3H), 3.26 - 3.15 (m, 1H), 3.08 - 2.94 (m, 3H), 2.84 (d, J = 9.8 Hz, 1H), 2.66 (d, J = 10.1 Hz, 1H), 1.22 (t, J = 7.4 Hz, 3H). MS (ESI, m / z): [M+H] + = 721.4

[0596] Example 281: 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(2-methyl- 2H-indazol-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide

[0597]

[0598] Step 1: To a mixture of 4-chloro-3-hydroxypyridine carboxylic acid (41.6 mg, 0.24 mmol) in DMF (3 mL) was added DIEA (62.04 mg, 0.48 mmol) and HATU (91.3 mg, 0.24 mm). The solution was stirred at room temperature for 1 h under N2, then N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-2-(2-methyl-2H-indazol-5-yl)-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (100 mg, 0.16 mmol) was added. The mixture was stirred at room temperature for 2 h. The mixture was purified by Prep HPLC eluted with MeCN in pure water (0.1% FA) to give 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(2-methyl-2H- indazol-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl) phenyl)acetamide (23.5 mg, 0.031 mmol, 19.1% yield) as a white solid.

[0599] 1 H NMR (400 MHz, DMSO-d6) δ 10.85 (s, 1H), 10.43 (s, 1H), 8.57 - 8.38 (m, 2H), 8.08 (d, J = 5.1 Hz, 2H), 8.01 - 7.93 (m, 2H), 7.71 (t, J = 7.7 Hz, 2H), 7.56 (d, J = 5.1 Hz, 1H), 5.42 (d, J = 10.2 Hz, 2H), 4.56 (d, J = 12.2 Hz, 1H), 4.19 (s, 3H), 3.57 (dd, J = 27.3, 11.6 Hz, 3H), 3.27 (s, 1H), 2.97 (t, J = 33.7 Hz, 4H), 2.67 (s, 1H), 1.22 (t, J = 7.3 Hz, 3H). MS (ESI, m / z): [M+H] + = 769.35

[0600] Example 282a and 282b: (S)-2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5- ethyl-2-(4-(methylsulfinyl)phenyl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2- chloro-4-(trifluoromethyl)phenyl)acetamide and (R)-2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(4-(methylsulfinyl)phenyl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin- 4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide

[0601]

[0602] Step 1: To a solution of tert-butyl 4-(2-bromo-4-(2-((2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (300 mg, 0.45 mmol) in DCM (3 mL) was added HC1 / dioxane (3 mL, 4 M) and the mixture was stirred at room temperature for 2 hours. The mixture was then concentrated under vacuum to give crude 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide as HC1 salt (280 mg, 0.50 mmol, 109.9% yield). MS (ESI) m / z = 562.24 [M+H] +

[0603] Step 2: To a solution of 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (240 mg, 0.43 mmol), 4-chloro-3-hydroxypyridine carboxylic acid (90 mg, 0.52 mmol), HATU (245 mg, 0.65 mmol) in DMF (5 mL) was added DIEA (111 mg, 0.86 mmol) and the mixture was stirred at room temperature for 16 h. The mixture was then diluted with water (40 mL) and extracted with ethyl acetate (40 mL*3). The organic layers were combined, washed with brine (40 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting residue was purified by flash chromatography (elution gradient: MeOH / DCM = 0-5%) to give 2-(2-bromo-6-(4-(4-chloro-3- hydroxypyridinecarboxamido)piperazin-l-yl)-5-ethyl-7-oxo-[l,2,4]triazolo[l,5- a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (180 mg, 0.25 mmol, 58.8% yield) as a brown solid. MS (ESI) m / z = 719.4 [M+l+Br] + .

[0604] Step 3: To a solution of 2-(2-bromo-6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)- 5-ethyl-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (90 mg, 0.130 mmol), Pd(dppf)Cl2(10 mg, 0.013 mmol) and potassium carbonate (54 mg, 0.390 mmol) in dioxane (10 mL) and pure water (1 mL) was stirred at 90 °C for 16 h under nitrogen. The mixture was filtered, concentrated in vacuo, purified by Prep HPLC eluted with MeCN in pure water (0.1% NH4HCO3) to give (R)-2-(6-(4-(4-chloro-3- hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(4-(methylsulfinyl)phenyl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide or (S) 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(4- (methylsulfinyl)phenyl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide as white solids.

[0605] Example 282a (36.10 mg, 0.047 mmol, 37.1% yield) was synthesized from the compound of peak 1 (Reference Example 279a) using the above procedure. 1 H NMR (400 MHz, MeOD-d4) δ 8.40 (d, J = 8.5 Hz, 2H), 8.16 (d, 1H), 7.81 (dd, J = 5.3, 3.2 Hz, 3H), 7.61 (d, J = 8.6 Hz, 1H), 7.53 (d, J = 5.0 Hz, 1H), 7.27 (d, J = 5.0 Hz, 1H), 5.46 (s, 2H), 4.70 (d, J = 12.0 Hz, 1H), 3.80 - 3.56 (m, 3H), 3.52 - 3.46 (m, 1H), 3.20 - 3.10 (m, 3H), 2.92 (d, J = 12.1 Hz, 1H), 2.84 (s, 3H), 2.74 (d, J = 10.7 Hz, 1H), 1.33 (t, J = 7.5 Hz, 3H). MS (ESI, m / z): [M+H] + = 777.2.

[0606] Example 282b (22.08 mg, 0.028 mmol, 22.7% yield) was synthesized from the compound of peak 2 (Reference Example 279b) using the above procedure. 1 H NMR (400 MHz, MeOD-d4) δ 8.40 (d, J = 8.5 Hz, 2H), 8.16 (d, 1H), 7.81 (dd, J = 5.3, 3.2 Hz, 3H), 7.61 (d, J = 8.6 Hz, 1H), 7.53 (d, J = 5.0 Hz, 1H), 7.27 (d, J = 5.0 Hz, 1H), 5.46 (s, 2H), 4.70 (d, J = 12.0 Hz, 1H), 3.80 - 3.56 (m, 3H), 3.52 - 3.46 (m, 1H), 3.20 - 3.10 (m, 3H), 2.92 (d, J = 12.1 Hz, 1H), 2.84 (s, 3H), 2.74 (d, J = 10.7 Hz, 1H), 1.33 (t, J = 7.5 Hz, 3H). MS (ESI, m / z): [M+H] + = 777.0.

[0607] Example 283: 2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin- 1-yl)-2-(2-methyl-2H-indazol-5-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2- fluoro-4-(trifluoromethyl)phenyl)acetamide

[0608]

[0609] Step 1: A mixture of 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carbonyl)piperazin-1-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4- (trifluoromethyl)phenyl)acetamide (100 mg, 0.15 mmol), 2-methyl-5-(4,4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)-2H-indazole (58.08 mg, 0.22 mmol), Pd(dppf)Cl2(10.98 mg, 0.015 mmol) and sodium carbonate (47.7 mg, 0.45 mmol) in dioxane (10 mL) was stirred at 90 °C under nitrogen for 16 h with pure water (1 mL). The mixture was then concentrated in vacuum and purified by prep-HPLC to give 2-(5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-1-yl)-2-(2-methyl- 2H-indazol-5-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4- (trifluoromethyl)phenyl)acetamide (23 mg, 0.031 mmol, 21.4% yield) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ 10.74 (s, 1H), 10.24 (s, 1H), 8.59 (s, 1H), 8.49 (s, 2H), 8.24 (t, J = 8.2 Hz, 1H), 7.96 (dd, J = 9.1, 1.5 Hz, 1H), 7.81 (d, J = 11.2 Hz, 1H), 7.69 (d, J = 9.1 Hz, 1H), 7.57 (d, J = 8.7 Hz, 1H), 5.39 (s, 2H), 4.54 (d, J = 11.8 Hz, 1H), 4.19 (s, 3H), 3.53 (t, J = 10.7 Hz, 3H), 3.26 (d, J = 11.4 Hz, 1H), 3.01 (s, 3H), 2.85 (d, J = 10.2 Hz, 1H), 2.68 - 2.66 (m, 1H), 2.45 (s, 3H), 1.20 (t, J = 7.4 Hz, 3H). MS (ESI, m / z): [M+H] += 734.3

[0610] Example 284: 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(2-(methyl- d3)-2H-indazol-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4- (trifluoromethyl)phenyl)acetamide

[0611]

[0612] Step 1: To a mixture of 4-chloro-3-hydroxypyridine carboxylic acid (133.29 mg, 0.77 mmol) in N,N-dimethylformamide (5 mL) was added DIEA (248.14 mg, 1.92 mmol) and HATU (365.02 mg, 0.96 mmol). The mixture was stirred at room temperature for 30 min, then 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4-(trifluoromethyl)phenyl)acetamide hydrochloride (350 mg, 0.60 mmol) was added. The mixture was stirred at room temperature for 12 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (15 mL*3). The combined organic layers were washed with brine (15 mL*3), dried over anhydrous sodium sulfate and concentrated in vacuo. The resulting mixture was purified by flash silica gel chromatography (elution gradient: 0 to 10% MeOH in DCM, v / v) to give 2-(2-bromo-6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4-(trifluoromethyl)phenyl)acetamide (180 mg, 0.26 mmol, 43% yield). MS (ESI, m / z): [M+H] + = 701.0, 703.0

[0613] Step 2: To a mixture of 2-(2-bromo-6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-1-yl)-5- ethyl-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4-(trifluoromethyl)phenyl)acetamide (90 mg, 0.14 mmol) in 1,4-dioxane (10 mL) and pure water (1 mL) was added 2-(methyl-d3)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2H-indazole (73.12 mg, 0.28 mmol), sodium carbonate (44.52 mg, 0.42 mmol) and Pd(dppf)Cl2(5.72 mg, 0.007 mmol). The mixture was degassed with N2and stirred at 85 °C for 12 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (15 mL*3). The combined organic layers were washed with brine (15 mL*3), dried over anhydrous sodium sulfate and concentrated in vacuo. The crude product was purified by prep-HPLC (0.1% FA) to give 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-1-yl)-5-ethyl-2-(2-(methyl-d3)-2H-indazol-5-yl)-7-oxo- [1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4-(trifluoromethyl)phenyl)acetamide (20.72 mg, 0.027 mmol, 19.3% yield). 1 H NMR (400 MHz, DMSO-d6) d 10.85 (s, 1H), 10.74 (s, 1H), 8.49 (s, 2H), 8.24 (t, J = 8.2 Hz, 1H), 8.08 (d, J = 5.1 Hz, 1H), 7.96 (dd, J = 9.0, 1.6 Hz, 1H), 7.81 (d, J = 9.4 Hz, 1H), 7.69 (d, J = 9.0 Hz, 1H), 7.56 (d, J = 5.1 Hz, 2H), 5.39 (s, 2H), 4.56 (d, J = 14.1 Hz, 1H), 3.64 - 3.48 (m, 3H), 3.29 - 3.20 (m, 1H), 3.08 - 2.92 (m, 3H), 2.85 (d, J = 11.8 Hz, 1H), 2.73 - 2.67 (m, 1H), 1.20 (t, J = 7.5 Hz, 3H). MS (ESI, m / z): [M+H] + = 756.2.

[0614] Example 285: 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(2- methyl-2H-indazol-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4- (trifluoromethyl)phenyl)acetamide

[0615]

[0616] Step 1 : To a mixture of 2-(2-bromo-6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)- 5-ethyl-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4-(trifluoromethyl) phenyl)acetamide (90 mg, 0.13 mmol) in 1,4-dioxane (10 mL) and water (1 mL) was added 2-methyl-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-2H-indazole (67.11 mg, 0.26 mmol), sodium carbonate (41.34 mg, 0.39 mmol) and Pd(dppf)Cl2(5.35 mmol). 1 mg, 0.0065 mmol). The mixture was degassed with N2and stirred at 85 °C for 12 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (15 mL*3). The combined organic layers were washed with brine (15 mL*3), dried over anhydrous sodium sulfate and concentrated in vacuo. The crude product was purified by prep-HPLC (0.1% FA) to give 2-(6-(4-(4-chloro-3- hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(2-methyl-2H-indazol-5-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4-(trifluoromethyl)phenyl)acetamide (23.02 mg, 0.031 mmol, 23.8% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 10.91 - 10.74 (m, 2H), 8.49 (s, 2H), 8.24 (t, J = 8.2 Hz, 1H), 8.10 - 7.91 (m, 2H), 7.81 (d, J = 10.2 Hz, 1H), 7.69 (d, J = 8.9 Hz, 1H), 7.56 (d, J = 10.2 Hz, 2H), 5.39 (s, 2H), 4.57 (d, J = 11.2 Hz, 1H), 4.19 (s, 3H), 3.57 (dt, J = 15.9, 10.6 Hz, 3H), 3.29 - 3.22 (m, 1H), 3.09 - 2.96 (m, 3H), 2.89 - 2.81 (m, 1H), 2.73 - 2.67 (m, 1H), 1.21 (t, J = 7.4 Hz, 3H). MS (ESI, m / z): [M+H] + = 753.2.

[0617] Examples 286a and 286b: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-((lS,6R)-5-(5- hydroxy-6-methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]octan-2-yl)-7-oxo-2- (pyrazolo[l,5-a]pyridin-5-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide and N-(2- chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-((lR,6S)-5-(5-hydroxy-6-methylpyrimidine-4- carbonyl)-2,5-diazabicyclo[4.2.0]octan-2-yl)-7-oxo-2-(pyrazolo[l,5-a]pyridin-5-yl)-[l,2,4]triazolo[l,5- a]pyrimidin-4(7H)-yl)acetamide

[0618]

[0619] Step 1: To a solution of cis-tert-butyl 2,5-diazabicyclo[4.2.0]octane-2-carboxylate (1.8 g, 8.48 mmol) in acetonitrile (45 mL) was added ethyl 2-bromo-3-oxopentanoate (1.9 g, 8.48 mmol) and potassium carbonate (3.5 g, 25.44 mmol). The mixture was stirred at 50 °C for 2 h. The mixture was filtered, and the filter cake was washed with acetonitrile. The filtrate was concentrated in vacuo and purified by flash silica gel chromatography (elution gradient: 0 to 50% ethyl acetate in hexanes, v / v) to give cis-tert-butyl 5-(l-ethoxy-l,3-dioxopentan-2-yl)-2,5- diazabicyclo[4.2.0]octane-2-carboxylate (1.4 g, 3.95 mmol, 46.6% yield) as a yellow oil. MS (ESI, m / z): [M+H]+ = 355.4.

[0620] Step 2 & Step 3: To a solution of cis-tert-butyl 5-(1-ethoxy-1,3-diketopentan-2-yl)-2,5- diazabicyclo[4.2.0]octane-2-carboxylate (1.4 g, 3.95 mmol) in ethanol (30 mL) was added 5-bromo-4H-1,2,4-triazol-3-amine (965.66 mg, 5.93 mmol) and phosphoric acid (4.5 g, 39.5 mmol). The reaction mixture was stirred at 90 °C for 48 h under nitrogen. Then to the mixture was added saturated sodium carbonate and (Boc)2O (4.31 g, 19.75 mmol) until pH = 10. The mixture was stirred at 25 °C for 2 h. The mixture was diluted with water (100 mL) and extracted with ethyl acetate (100 mL*3). The combined organic layers were washed with brine (80 mL) and concentrated. The residue was purified by flash silica gel chromatography (elution gradient: 0 to 3% MeOH in DCM, v / v) to give cis-tert-butyl 5-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)-2,5- diazabicyclo[4.2.0]octane-2-carboxylate (870 mg, 1.9 mmol, 48.1% yield) as a yellow solid. MS (ESI, m / z): [M+H] + = 453.1, 455.1.

[0621] Step 4: To a solution of cis-tert-butyl 5-(2-bromo-5-ethyl-7-oxo-4,7-dihydro- [1,2,4]triazolo[1,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylate (870 mg, 1.92 mmol) in acetonitrile (55 mL) was added 2-bromo-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (668.45 mg, 2.11 mmol) and DIEA (545.91 mg, 4.22 mmol). The mixture was stirred at 25 °C for 16 h. The mixture was concentrated in vacuo and purified by flash silica gel chromatography (elution gradient: 0 to 45% ethyl acetate in hexanes, v / v) to give cis-tert-butyl 5-(2-bromo-4-(2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro- [1,2,4]triazolo[1,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octane-2-carboxylate (650 mg, 0.95 mmol, 49.5% yield) as a yellow solid. MS (ESI, m / z): [M+H-56] + = 634.1.

[0622] Step 5: To a solution of cis tert-butyl 5-(2-bromo-4-(2-((2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)-2,5-diazabicyclo[4.2.0]octan-2-carboxylate (650 mg, 0.94 mmol) in dichloromethane (20 mL) was added 4 M HC1 / 1,4-dioxane (10 mL). The mixture was stirred at room temperature for 2 hours. The mixture was concentrated in vacuo to give cis 2-(6-(2,5-diazabicyclo[4.2.0]octan-2-yl)-2-bromo-5-ethyl-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide hydrochloride (550 mg, 0.88 mmol, 88.8% yield) as a yellow solid. MS (ESI, m / z): [M+H] + = 588.2, 590.2.

[0623] Step 6: To a mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (148 mg, 0.96 mmol) in acetonitrile (220 mL) was added HOAt (163.33 mg, 1.2 mmol) and EDCI (230.04 mg, 1.2 mmol). The mixture was stirred at room temperature for 1 hour, then a solution of cis 2-(6-(2,5-diazabicyclo[4.2.0]octan-2-yl)-2-bromo-5-ethyl-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide hydrochloride (300 mg, 0.48 mmol) and DIEA (372.21 mg, 2.88 mmol) in acetonitrile (55 mL) was added. The mixture was stirred at 30 °C for 16 hours. The mixture was concentrated in vacuo, diluted with water (50 mL). The mixture was extracted with DCM (50 mL*3). The combined organic layers were washed with brine (30 mL*3), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by flash silica gel chromatography (elution gradient: 0 to 3% MeOH in DCM, v / v) to give cis 2-(2-bromo-5-ethyl-6-(5-hydroxy-6-methylpyrimidine-4-carbonyl)-2,5- diazabicyclo[4.2.0]octan-2-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (130 mg, 0.18 mmol, 18.8% yield) as a yellow solid. MS (ESI, m / z): [M+H] + = 724.1.

[0624] Step 7: To a mixture of cis 2-(2-bromo-5-ethyl-6-(5-(5-hydroxy-6-methylpyrimidine-4- carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)- N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (130 mg, 0.18 mmol) in 1,4-dioxane (10 mL) and water (1 mL) was added 5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)pyrazolo[l,5- a]pyridine (70.30 mg, 0.29 mmol), Pd(PPh3)4 (20.80 mg, 0.018 mmol) and sodium carbonate (57.23 mg, 0.54 mmol). The mixture was degassed with nitrogen and stirred at 90 °C for 12 h. The mixture was concentrated and purified by prep HPLC (eluted with MeCN in pure water, 10 mmol / L NH4HC03) to give cis N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-(5-(5-hydroxy-6- methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]oct-2-yl)-7-oxo-2-(pyrazolo[l,5- a]pyridin-5-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (Example 286, 30 mg, 0.039 mmol, 22% yield). 1 H NMR (400 MHz, MeOD-d4) δ 8.61 (d, J = 7.4 Hz, 1H), 8.58 - 8.48 (m, 2H), 8.18 (d, J = 8.5 Hz, 1H), 8.00 (d, J = 2.4 Hz, 1H), 7.83 (s, 1H), 7.63 (dd, J = 16.9, 9.3 Hz, 2H), 6.76 (d, J = 2.4 Hz, 1H), 5.64 (d, J = 17.7 Hz, 1H), 5.39 (d, J = 17.3 Hz, 1H), 4.56 - 4.37 (m, 2H), 3.82 - 3.63 (m, 3H), 3.05 - 2.84 (m, 3H), 2.52 (d, J = 8.9 Hz, 3H), 2.45 - 2.11 (m, 1H), 1.85 - 1.55 (m, 2H), 1.43 - 1.31 (m, 4H). MS (ESI, m / z): [M+H] + = 762.2.

[0625] Step 8: Purification of Example 286 by SFC to give Example 286a and Example 286b: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-6-((1S,6R)-5-(5-hydroxy-6- methylpyrimidine-4-carbonyl)-2,5-diazabicyclo[4.2.0]octan-2-yl)-7-oxo-2-(pyrazolo[1,5- a]pyridin-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide or N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-6-((1R,6S)-5-(5-hydroxy-6-methylpyrimidine-4- carbonyl)-2,5-diazabicyclo[4.2.0]octan-2-yl)-7-oxo-2-(pyrazolo[1,5-a]pyridin-5-yl)- [1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide. MS (ESI, m / z): [M+H] + = 762.2.

[0626] NMR of 286a: 1 H NMR (400 MHz, MeOD-d4) δ 8.61 (d, J = 7.4 Hz, 1H), 8.58 - 8.48 (m, 2H), 8.18 (d, J = 8.5 Hz, 1H), 8.00 (d, J = 2.4 Hz, 1H), 7.82 (s, 1H), 7.63 (dd, J = 16.9, 9.3 Hz, 2H), 6.75 (d, J = 2.4 Hz, 1H), 5.63 (d, J = 17.7 Hz, 1H), 5.39 (d, J = 17.3 Hz, 1H), 4.56 - 4.36 (m, 2H), 3.80 - 3.53 (m, 3H), 3.05 - 2.80 (m, 3H), 2.51 (d, J = 8.9 Hz, 3H), 2.47 - 2.15 (m, 1H), 1.65 - 1.50 (m, 2H), 1.47 - 1.30 (m, 4H).

[0627] NMR of 286b: 1H NMR (400 MHz, MeOD-d4) δ 8.61 (d, J = 7.4 Hz, 1H), 8.55 - 8.49 (m, 2H), 8.18 (d, J = 8.5 Hz, 1H), 8.00 (d, J = 2.4 Hz, 1H), 7.82 (s, 1H), 7.63 (dd, J = 16.9, 9.3 Hz, 2H), 6.75 (d, J = 2.4 Hz, 1H), 5.63 (d, J = 17.7 Hz, 1H), 5.39 (d, J = 17.3 Hz, 1H), 4.56 - 4.36 (m, 2H), 3.80-3.55 (m, 3H), 3.02-2.82 (m, 3H), 2.52 (d, J = 8.9 Hz, 3H), 2.47 - 2.15 (m, 1H), 1.65 - 1.50 (m, 2H), 1.47-1.30 (m, 4H).

[0628] Example 287: 2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(l-oxido- 2,3-dihydrobenzo[b]thiophen-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2- chloro-4-(trifluoromethyl)phenyl)acetamide

[0629]

[0630] Step 1: To a solution of benzo[b]thiophene-3(2H)-one (2.0 g, 13.3 mmol) in ethanol (10 mL) was added hydrazine hydroxide (10.3 g, 205.8 mmol). The solution was stirred at 80 °C for 1 hour. The solution was concentrated, the residue was added to diethylene glycol (11.2 g, 105.49 mmol), then potassium hydroxide (2.24 g, 39.96 mmol) was added. The new solution was stirred at 120 °C for 16 hours. GCMS indicated the reaction was complete. Ethyl acetate (30 mL) was added, washed with brine (15 mL*2). Concentrated, the residue was purified by gel chromatography (PE) to give 2,3-dihydrobenzo[b]thiophene (800 mg, 5.88 mmol, 44.2% yield) as colorless oil. GC / MS (ESI, m / z): [M] + = 136

[0631] Step 2: To a solution of 2,3-dihydrobenzo[b]thiophene (830 mg, 6.09 mmol) in dichloromethane (20 mL) was added bromine (973.24 mg, 6.09 mmol) at 0 °C. The solution was stirred at room temperature for 16 h. Then NaHSO3(20 mL) was added, extracted with DCM (20 mL*2), washed with brine. Concentrated, the residue was purified by silica gel column (PE) to give 5-bromo-2,3-dihydrobenzo[b]thiophene (900 mg, 4.18 mmol, 68.7% yield) as yellow solid. 1 H NMR (400 MHz, CDC13) δ 7.30 (s, 1H), 7.21 (d, J = 8.2 Hz, 1H), 7.06 (d, J = 8.2 Hz, 1H), 3.36 (d, J = 6.9 Hz, 2H), 3.26 (t, J = 7.6 Hz, 2H).

[0632] Step 3: To a solution of 5-bromo-2,3-dihydrobenzo[b]thiophene (866 mg, 4.03 mmol) in dichloromethane (20 mL) was added 3-chloroperbenzoic acid (981.82 mg, 4.84 mmol, purity 85%) at 0 °C. The solution was stirred at room temperature for 16 h. NaOH (10 mL, 2 N) was added. Extracted with DCM (20 mL*3). The organic phase was washed with brine (10 mL), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by gel chromatography PE / EtOAc (10:1 to 1:1) to give 5-bromo-2,3-dihydrobenzo[b]thiophene 1-oxide (800 mg, 3.46 mmol, 85.9% yield) as yellow solid. MS (ESI, m / z): [M+H] + = 231.0, 233.0.

[0633] Step 4: To a mixture of 5-bromo-2,3-dihydrobenzo[b]thiophene 1-oxide (120 mg, 0.52 mmol) in 1,4-dioxane (20.0 mL) was added potassium acetate (153.1 g, 1.56 mmol), B2pin2(150 mg, 0.57 mmol) and Pd(dppf)Cl2(43 mg, 0.052 mmol) at room temperature under N2. The resulting mixture was stirred at 90 °C for 16 h under nitrogen. The mixture was concentrated in vacuum, the resulting residue was purified by silica gel column chromatography (10% to 50% EA / PE) to give 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2,3-dihydrobenzo[b]thiophene-1-oxide (90 mg, 0.32 mmol, 62.2% yield) as solid. MS (ESI, m / z): [M+H] + = 279.1, [M+H-82]+ = 196.88.

[0634] Step 5: 2-(2-bromo-6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5- ethyl-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (trifluoromethyl)phenyl)acetamide (100 mg, 0.14 mmol), 5-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)-2,3-dihydrobenzo[b]thiophene 1-oxide (47 mg, 0.17 mmol), Pd(dppf)Cl2(11 mg, 0.014 mmol) and sodium carbonate (45 mg, 0.42 mmol) in a mixture of dioxane (10 mL) / pure water (1 mL) was stirred at 85 °C for 16 h. The mixture was filtered, concentrated in vacuo, purified by Prep HPLC eluted with MeCN in pure water (0.1% NH4HCO3) to give 2-(6-(4-(4-chloro-3- hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(l-oxide-2,3-dihydrobenzo[b]thiophen-5-yl)- 7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl) acetamide (Example 287). MS (ESI, m / z): [M+H] + = 789.2.

[0635] Step 6: Example 287 was purified by SFC to give Example 287a and Example 287b: (S)-2-(6-(4-(4-chloro-3-hydroxypyridinyl)piperazin-l-yl)-5-ethyl-2-(l-oxide-2,3- dihydrobenzo[b]thiophen-5-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro- 4-(trifluoromethyl)phenyl)acetamide or (R)-2-(6-(4-(4-chloro-3-hydroxypyridinyl) piperazin-l-yl)-5-ethyl-2-(l-oxide-2,3-dihydrobenzo[b]thiophen-5-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide. MS (ESI, m / z): [M+H] + = 789.2.

[0636] NMR of 287a: 1H NMR (400 MHz, DMSO-d6) δ 10.55 - 10.12 (m, 1H), 8.29 (s, 1H), 8.18 (d, J = 8.2 Hz, 1H), 8.10 - 7.90 (m, 4H), 7.72 (d, J = 8.8 Hz, 1H), 7.49 (d, J = 5.2 Hz, 1H), 5.41 (s, 2H), 4.54-4.45 (m, 1H), 3.73 (dd, J = 15.4, 8.0 Hz, 1H), 3.65 - 3.30 (m, 5H), 3.27– 3.15 (m, 2H), 3.03–2.95 (m, 3H), 2.84 (d, J = 11.1 Hz, 1H), 2.67 (s, 1H), 1.22 (t, J = 7.4 Hz, 3H).

[0637] NMR of 287b: 1 H NMR (400 MHz, DMSO-d6) δ 10.55 - 10.12 (m, 1H), 8.29 (s, 1H), 8.18 (d, J = 8.2 Hz, 1H), 8.10 - 7.90 (m, 4H), 7.72 (d, J = 8.8 Hz, 1H), 7.49 (d, J = 5.2 Hz, 1H), 5.41 (s, 2H), 4.54-4.45 (m, 1H), 3.73 (dd, J = 15.4, 8.0 Hz, 1H), 3.65 - 3.30 (m, 5H), 3.27– 3.15 (m, 2H), 3.03–2.95 (m, 3H), 2.84 (d, J = 11.1 Hz, 1H), 2.67 (s, 1H), 1.22 (t, J = 7.4 Hz, 3H).

[0638] The following compounds were synthesized using methods analogous to the procedures described above or referenced. Starting materials were either commercial or internally prepared.

[0639]

[0640]

[0641]

[0642]

[0643]

[0644] Synthesis of intermediates:

[0645] Synthesis of intermediate 1: Imidazo[1,2-a]pyridine-6-ylboronic acid

[0646]

[0647] Step 1: To a solution of 6-bromoimidazo[l,2-a]pyridine (300 mg, 1.523 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-4-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2- dioxaborolane (502 mg, 1.979 mmol) and KOAc (448 mg, 4.568 mmol) in dioxane (20 mL) under nitrogen was added Pd(dppf)Cl2(111 mg, 0.152 mmol). The reaction mixture was stirred at 90 °C for 16 h. The mixture was concentrated under vacuum. Then purified by preparative high performance liquid chromatography (Gemini-C18 150*21.2 mm 5um: MeCN-H2O (0.1% FA): 55-85) to give the product imidazo[l,2-a]pyridin-6-ylboronic acid as a light yellow solid (110 mg, 0.679 mmol, 44.6% yield). MS (ESI) m / z = 163.2 [M+H] + .

[0648] Synthesis of intermediate 3: 2-(4-(dichloromethylene)cyclohex-l-en-l-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane

[0649]

[0650] Step 1: To a solution of PPh3(6.71 g, 25.6 mmol) in MeCN (10 mL) stirred under nitrogen was added a solution of l,4-dioxaspiro[4.5]decane-8-one hydrate (1 g, 6.4 mmol) and CC14(1.97 g, 12.8 mmol) in MeCN (10 mL) dropwise. After addition, the reaction mixture was stirred at 25 °C for 16 h. The reaction was quenched with pure water (30 mL), extracted with PE (30 mL), then washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified by flash chromatography (ethyl acetate:hexane = 0-5%) to give the product 8-(dichloromethylene)-l,4-dioxaspiro[4.5]decane as a white solid (1.2 g, 5.4 mmol, 84.4% yield). MS (ESI) m / z = 223.1, 225.2 [M+H] + .

[0651] Step 2: To a solution of 8-(dichloromethylene)-l,4-dioxaspiro[4.5]decane (1.2 g, 5.4 mmol) in THF (3 mL) was added 3N HC1 (3 mL) solution. The reaction mixture was stirred at 25 °C for 16 h. The mixture was concentrated and purified quickly (ethyl acetate: hexane = 0-3%) to give the product 4-(dichloromethylene)cyclohexan-l-one (0.7 g, 3.9 mmol, 72.2% yield) as a light yellow oil. MS (ESI) m / z = 179.1, 181.1 [M+H] + .

[0652] Step 3: To a solution of 4-(dichloromethylene)cyclohexan-l-one (700 mg, 3.910 mmol) in THF (20 mL) was added LDA (3.9 mL, 7.819 mmol) at -78 °C under nitrogen, the mixture was stirred at this temperature for 0.5 h, then 1,1,1-trifluoro-N-phenyl-N-((trifluoromethyl)sulfonyl)methanesulfonamide (1396 mg, 3.91 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with Sat. NH4C1, diluted with DCM (40 mL), then washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate: hexane = 0-10%) to give the product 4-(dichloromethylene)cyclohex-l-en-l-yl trifluoromethanesulfonate (500 mg, 1.607 mmol, 41.1% yield) as a yellow oil. 1 H NMR (400 MHz, CDC13) δ 5.76-5.45 (m, 1H), 3.20-3.10 (m, 2H), 2.72 (t, J = 6.5 Hz, 2H), 2.50-2.46 (m, 2H).

[0653] Step 4: A mixture of 4-(dichloromethylene)cyclohex-l-en-l-yl trifluoromethanesulfonate (500 mg, 1.607 mmol), 4,4,5,5-tetramethyl-2-(4,4,4,5,5-4-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2-dioxaborolane (449 mg, 1.768 mmol), Pd(dppf)Cl2(117 mg, 0.161 mmol) and KOAc (473 mg, 4.822 mmol) in dioxane (20 mL) was stirred at 80 °C for 10 h. The mixture was concentrated and purified quickly (ethyl acetate: hexane = 0-5%) to give the product 2-(4-(dichloromethylene)cyclohexyl-l-en-l-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane (140 mg, 0.484 mmol, 30.1% yield) as a yellow solid. 1HNMR (400 MHz, CDC13) δ 6.52-6.50 (m, 1H), 3.04-3.02 (m, 2H), 2.48 (t, J = 6.3 Hz, 2H), 2.29-2.25 (m, 2H), 1.26 (s, 12H).

[0654] Synthesis of Intermediate 5: 6-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)pyrazolo[l,5- a]pyridine

[0655]

[0656] Step 1: To a solution of 6-bromopyrazolo[l,5-a]pyridine (150 mg, 0.76 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2-dioxaborolane (251 mg, 0.989 mmol) and KOAc (149 mg, 1.52 mmol) in dioxane (3 mL) was added Pd(dppf)Cl2(55 mg, 0.076 mmol). The reaction mixture was stirred at 80 °C under nitrogen for 16 h. The mixture was concentrated under vacuum. Then purified by flash chromatography (ethyl acetate / hexanes = 0-3%) to give the product 6-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)pyrazolo[l,5-a]pyridine (70 mg, 0.286 mmol, yield: 37.7%) as colorless oil. MS (ESI) m / z = 260.0 [M+H] + .

[0657] Synthesis of Intermediate 7: 5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)benzo[c]isothiazole

[0658]

[0659] Step 1: Under nitrogen atmosphere, a mixture of methanesulfonamide (7.2 g, 75.6 mmol) and SOCl2 (13.09 g, 110 mmol) in toluene (10 mL) was stirred at 120 °C for 18 hours. After cooling to room temperature, toluene was removed under reduced pressure, and the residue was used directly for the next step. SOCl2 (1.41 g, 11.8 mmol) was added dropwise to a solution of 4-bromo-2-methylaniline (2.0 g, 10.7 mmol) in toluene (40 mL) at 0 °C. After the addition was complete, the reaction mixture was heated at 120 °C for 18 hours. Pyridine (0.97 g, 12.3 mmol) and the crude residue from the above reaction were added to the mixture. The resulting solution was then stirred at 120 °C for 18 hours. The reaction mixture was concentrated under reduced pressure, dissolved in ethyl acetate (100 mL), and washed with pure water (2 x 100 mL). The organic layer was washed with brine (100 mL), dried over anhydrous sodium sulfate, and concentrated under vacuum to obtain the crude product. This crude product was purified by rapid chromatography (ethyl acetate / hexane = 0-10%) to give a yellow solid, 5-bromobenzo[c]isothiazol (1.5 g, 0.007 mol, yield: 65.4%). MS (ESI) m / z = 214.0, 216.0 [M+H] + .

[0660] Step 2: Pd(dppf)Cl2 (273 mg, 0.374 mmol) was added to a solution of 5-bromobenzo[c]isothiazol (800 mg, 3.737 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-2-yl)-1,3,2-dioxaborane (1043 mg, 4.111 mmol), and KOAc (733 mg, 7.474 mmol) in dioxane (15 mL). The reaction mixture was stirred at 80 °C for 10 hours under nitrogen protection. The mixture was then concentrated under vacuum. The product was then purified by rapid chromatography (ethyl acetate / hexane = 0-3%) to give a green solid product, 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-2-yl)benzo[c]isothiazol (600 mg, 2.298 mmol, yield: 61.5%). 1 H NMR (400MHz, CD3OD) δ9.68 (s, 1H), 8.36 (s, 1H), 7.76 (d, J = 0.6Hz, 2H), 1.40 (s, 12H). MS (ESI) m / z = 262.2 [M+H] + .

[0661] Intermediate 9: Synthesis of 4,4,5,5-tetramethyl-2-(1-oxaspiro[3.5]non-6-en-7-yl)-1,3,2-dioxaborane

[0662]

[0663] Step 1: To a solution of 1-oxaspiro[3.5]nonan-7-one (200 mg, 1.4 mmol) in THF (8 mL) was added LDA (1.1 mL, 2.2 mmol, 2M in THF) at -78 °C under nitrogen. The mixture was stirred at this temperature for 0.5 h. Then 1,1,1-trifluoro-N-phenyl-N- ((trifluoromethyl)sulfonyl)methanesulfonamide (611 mg, 1.6 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with Sat. NH4Cl, diluted with DCM (40 mL), then washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate:hexane = 0-5%) to give the product 1-oxaspiro[3.5]non-6-en-7-yl trifluoromethanesulfonate (190 mg, 0.7 mmol, 48.9% yield) as colorless oil. 1 H NMR (400 MHz, CDCl3) δ 5.66-5.56 (m, 1H), 4.62-4.50 (m, 2H), 2.66-2.50 (m, 3H), 2.46 (t, J = 7.7 Hz, 2H), 2.42-2.31 (m, 1H), 2.22-2.09 (m, 1H), 2.05-1.94 (m, 1H).

[0664] Step 2: A mixture of 1-oxaspiro[3.5]non-6-en-7-yl trifluoromethanesulfonate (170 mg, 0.70 mmol), 4,4,5,5-tetramethyl-2-(4,4,4,5,6-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2- dioxaborolane (213 mg, 0.84 mmol), Pd(dppf)Cl2(51 mg, 0.07 mmol) and potassium acetate (137 mg, 1.40 mmol) in dioxane (8 mL) was stirred at 80 °C overnight. The mixture was concentrated and purified quickly (ethyl acetate:hexane = 0-6%) to give the product 4,4,5,5-tetramethyl-2-(1-oxaspiro[3.5]non-6-en-7-yl)-1,3,2-dioxaborolane (160 mg, 0.34 mmol, 39.8% yield) as colorless oil. 1 H NMR (400 MHz, CDCl3) δ 6.44-6.37 (m, 1H), 4.58-4.48 (m, 2H), 2.53-2.47 (m, 2H), 2.44-2.31 (m, 3H), 2.24-2.14 (m, 1H), 2.00-1.80 (m, 2H), 1.25 (s, 12H).

[0665] Intermediate 10: 4,4,5,5-tetramethyl-2-(2-oxaspiro[3.4]oct-6-en-6-yl)-1,3,2- dioxaborolane and 4,4,5,5-tetramethyl-2-(2-oxaspiro[3.4]oct-5-en-6-yl)-1,3,2- dioxaborolane

[0666]

[0667] Step 1: To a solution of 2-oxaspiro[3.4]octan-6-one (200 mg, 1.6 mmol) in tetrahydrofuran (5 mL) was added LDA (1.19 mL, 2.4 mmol) at -78 °C under nitrogen protection. The mixture was stirred at this temperature for 0.5 h. Then 1,1,1- trifluoro-N-phenyl-N-((trifluoromethyl)sulfonyl)methanesulfonamide (740 mg, 1.9 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with saturated ammonium chloride, diluted with dichloromethane (40 mL), washed with water (20 mL), brine (20 mL), dried over sodium sulfate, concentrated and purified by flash column chromatography (ethyl acetate:hexane = 0-10%) to give a mixture of 2-oxaspiro[3.4]oct-6-en-6-yl trifluoromethanesulfonate and 2-oxaspiro[3.4]oct-5-en-6-yl trifluoromethanesulfonate (220 mg, 0.77 mmol, 48.4% yield) as colorless oil. 1 HNMR (400 MHz, CDC13) δ 5.96-5.55 (m, 1H), 4.73-4.61 (m, 4H), 2.96-2.36 (m, 4H).

[0668] Step 2: A mixture of 2-oxaspiro[3.4]oct-6-en-6-yl trifluoromethanesulfonate and 2-oxaspiro[3.4]oct-5-en-6-yl trifluoromethanesulfonate (220 mg, 0.85 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2- dioxaborolane (238 mg, 0.94 mmol), Pd(dppf)Cl2(62 mg, 0.085 mmol) and potassium acetate (167 mg, 1.70 mmol) in dioxane (6 mL) was stirred at 80 °C for 3 h. The reaction mixture was concentrated and purified by flash column chromatography (ethyl acetate:hexane = 0-8%) to give the product 4,4,5,5-tetramethyl-2-(2-oxaspiro[3.4]oct-6-en-6-yl)-1,3,2-dioxaborolane and 4,4,5,5-tetramethyl-2-(2-oxaspiro[3.4]oct-5-en-6-yl)-1,3,2-dioxaborolane (160 mg, 0.34 mmol, 39.8% yield) as yellow oil. 1H NMR (400 MHz, CDC13) δ 6.68 - 6.39 (m, 1H), 4.73 - 4.59 (m, 4H), 2.46 - 2.19 (m, 4H), 1.26 (s, 12H).

[0669] Synthesis of Intermediate 12: 2-(5,5-difluoro-l,3a,4,5,6,6a-hexahydro pentabenz-2-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane

[0670]

[0671] Step 1 : To a cold (0 °C) solution of hexahydro-pentene-2,5-dione (5 g, 36.2 mmol) in DCM (250 mL) was added a solution of Deoxo Fluor (16 g, 72.4 mmol) in DCM (100 mL) followed by a catalytic amount of ethanol (0.50 g, 10.8 mmol). The reaction mixture was stirred at room temperature for 16 h. The reaction was quenched with saturated sodium bicarbonate, diluted with DCM (300 mL), washed with water (200 mL), brine (200 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate: hexane = 0-10%) to give the product 5,5-difluorohexahydro-penten-2(lH)-one (600 mg, 3.7 mmol, 10.2% yield) as a yellow oil. 1 H NMR (400 MHz, CDC13) δ 2.96 - 2.92 (m, 2H), 2.59 - 2.49 (m, 4H), 2.20 (dd, J = 19.3, 4.3 Hz, 2H), 2.10 - 1.85 (m, 2H).

[0672] Step 2: To a solution of 5,5-difluorohexan-2-one (400 mg, 2.498 mmol) in THF (20 mL) was added LDA (2.5 mL, 4.995 mmol) at -78 °C under nitrogen. The mixture was stirred at this temperature for 0.5 h, then 1,1,1-trifluoro-N-phenyl-N-((trifluoromethyl)sulfonyl)methane sulfonamide (892.23 mg, 2.4975 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with Sat. NH4CI, diluted with DCM (40 mL), washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate: hexane = 0-30%) to give 5,5-difluoro-l,3a,4,5,6,6a-hexahydro-penten-2-yl trifluoromethanesulfonate (300 mg, 0.72 mmol, 28.8% yield) as a light yellow oil. 1H NMR (400 MHz, CDC13) δ 5.60 (d, J = 1.8 Hz, 1H), 3.44 - 3.30 (m, 1H), 2.99-2.89 (m, 2H), 2.46 - 2.27 (m, 3H), 2.02 - 1.87 (m, 2H).

[0673] Step 3: A mixture of 5,5-difluoro-l,3a,4,5,6,6a-hexahydro-penten-2-yl triflate (300 mg, 1.027 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2- dioxaborolane (286.76 mg, 1.129 mmol), Pd(dppf)Cl2(75.12 mg, 0.103 mmol) and KOAc (302.26 mg, 3.080 mmol) in dioxane (20 mL) was stirred at 80 °C for 10 h. The mixture was concentrated and purified quickly (ethyl acetate:hexane = 0-5%) to give the product 2-(5,5-difluoro-l,3a,4,5,6,6a-hexahydro-penten-2-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane (130 mg, 0.48 mmol, 46.9% yield) as colorless oil. 1 H NMR (400 MHz, CDC13) δ 6.33 (dd, J = 4.1, 2.0 Hz, 1H), 3.38 - 3.30 (m, 1H), 2.92 - 2.82 (m, 1H), 2.76 - 2.68 (m, 1H), 2.36 - 2.20 (m, 3H), 1.98 - 1.75 (m, 2H), 1.27 (d, J = 8.2 Hz, 12H).

[0674] Synthesis of Intermediate 13: 4,4,5,5-Tetramethyl-2-(l-oxaspiro[4.5]dec-7-en-8-yl)-l,3,2-dioxaborolane

[0675]

[0676] Step 1: To a solution of 1-oxaspiro[4.5]decan-8-one (200 mg, 1.3 mmol) in THF (5 mL) was added LDA (1.5 mL, 2.6 mmol) at -78 °C under nitrogen, the mixture was stirred at this temperature for 0.5 h, then 1,1,1-trifluoro-N-phenyl-N- ((trifluoromethyl)sulfonyl)methanesulfonamide (505 mg, 1.3 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with Sat. NH4Cl, diluted with DCM (40 mL), then washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate:hexane = 0~10%) to give the product 1-oxaspiro[4.5]decan-7-en-8-yl trifluoromethanesulfonate (150 mg, 0.52 mmol, yield: 40.3%) as yellow oil. 1 H NMR (400 MHz, CDC13) δ 5.75-5.65 (m, 1H), 3.95-3.80 (m, 2H), 2.65-2.55 (m, 1H), 2.40-2.20 (m, 3H), 2.05-1.85 (m, 3H), 1.80-1.70 (m, 3H).

[0677] Step 2: A mixture of 1-oxaspiro[4.5]decan-7-en-8-yl trifluoromethanesulfonate (150 mg, 0.52 mmol), 4,4,5,5-tetramethyl-2-(4,4,4,5,5-4-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2- borinoane (146 mg, 0.57 mmol), Pd(dppf)Cl2(38 mg, 0.05 mmol) and KOAc (103 mg, 1.04 mmol) in dioxane (5 mL) was stirred at 80 °C for 3 h. The mixture was concentrated and purified quickly (ethyl acetate:hexane = 0~10%) to give the product 4,4,4,,55-tetramethyl-2-{1-oxaspiro[4.5]decan-7-en-8-yl}-1,3,2-dioxaborolane (80 mg, 0.3 mmol, yield: 58.2%) as yellow oil. 1 H NMR (400 MHz, CDC13) δ 6.50-6.45 (m, 1H), 3.95-3.80 (m, 2H), 2.40-2.15 (m, 4H), 1.95-1.85 (m, 2H), 1.75-1.55 (m, 4H), 1.25 (s, 12H).

[0678] Synthesis of intermediate 14: 4,4,5,5-tetramethyl-2-(5-oxaspiro[3.4]oct-7-en-7-yl)-1,3,2- dioxaborolane

[0679] Synthesis of intermediate 14: 4,4,5,5-tetramethyl-2-(5-oxaspiro[3.4]oct-7-en-7-yl)-1,3,2- dioxaborolane

[0679] Synthesis of intermediate 14: 4,4,5,5-tetramethyl-2-(5-oxaspiro[3.4]oct-7-en-7-yl)-1,3,2- dioxaborolane

[0679]

[0680] Step 1: To a solution of 5-oxaspiro[3.4]octan-7-one (300 mg, 2.38 mmol) in THF (5 mL) was added LDA (2.5 mL, 4.75 mmol) at -78 °C under nitrogen, the mixture was stirred at this temperature for 0.5 h, then 1,1,1-trifluoro-N-phenyl-N-((trifluoromethyl)sulfonyl)methane sulfonamide (926 mg, 2.38 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with Sat. NH4Cl, diluted with DCM (40 mL), then washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate:hexane = 0~10%) to give the product 5-oxaspiro[3.4]oct-7-en-7-yl trifluoromethanesulfonate (150 mg, 0.58 mmol, yield: 24.4%) as yellow oil. 1 H NMR (400 MHz, CDCl3) d 6.05-6.02 (m, 1H), 4.20-4.10 (m, 1H), 3.96 (s, 1H), 2.45-2.15 (m, 6H).

[0681] Step 2: A mixture of 5-oxaspiro[3.4]oct-7-en-7-yl trifluoromethanesulfonate (100 mg, 0.38 mmol), 4,4,5,5-tetramethyl-2-(4,4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (108 mg, 0.42 mmol), Pd(dppf)Cl2(28 mg, 0.038 mmol) and KOAc (76 mg, 0.77 mmol) in dioxane (5 mL) was stirred at 80 °C for 3 h. The mixture was concentrated and purified quickly (ethyl acetate:hexane = 0~10%) to give the product 4,4,4,,5,5-tetramethyl-2-{5-oxaspiro[3.4]oct-7-en-7-yl}-1,3,2-dioxaborolane (25 mg, 0.1 mmol, yield: 27.8%) as yellow oil. 1 H NMR (400 MHz, CDCl3) d 7.75-7.70 (m, 1H), 4.68 (dd, J = 13.2, 2.0 Hz, 2H), 2.35-2.30 (m, 2H), 2.20-2.05 (m, 2H), 1.65-1.55 (m, 2H), 1.19 (s, 12H).

[0682] Synthesis of Intermediate 15: 4,4,5,5-tetramethyl-2-(3,3a,4,6a-tetrahydro-1H- cyclopenta[c]furan-5-yl)-1,3,2-dioxaborolane

[0683]

[0684] Step 1: To a stirred solution of phosphorous acid triphenyl ester (737.88 mg, 2.378 mmol) in DCM (15 mL) was added Br2(329.37 mg, 2.061 mmol) under nitrogen at -60 °C. The reaction mixture was stirred at -60 °C for 30 min. Then TEA (320.85 mg, 3.171 mmol) was added and stirred at -60 °C for 30 min. Then tetrahydro-lH-cyclopenta[c]furan-5(3H)-one (200 mg, 1.585 mmol) was added. The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with water (20 mL). The crude mixture was extracted with DCM (50 mL*3), the combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo, then purified by flash chromatography (ethyl acetate / hexane = 0-10%) to give the product 5-bromo-3,3a,4,6a-tetrahydro-lH-cyclopenta[c]furan as a light yellow oil (143 mg, 0.756 mmol, yield: 47.7%). 1 H NMR (400 MHz, CDC13) δ 5.72 (dd, J = 4.3, 2.1 Hz, 1H), 3.89 - 3.53 (m, 4H), 3.39 - 3.28 (m, 1H), 3.10 - 2.84 (m, 2H), 2.48 - 2.26 (m, 1H).

[0685] Step 2: To a solution of 5-bromo-3,3a,4,6a-tetrahydro-lH-cyclopenta[c]furan (143 mg, 0.756 mmol), 4,4,5,5-tetramethyl-2-(4,4,4,5,5-4-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2- dioxaborolane (211.29 mg, 0.832 mmol) and KOAc (148.47 mg, 1.513 mmol) in dioxane (15 mL) was added Pd(dppf)Cl2(54.89 mg, 0.0756 mmol). The reaction mixture was stirred at 80 °C for 3 h under nitrogen. The mixture was concentrated under vacuum. Then purified by flash chromatography (ethyl acetate / hexane = 0-3%) to give the product 4,4,5,5-tetramethyl-2-(3,3a,4,6a-tetrahydro-lH-cyclopenta[c]furan-5-yl)-l,3,2-dioxaborolane as a colorless oil (37 mg, 0.157 mmol, yield: 20.7%). 1H NMR (400 MHz, CDC13) δ 6.29 - 6.27 (m, 1H), 3.86 - 3.72 (m, 2H), 3.75 - 3.67 (m, 1H), 3.54 - 3.41 (m, 2H), 2.70 - 2.66 (m, 1H), 2.34 - 2.30 (m, 1H), 2.06 - 2.00 (m, 1H), 1.26 (s, 12H).

[0686] Synthesis of intermediate 16: 2-(4,4-difluorocyclohept-l-en-l-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane and 2-(5,5-difluorocycloheptane-l-en-l-yl)-4,4,5,5-tetramethyl-l,2,2-dioxaborolane

[0687]

[0688] Step 1: A solution of 4,4-difluorocyclohexan-l-one (1000 mg, 7.456 mmol), ethyl 2-diazoacetate (1106 mg, 9.693 mmol) and BF3.Et20 (1376 mg, 9.663 mmol) in DCM (20 mL) was stirred at -10 °C for 2 hours. The mixture was concentrated and purified by flash chromatography (ethyl acetate / hexane = 0-10%) to give the product ethyl 5,5-difluoro-2-oxocycloheptane-l-carboxylate (500 mg, 1.930 mmol, yield: 25.9%) as an oil. 1 H NMR (400 MHz, CDC13) δ 4.26 - 4.19 (m, 2H), 2.81 - 2.52 (m, 1H), 2.49 - 2.44 (m, 2.5H), 2.38 - 1.85 (m, 5.5H), 1.34 - 1.26 (m, 3H).

[0689] Step 2: A solution of ethyl 5,5-difluoro-2-oxocycloheptane-l-carboxylate (5.6 g, 25.4 mmol) in 3 M aqueous HC1 (13.5 mL) was stirred at 100 °C for 16 hours. The reaction mixture was added to water (50 mL), extracted with ethyl acetate (50 mL*3), the combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuum, then purified by flash chromatography (ethyl acetate / hexane = 0-10%) to give the product 4,4-difluorocycloheptan-l-one (2.3 g, 0.016 mmol, yield: 61.0%) as a light colorless oil. 1 H NMR (400 MHz, CDC13) δ 2.63 - 2.52 (m, 4H), 2.26 - 2.07 (m, 4H), 1.92 - 1.84 (m, 2H).

[0690] Step 3: To a stirred solution of phosphorous acid triphenyl ester (1256.63 mg, 4.05 mmol) in DCM (15 mL) at -60 °C under nitrogen was added Br2(560.93 mg, 3.51 mmol). The reaction mixture was stirred at -60 °C for 30 min. Then TEA (546.43 mg, 5.4 mmol) was added and stirred at -60 °C for 30 min. Then 4,4-difluorocycloheptan-l-one (400 mg, 2.7 mmol) was added. The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with water (20 mL). The crude mixture was extracted with DCM (50 mL*3), the combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuum, then purified by flash chromatography (ethyl acetate / hexane = 0-3%) to give a mixture of 1-bromo-4,4-difluorocyclohepta-l-ene and 1-bromo-5,5-difluorobicyclohepta-l-ene (320 mg, 1.516 mmol, yield: 56.2%) as colorless oil. 1 HNMR (400 MHz, CDC13) δ 6.27 - 5.95 (m, 1H), 2.90 - 2.55 (m, 2.5H), 2.24 - 1.62 (m, 5.5H).

[0691] Step 4: To a stirred solution of 1-bromo-4,4-difluorocyclohepta-l-ene and 1-bromo-5,5-difluorobicyclohepta-l-ene (320 mg, 1.516 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2-dioxaborolane (423.52 mg, 1.668 mmol) and KOAc (297.61 mg, 3.032 mmol) in dioxane (10 mL) was added Pd(dppf)Cl2(110.02 mg, 0.152 mmol). The reaction mixture was stirred at 80 °C for 10 h under nitrogen. The mixture was concentrated under vacuum. Then purified by flash chromatography (ethyl acetate / hexane = 0-1%) to give a mixture of 2-(4,4-difluorocyclohepta-l-en-l-yl)-4,4,5,5-tetramethyl-l,3,2-dioxaborolane and 2-(5,5-difluorocyclohexa-l-en-l-yl)-4,4,5,5-tetramethyl-l,3,4-dioxaborolane (110 mg, 0.426 mmol, yield: 28.1%) as colorless oil. 1 H NMR (400 MHz, CDC13) δ 6.84 - 6.37 (m, 1H), 2.30 - 2.25 (m, 4H), 1.97 - 1.85 (m, 4H), 1.31 - 1.22 (m, 12H).

[0692] Synthesis of intermediate 19: 2-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-5,6- dihydro-4H-pyrrolo[l,2-b]pyrazole

[0693]

[0694] Step 1: To a solution of pyrrolidine-2-carboxylic acid (250 mg, 2.17 mmol) in pure water (1 mL) was added NaNCte (210 mg, 3.04 mmol) and HC1 (0.5 mL) at 0 °C. The mixture was stirred at 25 °C for 6 h. The mixture was diluted with pure water (10 mL) and extracted with DCM (15 mL*8). The combined organic was dried over anhydrous sodium sulfate, filtered, and concentrated to give the product nitroso proline (140 mg, 0.87 mmol, 40.3% yield) as a white solid.

[0695] Step 2: To a solution of l-nitroproline (1.6 g, 11.1 mmol) in MeCN (20 mL) was added TFAA (4.66 g, 22.2 mmol) at 0 °C. The mixture was stirred at 25 °C for 2 h. Then K2CO3 (3.07 g, 22.2 mmol) was added and the mixture was further stirred at 24 °C for 1 h. The mixture was filtered, the filtrate was concentrated and purified quickly (MeOH / DCM = 0~10%) to give the product 5,6-dihydro-4H-pyrrolo[l,2-c][l,2,3]oxadiazol-7-ium-3-olate (0.82 g, 5.9 mmol, 53.1% yield) as a yellow oil. MS (ESI) m / z = 253.1 [M+H] + .

[0696] Step 3: A mixture of 5,6-dihydro-4H-pyrrolo[l,2-c][l,2,3]oxadiazol-7-ium-3-olate (820 mg, 6.5 mmol), 2-ethynyl-4,4,5,5-tetramethyl-l,3,2-dioxaborolane (1.98 g, 13.0 mmol) in xylene (15 mL) was stirred at 160 °C for 20 h. The mixture was concentrated and purified by preparative high performance liquid chromatography (Gemini-C18 150*21.2 mm, 5 um: MeCN-H2O (0.1% TFA): 5-40) to give the product 2-(4,4,4,5,5-tetramethyl-l,3,4-dioxaborolan-2-yl)-5,6-dihydro-4H-pyrrolo[l,2-b]pyrazole (180 mg, 0.61 mmol, 9.5% yield). 1H NMR (400 MHz, DMSO-d6) δ 6.21 (s, 1H), 4.07 - 4.03 (m, 2H), 2.82 - 2.77 (m, 2H), 2.57 - 2.52 (m, 2H), 1.25 (s, 12H).

[0697] The following compounds were synthesized using the above method:

[0698]

[0699] Synthesis of Intermediate 20: 4,5,6,7-tetrahydroisoxazolo[4,3-c]pyridine hydrochloride

[0700]

[0701] Step 1: Prop-2-enal (3.2 g, 20.6 mmol) and camphor sulfonic acid (0.96 g, 4 mmol) were added to a cooled ice-water bath solution of tert-butyl N-(prop-2-yn-1-yl)carbamate (11.5 g, 206 mmol) in DCM (60 mL), the resulting mixture was stirred at 0 °C for 15 min, then stirred at room temperature for 4 h. The mixture was diluted with water (50 mL), extracted with DCM (50 mL*3). The combined organic layers were washed with brine (100 mL), dried over anhydrous sodium sulfate, then concentrated under vacuum, purified by flash chromatography (ethyl acetate / hexane = 0-10%) to give the product tert-butyl N-(3-oxopropyl)-N-(prop-2-yn-1-yl)carbamate (1.7 g, 8 mmol, yield: 38%) as yellow oil. 1 H NMR (400 MHz, CDCl3) δ 9.81 (t, J = 1.4 Hz, 1H), 4.07 (d, J = 17.2 Hz, 2H), 3.64 (t, J = 6.6 Hz, 2H), 2.79 (t, J = 6.4 Hz, 2H), 2.23 (t, J = 2.4 Hz, 1H), 1.53 - 1.41 (m, 9H).

[0702] Step 2: Hydroxylamine hydrochloride (615 mg, 8.85 mmol) was added to a cooled ice-water bath suspension of tert-butyl N-(3-oxopropyl)-N-(prop-2-yn-1-yl)carbamate (1.7 g, 8 mmol) in pure water / ethanol (30 mL / 10 mL), then a solution of NaOH (708 mg, 17.7 mmol) dissolved in ethanol / pure water (5 mL / 10 mL) was added dropwise to the mixture over 15 minutes. The resulting mixture was stirred at room temperature for 3 hours. Then the mixture was concentrated in vacuo, diluted with water (50 mL), extracted with MTBE (50 mL*3). The combined organic layers were washed with brine (100 mL), dried over anhydrous sodium sulfate, then concentrated under vacuum and purified by flash chromatography (ethyl acetate / hexane = 0-30%) to give the product tert-butyl N-[(3E)-3-(hydroxyimino)propyl]-N-(prop-2-yn-1-yl)carbamate (1.5 g, 6.6 mmol, yield: 82%) as a yellow oil. MS (ESI) m / z = 249.1 [M+Na] + .

[0703] Step 3: To a solution of tert-butyl N-[(3Z)-3-(hydroxyimino)propyl]-N-(prop-2-yn-1-yl)carbamate (1500 mg, 6.63 mmol) in MeCN (15 mL) was added a suspension of chloramine-T trihydrate (1640 mg, 6.63 mmol). The reaction mixture was stirred at 85 °C for 6 hours. The mixture was diluted with water (30 mL), extracted with MTBE (30 mL*3). The combined organic layers were washed with brine (30 mL), dried over anhydrous sodium sulfate, then concentrated under vacuum and purified by flash chromatography (ethyl acetate / hexane = 0-50%) to give the product tert-butyl 6,7-dihydroisoxazolo[4,3-c]pyridine-5(4H)-carboxylate (650 mg, 2.90 mmol, 43.8% yield) as a yellow oil. 1 H NMR (400 MHz, CDCl3) d 8.20 (s, 1H), 4.53 (s, 2H), 3.70 (t, J = 5.6 Hz, 2H), 2.87 (t, J = 5.9 Hz, 2H), 1.49 (s, 9H).

[0704] Step 4: To a solution of tert-butyl 6,7-dihydroisoxazolo[4,3-c]pyridine-5(4H)- carboxylate (650 mg, 2.90 mmol) in DCM (3 mL) was added a solution of HC1 in dioxane (1 mL, 4 M). The reaction mixture was stirred at room temperature for 2 hours. Then concentrated in vacuo to give the crude product 4,5,6,7-tetrahydroisoxazolo[4,3-c]pyridine hydrochloride (300 mg, 2.41 mmol, yield: 83%) as a yellow solid. MS (ESI) m / z = 125.1 [M+H] + .

[0705] Synthesis of Intermediate 22: tert-butyl 4-(2-(4-(difluoromethyl)piperidin-l-yl)-5- ethyl-4-(2-((2-methyl-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-7-oxo-4,7- dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate

[0706]

[0707] Step 1: To a solution of 2-methyl-4-(trifluoromethyl)aniline (175 mg, 1 mmol) in DCM (10 mL) was added DIPEA (387 mg, 3 mmol) and 2-bromoacetyl bromide (605 mg, 3 mmol) at 0 °C. The mixture was stirred at room temperature for 16 hours. The mixture was diluted with water (20 mL) and extracted with DCM (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuo and purified by flash chromatography (ethyl acetate / hexane = 0-13%) to give the product 2-bromo-N-(2-methyl-4-(trifluoromethyl)phenyl)acetamide (181 mg, 0.61 mmol, 61% yield) as a white solid. MS (ESI) m / z = 295.9, 297.9 [M+H] + .

[0708] Step 2: Add 2-bromo-N-[2-methyl-4-(trifluoromethyl)piperidin-1-yl]-5-ethyl-7-oxo-4H-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl}piperazine-1-carboxylic acid tert-butyl ester (80 mg, 0.1668 mmol) to a DMF (10 mL) solution, along with 2-bromo-N-[2-methyl-4-(trifluoromethyl)phenyl]acetamide (74.08 mg, 0.25 mmol) and DIPEA (64.67 mg, 0.5 mmol). Stir the mixture at room temperature for 16 hours. Dilute the mixture with water (20 mL) and extract with ethyl acetate (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated under vacuum, and purified by rapid chromatography (ethyl acetate / hexane = 0-70%) to give a white solid product, 4-(2-(4-(difluoromethylene)piperidin-1-yl)-5-ethyl-4-(2-(2-methyl-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylic acid tert-butyl ester (100 mg, 0.14 mmol, 87% yield). MS (ESI) m / z = 695.2 [M+H] + .

[0709] Intermediate 23: Synthesis of tert-butyl piperazine-1-yl)-5-ethyl-4-(2-((2-methyl-6-(trifluoromethyl)pyridin-3-yl)amino)-2-oxoethyl)-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylate

[0710]

[0711] Step 1: To a solution of 2-methyl-6-(trifluoromethyl)pyridin-3-amine (150 mg, 0.85 mmol) in DCM (10 mL), TEA (257 mg, 2.55 mmol) and 2-bromoacetyl bromide (515 mg, 2.55 mmol) were added. The reaction mixture was stirred at room temperature for 5 hours. The mixture was diluted with water (10 mL) and extracted with DCM (10 mL x 3). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate, concentrated under vacuum, and purified by rapid chromatography (ethyl acetate / hexane = 0-25%) to give a white solid product 2-bromo-N-[2-methyl-6-(trifluoromethyl)pyridin-3-yl]acetamide (200 mg, 0.67 mmol, 79% yield). MS (ESI) m / z = 297.0, 298.9 [M+H] + .

[0712] Step 2: Add 2-bromo-N-[2-methyl-6-(trifluoromethyl)piperidin-1-yl]-5-ethyl-7-oxo-4H-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl]piperazine-1-carboxylic acid tert-butyl ester (50 mg, 0.1 mmol) to a DMF (5 mL) solution of 4-{2-[4-(difluoromethyl)piperidin-3-yl]acetamide (46.48 mg, 0.15 mmol) and DIPEA (40.44 mg, 3 mmol). Stir the mixture at room temperature for 16 hours. Dilute the mixture with water (20 mL) and extract with ethyl acetate (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated under vacuum, and purified by rapid chromatography (ethyl acetate and hexane = 0-70%) to give a colorless oily product, 4-(2-(4-(difluoromethylene)piperidin-1-yl)-5-ethyl-4-(2-((2-methyl-6-(trifluoromethyl)pyridin-3-yl)amino)-2-oxoethyl)-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylic acid tert-butyl ester (62 mg, 0.089 mmol, 85% yield). MS (ESI) m / z = 640.2 [M+H-56] + .

[0713] Intermediate 24: Synthesis of tert-butyl piperazine-1-yl)-5-ethyl-7-oxo-4-(2-oxo-2-((4-(trifluoromethyl)phenyl)amino)ethyl)-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylate

[0714]

[0715] Step 1: To a solution of 4-(trifluoromethyl)aniline (322 mg, 2 mmol) in DCM (20 mL), TEA (606 mg, 6 mmol) and 2-bromoacetyl bromide (1.21 g, 6 mmol) were added. The reaction mixture was stirred at room temperature for 16 hours. The mixture was diluted with water (20 mL) and extracted with DCM (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated under vacuum, and purified by rapid chromatography (ethyl acetate / hexane = 0-8%) to give the product 2-bromo-N-(4-(trifluoromethyl)phenyl)acetamide (350 mg, 1.24 mmol, 62% yield), as a yellow solid. MS (ESI) m / z = 281.9, 283.9 [M+H] + .

[0716] Step 2: To a solution of tert-butyl 4-{2-[4-(difluoromethyl)piperidin-l-yl]-5- ethyl-7-oxo-4H-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl}piperazine-l-carboxylate (80 mg, 0.17 mmol) in DMF (5 mL) was added 2-bromo-N-[4- (trifluoromethyl)phenyl]acetamide (70 mg, 0.25 mmol) and DIPEA (65 mg, 0.5 mmol). The mixture was stirred at room temperature for 16 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (ethyl acetate hexanes = 0-50%) to give tert-butyl 4-(2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-4-(2-oxo-2-((4- (trifluoromethyl)phenyl)amino)ethyl)-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine- 1-carboxylate (110 mg, 0.16 mmol, 96% yield) as a yellow solid. MS (ESI) m / z = 681.3 [M+H] + .

[0717] Synthesis of Intermediate 26: tert-butyl 4-(4-(2-(2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl)amino)-2-oxoethyl)-2-(4-(difluoromethyl)piperidin-l-yl)-5-ethyl-7-oxo-4,7- dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate

[0718]

[0719] Step 1: Add 2-bromo-N-[2-chloro-4-(pentafluoro-λ6-thioalkyl)phenyl]acetamide (117 mg, 0.31 mmol) and DIPEA (81 mg, 0.63 mmol) to a DMF (10 mL) solution of 4-{2-[4-(difluoromethylene)piperidin-1-yl]-5-ethyl-7-oxo-4H-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl}piperazine-1-carboxylic acid tert-butyl ester (100 mg, 0.21 mmol). Stir the mixture at room temperature for 16 hours. Dilute the mixture with water (20 mL) and extract with ethyl acetate (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated under vacuum, and purified by rapid chromatography (ethyl acetate / hexane = 0-70%) to give the solid product 4-(4-(2-chloro-4-(pentafluoro-λ6-sulfonyl)phenyl)amino)-2-oxoethyl)-2-(4-(difluoromethylene)piperidin-1-yl)-5-ethyl-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylic acid tert-butyl ester (80 mg, 0.10 mmol, 49% yield). MS (ESI) m / z = 716.8 [M+H-56] + .

[0720] Intermediate 27: Synthesis of 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidin-4-carbonyl)piperazin-1-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-6-(trifluoromethyl)pyridin-3-yl)acetamide

[0721]

[0722] Step 1: At 0 °C, 2-bromoacetyl bromide (1.54 g, 7.63 mmol) was added to a solution of 2-chloro-6-(trifluoromethyl)pyridin-3-amine (500 mg, 2.54 mmol) and TEA (772 mg) in DCM (5 mL). The mixture was stirred at room temperature for 16 hours. The mixture was rapidly purified (ethyl acetate:hexane = 0–30%) to give a yellow solid of 2-bromo-N-[2-chloro-6-(trifluoromethyl)pyridin-3-yl]acetamide (600 mg, 1.89 mmol, yield: 74.4%). MS (ESI) m / z = 318.9 [M+H] + .

[0723] Step 2: A mixture of 4-{2-bromo-5-ethyl-7-oxo-4H-[1,2,4]triazolo[1,5-A]pyrimidin-6-yl}piperazine-1-carboxylic acid tert-butyl ester (100 mg, 0.23 mmol), 2-bromo-N-[2-chloro-6-(trifluoromethyl)pyridin-3-yl]acetamide (89 mg, 0.28 mmol), and DIEA (90 mg, 0.7 mmol) in DMF (3 mL) was stirred at room temperature for 6 hours. The mixture was rapidly purified (MeOH:DCM = 0–10%) to obtain 5-ethyl-7-oxo-[1,2,4]triazolo[1,5-A]pyrimidin-6-yl]piperazine-1-carboxylate (100 mg, 0.15 mmol, yield: 65.4%) as a gray solid. MS (ESI) m / z = 609.1 [M+H-56] + .

[0724] Step 3: Add HCl / dioxane (1 mL, 4 M) to a DCM solution of tert-butyl piperazine-1-carboxylate (100 mg, 0.15 mmol) containing 4-(2-bromo-4-(2-((2-chloro-6-(trifluoromethyl)pyridin-3-yl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylate (2 mL) and stir at room temperature for 1 hour. The mixture was concentrated to give 2-(2-bromo-5-ethyl-7-one-6-(piperazin-1-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-6-(trifluoromethyl)pyridin-3-yl)acetamide (90 mg, 0.16 mmol, yield: 106.3%), as a white solid. MS (ESI) m / z = 565.1 [M+H] + .

[0725] Step 4: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (49 mg, 0.32 mmol), HOAt (54 mg, 0.39 mmol) and EDCI (76 mg, 0.39 mmol) in MeCN (6 mL) was stirred at room temperature for 1 h under nitrogen atmosphere, then 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-6-(trifluoromethyl)pyridin-3- yl)acetamide (90 mg, 0.16 mmol) and DIPEA (103 mg, 0.79 mmol) were added in MeCN (3 mL), the mixture was purified quickly (MeOH:DCM=0~10%), to give the product 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-6-(trifluoromethyl)pyridin-3- yl)acetamide (70 mg, 0.1 mmol, yield: 62.5%) as a yellow solid. MS (ESI) m / z = 701.0 [M+H] + .

[0726] Synthesis of Intermediate 28: 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(4- (trifluoromethyl)phenyl)acetamide

[0727]

[0728] Step 1: To a solution of 4-(trifluoromethyl)aniline (1 g, 6.2 mmol) in DCM (20 mL) was added TEA (1.87 g, 18.6 mmol) and 2-bromoacetyl bromide (3.75 g, 18.6 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 16 h. The mixture was diluted with water (20 mL) and extracted with DCM (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuo and purified by flash chromatography (ethyl acetate / hexane = 0-8%) to give the product 2-bromo-N-(4-(trifluoromethyl)phenyl)acetamide (1.4 g, 5 mmol, 80% yield) as a yellow solid. MS (ESI) m / z = 282.0, 284.0 [M+H] + .

[0729] Step 2: To a solution of tert-butyl 4-{2-bromo-5-ethyl-7-oxo-4H- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl}piperazine-l-carboxylate (1.5 g, 3.5 mmol) in MeCN (20 mL) was added 2-bromo-N-[4-(trifluoromethyl)phenyl]acetamide (1.48 g, 5.2 mmol) and DIPEA (1.36 g, 10.5 mmol). The mixture was stirred at 50 °C for 16 h. The mixture was concentrated under vacuum and purified by flash chromatography (ethyl acetate / hexanes = 0-50%) to give the product tert-butyl 4-(2-bromo-5-ethyl-7-oxo-4-(2-oxo-2-((4- (trifluoromethyl)phenyl)amino)ethyl)-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine- 1-carboxylate (335 mg, 0.5 mmol, 14% yield). MS (ESI) m / z = 572.0, 574.0 [M+H-56] + .

[0730] Step 3: To a solution of tert-butyl 4-[2-bromo-5-ethyl-7-oxo-4-({[4- (trifluoromethyl)phenyl]carbamoyl}methyl)-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl]piperazine-l- carboxylate (335 mg, 0.53 mmol) in DCM (5 mL) was added a solution of HC1 in dioxane (5 mL, 4 M). The mixture was stirred at room temperature for 2 h. The mixture was concentrated under vacuum to give the crude product 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(4-(trifluoromethyl)phenyl)acetamide (300 mg, 0.56 mmol, 100% yield) as a white solid. MS (ESI) m / z = 528.0. 530.0 [M+H] + .

[0731] Step 4: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (164 mg, 1.06 mmol), HOAt (181 mg, 1.32 mmol) and EDCI (254 mg, 1.3 mmol) in MeCN (25 mL) was stirred at room temperature for 1 h, then 2-[2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4-yl]-N-[4-(trifluoromethyl)phenyl]acetamide (300 mg, 0.53 mmol) and DIEA (412 mg, 3.18 mmol) in MeCN (5 mL) was added, the mixture was stirred at room temperature for 1 h. The mixture was diluted with water (30 mL), extracted with ethyl acetate (30 mL*3). The combined organic layers were washed with brine (30 mL), dried over anhydrous sodium sulfate, concentrated in vacuum, and purified by flash chromatography (MeOH:DCM=0-5%) to give 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(4-(trifluoromethyl)phenyl)acetamide (152 mg, 0.228 mmol, 43% yield) as a white solid. MS (ESI) m / z = 664.0, 665.9 [M+H] +

[0732] Synthesis of Intermediate 29: tert-Butyl 4-(2-bromo-4-(2-(2-chloro-4-(pentafluoro-λ6-sulfanylidenamino)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine- 1 -carboxylate

[0733]

[0734] Step 1: To a solution of 4-(pentafluoro-λ6-sulfanylidenamino)aniline (1700 mg, 7.75 mmol) in MeCN (20 mL) was added NCS (1035 mg, 7.75 mmol), the mixture was stirred at 45 °C for 16 h. The mixture was diluted with water (20 mL), extracted with DCM (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum, and purified by flash chromatography (ethyl acetate / hexanes = 0-20%) to give the product 2-chloro-4-(pentafluoro-λ6-sulfanylidenamino)aniline (1500 mg, 5.91 mmol, 76% yield) as a yellow oil. MS (ESI) m / z = 253.9 [M+H] + .

[0735] Step 2: To a solution of 2-chloro-4-(pentafluoro-λ6-sulfanyl)aniline (1500 mg, 5.91 mmol) in DCM (15 mL) was added 2-bromoacetyl bromide (3581 mg, 17.74 mmol) and TEA (1795 mg, 17.74 mmol). The mixture was stirred at room temperature for 1 hour. The mixture was diluted with water (20 mL) and extracted with DCM (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (ethyl acetate / hexane = 0-30%) to give the product 2-bromo-N-[2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl]acetamide (900 mg, 2.40 mmol, 40.6% yield) as a white solid. MS (ESI) m / z = 375.7 [M+H] + .

[0736] Step 3: To a solution of tert-butyl 4-{2-[4-(difluoromethyl)piperidin-l-yl]-5-ethyl-7-oxo-4H- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl}piperazine-l-carboxylate (450 mg, 1.053 mmol) in DMF (10 mL) was added 2-bromo-N-[2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl]acetamide (512 mg, 1.37 mmol) and DIPEA (408 mg, 3.16 mmol). The mixture was stirred at room temperature for 16 hours. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum, purified by flash chromatography (ethyl acetate / hexane = 0-70%) to give the product tert-butyl 4-(2-bromo-4-(2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl)amino)-2-oxoethyl)-5- ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (280 mg, 0.38 mmol, 36% yield) as a yellow solid. MS (ESI) m / z = 663.7 [M+H] +

[0737] Step 4: To a solution of tert-butyl 4-(2-bromo-4-(2-(2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl)amino)-2- oxoethyl)-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l- carboxylate (100 mg, 0.138 mmol) in DCM (5 mL) was added a solution of HC1 in dioxane (3 mL, 4 M). The mixture was stirred at room temperature for 2 hours. The mixture was concentrated under vacuum to give the crude product 2-[2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4-yl]-N-[2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl]acetamide (80 mg, 0.13 mmol, 93% yield) as a white solid. MS (ESI) m / z = 619.8 [M+H] +

[0738] Step 5: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (60 mg, 0.387 mmol), HOAt (43 mg, 0.32 mmol) and EDCI (62 mg, 0.32 mmol) in MeCN (15 mL) was stirred at room temperature under argon for 1 hour, then 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl)acetamide (80 mg, 0.13 mmol) and DIEA (83 mg, 0.64 mmol) in MeCN (5 mL) were added, and the mixture was stirred at room temperature for 1 hour. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and concentrated in vacuum, purified by flash chromatography (MeOH / DCM = 0-5%) to give the product 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(pentafluoro-λ6-sulfanyl)phenyl)acetamide (40 mg, 0.052 mmol, 40.7% yield) as a yellow solid. MS (ESI) m / z = 755.7 [M+H] + .

[0739] Intermediate 30: Synthesis of 4,4,5,5-tetramethyl-2-(3-oxaspiro[5.5]undec-8-en-9-yl)-l,3,2- dioxaborolane

[0740]

[0741] Step 1: To a solution of 3-oxaspiro[5.5]undecan-9-one (250 mg, 1.49 mmol) in THF (8 mL) was added LDA (1.2 mL, 2.40 mmol, 2 M in THF) at -78 °C under nitrogen. The mixture was stirred at this temperature for 0.5 h. Then 1,1,1-trifluoro-N-phenyl-N- ((trifluoromethyl)sulfonyl)methanesulfonamide (637 mg, 1.78 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with saturated NH4Cl and diluted with ethyl acetate (40 mL). Then washed with water (20 mL), brine (20 mL). The organic layer was dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate: hexane = 0-5%) to give the product 3-oxaspiro[5.5]undec-8-en-9-yl trifluoromethanesulfonate (310 mg, 1.03 mmol, 69.5% yield) as colorless oil. 1 H NMR (400 MHz, CDC13) δ 5.69 (t, J = 4.1 Hz, 1H), 3.77 - 3.62 (m, 4H), 2.38-2.31 (m, 2H), 2.14 (dd, J = 6.2, 2.6 Hz, 2H), 1.71 (t, J = 6.5 Hz, 2H), 1.54-1.46 (m, 4H).

[0742] Step 2: A mixture of 3-oxaspiro[5.5]undec-8-en-9-yl trifluoromethanesulfonate (310 mg, 1.03 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-4-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2- dioxaborolane (315 mg, 1.24 mmol), Pd(dppf)Cl2(75 mg, 0.10 mmol) and potassium acetate (203 mg, 2.06 mmol) in dioxane (8 mL) was stirred at 80 °C under nitrogen overnight. The mixture was concentrated and purified quickly (ethyl acetate: hexane = 0-6%) to give the product 4,4,5,5-tetramethyl-2-(3-oxaspiro[5.5]undec-8-en-9-yl)-l,3,2-dioxaborolane (200 mg, 0.72 mmol, 69.6% yield) as colorless oil. 1 H NMR (400 MHz, CDC13) δ 6.49 - 6.44 (m, 1H), 3.71 - 3.60 (m, 4H), 2.15-2.09 (m, 2H), 2.04-2.01 (m, 2H), 1.48 (t, J = 6.4 Hz, 2H), 1.44 - 1.39 (m, 4H), 1.24 (s, 12H).

[0743] Synthesis of Intermediate 31: 3-Fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2- yl)pyrazolo[1,5-a]pyridine

[0744]

[0745] Step 1: To a solution of 5-bromopyrazolo[1,5-a]pyridine (500 mg, 2.537 mmol) in MeCN (10 mL) was added selectfluor (988 mg, 2.7191 mmol). The reaction mixture was stirred at 80 °C for 16 h. The mixture was concentrated under vacuum. Then purified by flash chromatography (ethyl acetate / hexane = 0-5%) to give the product 5-bromo-3-fluoropyrazolo[1,5-a]pyridine (220 mg, 1.023 mmol, 40.3% yield) as a yellow solid. MS (ESI) m / z = 214.9 [M+H] + .

[0746] Step 2: To a solution of 5-bromo-3-fluoropyrazolo[1,5-a]pyridine (100 mg, 0.465 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborane (130 mg, 0.5116 mmol) and KOAc (91 mg, 0.930 mmol) in dioxane (3 mL) was added Pd(dppf)Cl2(34 mg, 0.046 mmol). The reaction mixture was stirred at 80 °C for 16 h under nitrogen. The mixture was concentrated under vacuum to give 3-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazolo[1,5-a]pyridine (50 mg, 0.19 mmol, 41% yield) as a brown oil. MS (ESI) m / z = 263.1 [M+H] + .

[0747] Synthesis of Intermediate 32: 5-(4,4,5,5-Tetramethyl-1,3,2-dioxaborolan-2-yl)-1-((2- (trimethylsilyl)ethoxy)methyl)-1H-indazole

[0748]

[0749] Step 1: To a solution of 5-bromo-lH-indazole (1000 mg, 5.075 mmol) in DMF (10 mL) was added NaH (304 mg, 7.613 mmol). The reaction mixture was stirred at 0 °C for 30 min. Then SEMCl (1269 mg, 7.613 mmol) was added, and the reaction mixture was stirred at 25 °C for 16 h. The mixture was concentrated under vacuum. Then purified by flash chromatography (ethyl acetate / hexanes = 0-5%) to give the product 5-bromo-l-((2-(trimethylsilyl)ethoxy)methyl)-lH-indazole (1500 mg, 4.573 mmol, yield: 90.1%) as a yellow solid. MS (ESI) m / z = 327.0 [M+H] + .

[0750] Step 2: To a solution of 5-bromo-l-((2-(trimethylsilyl)ethoxy)methyl)-lH-indazole (500 mg, 1.523 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-4-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2-dioxaborolane (425 mg, 1.675 mmol), and KOAc (299 mg, 3.046 mmol) in dioxane (3 mL) was added Pd(dppf)Cl2(110 mg, 0.152 mmol). The reaction mixture was stirred at 80 °C for 16 h under nitrogen protection. The mixture was concentrated under vacuum and purified by flash chromatography (ethyl acetate / hexanes = 0-5%) to give 5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-l-((2-(trimethylsilyl)ethoxy)methyl)-lH-indazole (250 mg, 0.66 mmol, yield: 43.7%) as a colorless oil. MS (ESI) m / z = 375.1 [M+H] + .

[0751] Synthesis of Intermediate 33: 2-methyl-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)pyrazolo[l,5-a]pyridine

[0752]

[0753] Step 1: To a solution of 4-bromo-2-methylpyridine (2 g, 11.6 mmol) in THF (20 mL) was added LDA (11.5 mL, 23.2 mmol) at -78 °C under nitrogen, the mixture was stirred at this temperature for 0.5 h, then N-methoxy-N-methylacetamide (1.2 g, 11.6 mmol) was added. The mixture was stirred at 25 °C for 16 h. The reaction was quenched with Sat. NH4Cl, diluted with ethyl acetate (50 mL), washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate:hexane = 0~10%), to give the product 1-(4-bromopyridin-2-yl)propan-2-one (800 mg, 3.74 mmol, yield: 32.2%) as yellow oil. MS (ESI) m / z = 214.0, 216.0 [M+H] + .

[0754] Step 2: To a solution of O-trimesylate acetylhydroxamic acid ethyl ester (2 g, 7 mmol) in dioxane (3 mL) was added HCIO4 (0.8 mL) at 0 °C, the mixture was stirred at 25 °C for 0.5 h, ice water was added to the mixture, then filtered. The collected filter cake was dissolved in DCM (3 mL), 1-(4-bromopyridin-2-yl)propan-2-one (800 mg, 3.74 mmol) was added, the mixture was stirred at 25 °C for 1 h. The mixture was concentrated in vacuum, dissolved in DMF (3 mL), potassium carbonate (1.55 g, 11.2 mmol) was added to the mixture, and stirred at 25 °C for 4 h. The reaction was diluted with water, extracted with ethyl acetate. The combined organic layers were washed with water (20 mL), brine (20 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (ethyl acetate:hexane = 0~10%), to give the product 5-bromo-2-methylpyrazolo[l,5-a]pyridine (110 mg, 0.52 mmol, yield: 13.9%) as yellow oil. MS (ESI) m / z = 213.1 [M+H] + .

[0755] Step 3: A mixture of 5-bromo-2-methylpyrazolo[l,5-A]pyridine (110 mg, 0.52 mmol), 4,4,5,5-tetramethyl-2-(4,4,4,5,5-4-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2- dioxaborolane (147 mg, 0.58 mmol), Pd(dppf)Cl2(37 mg, 0.052 mmol) and KOAc (154 mg, 1.57 mmol) in dioxane (5 mL) was stirred at 90 °C for 16 h under argon. The mixture was concentrated and the residue was purified by combiflash (ethyl acetate:hexane = 0~10%) to give the product 2-methyl-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)pyrazolo[l,5- a]pyridine (50 mg, 0.19 mmol, 37.2% yield) as colorless oil. MS (ESI) m / z = 259.3 [M+H] + .

[0756] Synthesis of intermediate 34: 7-methyl-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2- yl)pyrazolo[l,5-a]pyridine

[0757]

[0758] Step 1: To TFA solvent (10 mL) was added tert-butyl N-{[(2,4,6-trimethylbenzene)sulfonyl]oxy}carbamate (2 g, 6.3 mmol) at 0 °C. The mixture was stirred at this temperature for 2 h. To the mixture was added ice water at 0 °C, then filtered. The filter cake was concentrated to give the product amino 2,4,6-trimethylbenzenesulfonate (1.3 g, 4.8 mmol, 76.2% yield) as white solid. MS (ESI) m / z = 216.1 [M+H] + .

[0759] Step 2: A mixture of amino 2,4,6-trimethylbenzenesulfonate (1.3 g, 6.0 mmol), 4-bromo-2-methylpyridine (0.83 g, 4.8 mmol) in DCM (20 mL) was stirred at 25 °C for 16 h. The mixture was concentrated, triturated with chloroform, filtered. To the filtrate was added ether, filtered. The filter cake was concentrated to give the product l-amino-4-bromo-2-methylpyridin-l-ium (1.2 g, 3.8 mmol, 64.4% yield) as white solid. MS (ESI) m / z = 187.0 [M] + .

[0760] Step 3: A mixture of 1-amino-4-bromo-2-methylpyridin-1-ium (1 g, 5.3 mmol), methyl prop-2-ynoate (0.45 g, 5.3 mmol), potassium carbonate (1.47 g, 10.6 mmol) in DMF (15 mL) was stirred at 25 °C for 16 h. The mixture was diluted with ethyl acetate (100 mL), washed with water (30 mL*2), brine (30 mL), dried over anhydrous sodium sulfate, concentrated and purified quickly (DCM:hexane=0~40%) to give the product methyl 5-bromo-7-methylpyrazolo[1,5-a]pyridine-3-carboxylate (0.29 g, 1.1 mmol, 18.8% yield) as a white solid. MS (ESI) m / z = 269.0 [M+H] + .

[0761] Step 4: A mixture of methyl 5-bromo-7-methylpyrazolo[1,5-a]pyridine-3-carboxylate (290 mg, 1.08 mmol) in 50% H2SO4 (8 mL) was stirred at 110 °C for 20 h. The mixture was neutralized with saturated NaOH, then extracted with ethyl acetate (50 mL*2). The combined organic layers were washed with water (30 mL*2), brine (20 mL), dried over anhydrous sodium sulfate. Concentrated and purified quickly (DCM:hexane=0~30%) to give the product 5-bromo-7-methylpyrazolo[1,5-a]pyridine (190 mg, 0.85 mmol, 79.3% yield) as a colorless oil. MS (ESI) m / z = 211.0; 213.0 [M+H] + .

[0762] Step 5: A mixture of 5-bromo-7-methylpyrazolo[1,5-a]pyridine (190 mg, 0.9 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (251 mg, 1.0 mmol), Pd(dppf)Cl2 (65 mg, 0.09 mmol) and KOAc (177 mg, 1.8 mmol) in dioxane (6 mL) was stirred at 90 °C for 6 h. The mixture was concentrated to give the product 7-methyl-5-(4,4,4,5,5,5-tetraethyl-1,3,2-dioxaborolan-2-yl)pyrazolo[1,5-a]pyridine (190 mg, crude) as a black oil. MS (ESI) m / z = 259.0 [M+H] + .

[0763] Synthesis of imidazo[1,5-a]pyridine-7-yl boronic acid

[0764]

[0765] Step 1: A mixture of 7-bromoimidazo[l,5-A]pyridine (100 mg, 0.51 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2-dioxaborolane (142 mg, 0.56 mmol), Pd(dppf)Cl2(37 mg, 0.051 mmol) and KOAc (100 mg, 1.01 mmol) in dioxane (6 mL) was stirred at 80 °C for 16 h under nitrogen. The mixture was filtered, then concentrated and purified by prep-HPLC (Gemini-C18 150*21.2 mm, 5 um: ACN-H20 (0.1% FA): 0-10) to give the product imidazo[l,5-a]pyridin-7-ylboronic acid (70 mg, 0.039 mmol, 76.6% yield) as a brown solid. MS (ESI) m / z = 163.1 [M+H] + .

[0766] Synthesis of intermediate 35: 5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)benzo[c]isoxazole

[0767]

[0768] Step 1: To a solution of 5-bromo-2-nitrobenzaldehyde (690 mg, 3 mmol) in MeOH-ethyl acetate (1: 1, 20 mL) was added SnCl2-2H2O (2.03 g, 9 mmol). The mixture was stirred at room temperature for 24 h. The reaction was quenched with saturated sodium bicarbonate (20 mL) and filtered. The aqueous phase was extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (PE / ethyl acetate = 0-5%) to give the product 5-bromo benzo[c]isoxazole (517 mg, 2.6 mmol, 87% yield) as a white solid. 1 H NMR (400 MHz, CDC13) δ 9.11 (d, J = 0.8 Hz, 1H), 7.78 (s, 1H), 7.55 (d, J = 9.4 Hz, 1H), 7.36 (dd, J = 9.4, 1.6 Hz, 1H).

[0769] Step 2: A mixture of 5-bromobenzo[c]isoxazole (417 mg, 2.1 mmol), (BPin)2(641.73 mg, 2.52 mmol), KOAc (620.02 mg, 6.3 mmol) and Pd(dppf)Cl2(154.09 mg, 0.21 mmol) in dioxane (20 mL) was stirred at 90 °C for 1 h under nitrogen atmosphere. The mixture was concentrated under vacuum and purified by flash chromatography (ethyl acetate / hexane = 0-5%) to give the product 5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)benzo[c]isoxazole (110 mg, 0.44 mmol, 21% yield). MS (ESI) m / z = 246.1 [M+H] + .

[0770] Synthesis of intermediate 36: 2-(tributylstannyl)thieno[2,3-b]pyridine

[0771]

[0772] Step 1: To a cold (-78 °C) solution of thieno[2,3-b]pyridine (135 mg, 1 mmol) in dry THF (20 mL) was added dropwise n-butyllithium (0.4 mL, 1.1 mmol). The reaction mixture was stirred at -78 °C for 60 min under nitrogen protection. A solution of Bu3SnCl (357.5 mg, 1.1 mmol) in dry THF (5 mL) was added and the reaction mixture was stirred at -78 °C for 30 min. The solution was allowed to warm to room temperature over 2 h. The mixture was quenched with NH4Cl solution (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (ethyl acetate:hexane = 0-3%) to give the product 2-(tributylstannyl)thieno[2,3-b]pyridine (275 mg, 0.64 mmol, 64% yield) as colorless oil. 1 H NMR (400 MHz, DMSO-d6) d 8.46 (dd, J = 4.5, 1.4 Hz, 1H), 8.21 (dd, J = 8.0, 1.5 Hz, 1H), 7.47 (s, 1H), 7.34 (dd, J = 8.0, 4.5 Hz, 1H), 1.52 (dt, J = 8.1, 7.1 Hz, 6H), 1.28 (dd, J = 14.7, 7.3 Hz, 6H), 1.17 - 1.09 (m, 6H), 0.83 (dd, J = 9.3, 5.3 Hz, 9H). MS (ESI) m / z = 426.1 [M+H] + .

[0773] Synthesis of Intermediate 37: 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carbonyl)piperazin-1-yl)-7-oxo-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4- (trifluoromethyl)phenyl)acetamide

[0774]

[0775] Step 1: To a mixture of 2-fluoro-4-(trifluoromethyl)aniline (500 mg, 2.8 mmol) and TEA (850 mg, 8.4 mmol) in DCM (5 mL) was added 2-bromoacetyl bromide (1.7 g, 8.4 mmol) dropwise at 0 °C. The mixture was heated to room temperature and stirred at this temperature for 16 h. The mixture was concentrated and purified quickly (ethyl acetate:hexane = 0-10%) to give the product 2-bromo-N-[2-fluoro-4- (trifluoromethyl)phenyl]acetamide (600 mg, 2 mmol, yield: 71.4%) as a yellow solid. MS (ESI) m / z = 300.0 [M+H] + .

[0776] Step 2: A mixture of 2-bromo-N-[2-fluoro-4-(trifluoromethyl)phenyl]acetamide (300 mg, 1 mmol), tert-butyl 4-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-A]pyrimidin-6-yl)piperazine- 1-carboxylate (428 mg, 1 mmol), DIPEA (388 mg, 3 mmol) in ACN (5 mL) was stirred at 25 °C for 16 h. The mixture was concentrated and purified by flash combustion (MeOH:DCM = 0-10%) to give tert-butyl 4-(2-bromo-5-ethyl-4-(2-(2-fluoro-4- (trifluoromethane))phenyl)amino)-2-oxoethyl)-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-A]pyrimidin- 6-yl)piperazine-1-carboxylate (320 mg, 0.49 mmol, yield: 49.4%). MS (ESI) m / z = 592.1 [M+H-56] + .

[0777] Step 3: To a solution of tert-butyl 4-(2-bromo-5-ethyl-4-(2-(2-fluoro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5- a]pyrimidin-6-yl)piperazine-l-carboxylate (320 mg, 0.49 mmol) in DCM (3 mL) was added HC1 / dioxane (1 mL, 4 M) and the mixture was stirred at 25 °C for 1 h. The mixture was concentrated to give crude 2-[2-bromo-5-methyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4-yl]-N-[2-fluoro-4-(trifluoromethyl)phenyl]acetamide (250 mg, 0.46 mmol). MS (ESI) m / z = 546.2 [M+H] + .

[0778] Step 4: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (141 mg, 0.91 mmol), HOAt (156 mg, 1.14 mmol) and EDCI (219 mg, 1.13 mmol) was stirred in ACN (20 mL) at 25 °C for 1 h, then a solution of 2-[2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4-yl]-N-[2-fluoro-4-(trifluoromethyl)phenyl]acetamide (250 mg, 0.46 mmol) and DIPEA (296 mg, 2.3 mmol) in MeCN (5 mL) was added and further stirred for 1 h. The mixture was concentrated and purified. Yellow solid 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carboxyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-fluoro-4- (trifluoromethyl)phenyl)acetamide (100 mg, 0.15 mmol, yield: 31.8%) was obtained by flash (MeOH:DCM = 0~10%). MS (ESI) m / z = 682.2 [M+H] + .

[0779] Synthesis of intermediate 38: 5-(tributylstannyl)pyrazolo[l,5-a]pyrimidine

[0780]

[0781] Step 1 : To a solution of 5-bromopyrazolo[l,5-a]pyrimidine (200 mg, 1 mmol) and Pd(PPh3)4 (116.71 mg, 0.1 mmol) in dioxane (10 mL) was added 1,1,1,2,2,2-hexabutyldistannane (1171.81 mg, 2 mmol). The mixture was stirred at 100 °C for 16 h under argon. The mixture was concentrated under vacuum and purified by flash chromatography (PE / EtOAc = 0-5%) to give the product 5-(tributylstannyl)pyrazolo[l,5-a]pyrimidine. (275 mg, 0.64 mmol, 64% yield) as colorless oil. MS (ESI) m / z = 410.1 [M+H] + .

[0782] Intermediate 40: Synthesis of 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carbonyl)piperazin-l-yl-2,2,3,3,5,6,6-d8)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2- chloro-4-(trifluoromethyl)phenyl)acetamide

[0783]

[0784] Step 1 : A mixture of 2-bromo-3-oxopentanoic acid ethyl ester (574 mg, 2.57 mmol), piperazine- 1-carboxylic acid tert-butyl ester-2,2,3,3,5,6,6-d8 (500 mg, 2.57 mmol) and potassium carbonate (1.06 g, 7.71 mmol) in ACN (10 mL) was stirred at 50 °C for 2 h. The mixture was filtered, the filter cake was washed with ACN. The filtrate was concentrated under vacuum and purified by flash chromatography (ethyl acetate / hexanes = 0-12%) to give the product 4-(l-ethoxy-l,3-dioxopentan-2-yl)piperazine-l-carboxylic acid tert-butyl ester-2,2,3,3,5,6,6-d8 (454 mg, 1.34 mmol, 60% yield) as yellow oil. MS (ESI) m / z = 337.2 [M+H] + .

[0785] Step 2 & Step 3: To a solution of tert-butyl 4-(l-ethoxy-l,3-diketopentan-2-yl)piperazine-l- carboxylate-2,2,3,3,5,6,6-d8 (454 mg, 1.35 mmol) in ethanol (10 mL) was added 5-bromo-4H- 1,2,4-triazol-3-amine (329.88 mg, 2.02 mmol) and phosphoric acid (1.32 g, 13.5 mmol). The reaction mixture was stirred at 85 °C for 48 h under nitrogen protection. Then the mixture was basified with saturated sodium carbonate to pH = 10 and treated with Boc20 (1.76 g, 8.09 mmol). The mixture was stirred at 25 °C for 2 h. The mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (MeOH / DCM = 0-3%) to give the product tert-butyl 4-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l- carboxylate-2,2,3,3,5,5,6,6-d8 as colorless oil (93 mg, 0.15 mmol, 11% yield). MS (ESI) m / z = 435.1, 437.1 [M+H] + .

[0786] Step 4: To a solution of tert-butyl 4-(2-bromo-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin- 6-yl)piperazine-l-carboxylate-2,2,3,3,5,6,6-d8 (93 mg, 0.15 mmol) in ACN (10 mL) was added 2-bromo-N-[2-chloro-4-(trifluoromethyl)phenyl]acetamide (33.23 mg, 0.1 mmol) and DIPEA (57.96 mg, 0.44 mmol). The mixture was stirred at 25 °C for 16 h. The mixture was concentrated in vacuum and purified by flash chromatography (ethyl acetate / hexanes = 0-55%) to give tert-butyl 4-(2-bromo-4-(2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin- 6-yl)piperazine-l-carboxylate-2,2,3,3,5,6,6-d8 as yellow oil (47 mg, 0.07 mmol, 46% yield). MS (ESI) m / z = 614.0, 616.0 [M+H-56] + .

[0787] Step 5: To a solution of tert-butyl 4-(2-bromo-4-(2-((2-chloro-4- (trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate-2,2,3,3,5,5,6,6- d8 (47 mg, 0.07 mmol) in DCM (5 mL) was added a solution of HC1 in dioxane (2 mL). The mixture was stirred at room temperature for 1 h. The mixture was concentrated under vacuum to give the crude product 2-(2-bromo-5-ethyl-7-oxo-6- (piperazin-l-yl-2,2,3,3,5,6,6-d8)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2- chloro-4-(trifluoromethyl)phenyl)acetamide (40 mg, 0.07 mmol, 100% yield) as a white solid. MS (ESI) m / z = 570.1, 572.1 [M+H] + .

[0788] Step 6: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (21.58 mg, 0.14 mmol), HOAt (23.82 mg, 0.17 mmol) and EDCI (33.55 mg, 0.17 mol) in ACN (25 mL) was stirred at 250 °C under argon for 1 h, then 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl-2,2,2,3,3,5,5,6,6-d8)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(trifluoromethyl)phenyl)acetamide (40 mg, 0.07 mmol) and DIEA (45.23 mg, 0.35 mmol) were added to ACN (5 mL) and the mixture was stirred at room temperature for 1 h. The mixture was concentrated to remove ACN, diluted with water (20 mL), extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, concentrated under vacuum, purified by flash chromatography (MeOH / DCM = 0-3%) to give 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4- carboxyl)piperazin-l-yl-2,2,3,3,5,6,6-d8)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N- (2-chloro-4-(trifluoromethyl)phenyl)acetamide (25 mg, 0.03 mmol, 50% yield) as a yellow oil. MS (ESI) m / z = 706.1, 708.1 [M+H] +

[0789] Synthesis of intermediate 42: 2-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)- 2,3-dihydrobenzo[d]isothiazole-1,1-dioxide

[0790]

[0791] Step 1: To a suspension of 5-bromo-2,3-dihydrobenzo[d]isothiazole-1,1-dioxide (400 mg, 1.61 mmol) and potassium carbonate (222.52 mg, 1.61 mm) in DMF (4 mL) was added Mel (799.83 mg, 5.64 mmol). The reaction mixture was stirred at room temperature for 16 hours. The reaction was cooled and concentrated in vacuo. The solution was diluted with DCM (20 mL*2), washed with water (20 mL*2), dried over anhydrous sodium sulfate and concentrated in vacuo to give 5-bromo-2-methyl-2,3-dihydrobenzo[d]isothiazole 1,1-dioxide (350 mg, 1.34 mmol, 82.8% yield) as a white solid. 1 H NMR (400 MHz, DMSO-d6) d 7.95 (d, J = 11.3 Hz, 1H), 7.85 - 7.61 (m, 2H), 7.50 (d, J = 7.8, 2.9 Hz, 1H), 1.68 (d, J = 13.5 Hz, 6H). MS (ESI, m / z) = 262.12 [M+H] + .

[0792] Step 2: A mixture of 5-bromo-2-methyl-2,3-dihydrobenzo[d]isothiazole-1,1-dioxide (200 mg, 0.76 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (324 mg, 1.28 mmol), potassium acetate (209 mg, 2.13 mmol) and Pd(dppf)Cl2(8.7 mg, 0.011 mmol) in 1,4-dioxane (5 mL) was heated at 100 °C under nitrogen for 16 hours. The reaction mixture was concentrated in vacuo and purified by silica gel column chromatography (PE / EtOAc = 10 / 1) to give 2-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)-2,3-dihydrobenzo[d]isothiazole-1,1-dioxide (104 mg, 0.37 mmol, 44.3% yield) as a white solid. MS (ESI, m / z) = 309.1 [M+H] + .

[0793] Synthesis of Intermediate 43: 4-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)- 3,6-dihydropyridine-l(2H)-carbonitrile

[0794]

[0795] Step 1: To a solution of 4-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,2,3,6- tetrahydropyridine hydrochloride (0.5 g, 2.04 mmol) in DMF was added cesium carbonate (1.10 g, 3.39 mmol) at 0 °C. The mixture was stirred at 0 °C for 15 min, and cyanogen bromide in THF (1 mL) (0.22 g, 2.04 mmol) was added dropwise. The mixture was stirred for 16 h. The reaction mixture was quenched with ice water and diluted with DCM. The aqueous layer was separated and extracted with DCM (10 mL*2). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated to give 4-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-3,6- dihydropyridine-l(2H)-carbonitrile (140 mg, 0.60 mmol, 29.4% yield) as a yellow solid. MS (ESI, m / z) = 235.2 [M+H] + .

[0796] Synthesis of Intermediate 44: 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine- 4-carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (difluoromethyl)phenyl)acetamide

[0797]

[0798] Step 1: To a mixture of 3-chloro-4-nitrobenzaldehyde (1900 mg, 10.24 mmol) in DCM (20 mL) was added diethylaminosulfur trifluoride (1980 mg, 12.29 mmol) at -78 °C. The mixture was stirred at the same temperature for 10 min. The cooling bath was removed, and the mixture was stirred overnight. Concentrated aqueous sodium bicarbonate solution was slowly added to the mixture, and the mixture was extracted with DCM (50 mL*3). The combined organic layers were dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was purified by column chromatography (PE) to give 2-chloro-4-(difluoromethyl)-l-nitrobenzene (1800 mg, 8.6 mmol, 84.7% yield) as a yellow oil. MS (ESI, m / z) = 207.5 [M+H] +

[0799] Step 2: A mixture of 2-chloro-4-(difluoromethyl)-l-nitrobenzene (4.1 g, 21.4 mmol) and Pd / C (0.23 g, 2.15 mmol) in ethyl acetate (250 mL) was stirred under H2at 25 °C for 16 h. The reaction mixture was filtered with celite and concentrated to give 2-chloro-4-(difluoromethyl)aniline (3.0 g, 16.9 mmol, 78.7% yield) as yellow oil. MS (ESI, m / z) = 178.2 [M+H] +

[0800] Step 3: To a mixture of 2-chloro-4-(difluoromethyl)aniline (3.89 g, 21.91 mmol) and ethyldiisopropylamine (8.5 g, 65.73 mmol) in dichloromethane (50 mL) was added 2-bromoacetyl bromide (13.2 g, 65.73 mmol) dropwise at 0 °C under N2. The resulting mixture was stirred at room temperature under N2for 16 h. The mixture was diluted with water (50 mL) and extracted with DCM (50 mL*3). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate, concentrated in vacuum and purified by flash chromatography (ethyl acetate / hexane = 0-20%) to give 2-bromo-N-(2-chloro-4-(difluoromethyl)phenyl)acetamide (3.1 g, 10.4 mmol, 45.04%). MS (ESI, m / z) = 298.5 [M+H] +

[0801] Step 4: To a solution of tert-butyl 4-(2-bromo-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (500 mg, 1.17 mmol) in DMF (8 mL) was added 2-bromo-N-(2-chloro-4-(difluoromethyl)phenyl)acetamide (349 mg, 1.17 mmol) and ethyldiisopropylamine (453 mg, 3.51 mmol). The mixture was stirred at room temperature under N2for 12 h. The mixture was diluted with water (50 mL) and extracted with ethyl acetate (50 mL*3). The combined organic layers were washed with brine (50 mL*3), dried over anhydrous sodium sulfate and concentrated in vacuum. The crude product was purified by flash silica gel chromatography (elution gradient: 30% to 70% ethyl acetate in hexane) to give tert-butyl 4-(2-bromo-4-(2-chloro-4-(difluoromethyl)phenyl)amino)-2-oxoethyl)-5- ethyl-7-oxo-4,7-dihydro-[l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (384 mg, 0.59 mmol, 50.89%). MS (ESI, m / z) = 588.1 [M+H-56] +

[0802] Step 5: To a solution of tert-butyl 4-(2-bromo-4-(2-((2-chloro-4- (difluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro- [l,2,4]triazolo[l,5-a]pyrimidin-6-yl)piperazine-l-carboxylate (384 mg, 0.59 mmol) in dichloromethane (5 mL) was added 4 M HC1 / dioxane (5 mL). The mixture was stirred at room temperature for 2 hours. The resulting mixture was concentrated under vacuum to give 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(difluoromethyl)phenyl)acetamide (300 mg, 0.55 mmol, 92.6%) as a yellow solid. MS (ESI, m / z) = 544.2 [M+H] +

[0803] Step 6: A mixture of 5-hydroxy-6-methylpyrimidine-4-carboxylic acid (254 mg, 1.65 mmol), l-hydroxy-7-azabenzotriazole (224 mg, 1.65 mmol) and 3- (ethylimino methyleneamino)-N,N-dimethylpropan-l -amine (316 mg, 1.65 mmol) in acetonitrile (40 mL) was stirred at room temperature under N2for 1 hour, then 2-(2-bromo-5-ethyl-7-oxo-6-(piperazin-l-yl)-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4-(difluoromethyl)phenyl)acetamide (300 mg, 0.55 mmol) and ethyl diisopropylamine (0.55 mL, 3.30 mmol) in acetonitrile (10 mL) were added. The mixture was stirred at room temperature for 16 hours. The mixture was concentrated to remove MeCN, diluted with water (20 mL), extracted with ethyl acetate (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and concentrated in vacuum. The residue was purified by C18 column chromatography eluted with MeCN in pure water (0.1% FA) to give 2-(2-bromo-5-ethyl-6-(4-(5-hydroxy-6-methylpyrimidine-4-carbonyl)piperazin-l-yl)-7-oxo-[l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)-N-(2-chloro-4- (difluoromethyl)phenyl)acetamide (100 mg, 0.14 mmol, 18.2%). MS (ESI, m / z) = 680.1 [M+H] +

[0804] Synthesis of Intermediate 45: N-(2-chloro-4-(trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-1-yl)-2-(pyrazolo[1,5-a]pyridin-5-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-4(7H)-yl)acetamide

[0805]

[0806] Step 1: To a mixture of tert-butyl 4-(2-bromo-4-(2-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylate (1000 mg, 1.51 mmol) in 1,4-dioxane (20 mL) and water (2 mL) was added 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazolo[1,5-a]pyridine (552 mg, 2.27 mmol), sodium carbonate (480 mg, 4.53 mmol) and Pd(dppf)Cl2(110 mg, 0.15 mmol). The mixture was stirred at 85 °C for 12 h under nitrogen. The reaction mixture was quenched by the addition of pure water and extracted with ethyl acetate (100 mL*3). The combined organic layers were washed with brine (100 mL*3), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The mixture was purified by silica gel column chromatography (PE / EtOAc = 1 / 2) to give tert-butyl 4-(4-(2-(2-chloro-4-(trifluoromethyl)phenyl)amino)-2-oxoethyl)-5-ethyl-7-oxo-2-(pyrazolo[1,5-a]pyridin-5-yl)-4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidin-6-yl)piperazine-1-carboxylate (689 mg, 0.98 mmol, 65.2% yield). MS (ESI, m / z) = 700.4 [M+H] +

[0807] Step 2: To a solution of tert-butyl 4-(4-(2-((2-chloro-4-(trifluoromethyl)phenyl)amino)-2- oxoethyl)-5-ethyl-7-oxo-2-(pyrazolo[l,5-a]pyridin-5-yl)-4,7-dihydro-[l,2,4]triazolo[l,5- a]pyrimidin-6-yl)piperazin-l -carboxylate (689 mg, 0.98 mmol) in DCM (10 mL) was added hydrogen chloride (7 mL, 4 M in dioxane). The mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated in vacuo to give N-(2-chloro-4- (trifluoromethyl)phenyl)-2-(5-ethyl-7-oxo-6-(piperazin-l-yl)-2-(pyrazolo[l,5-a]pyridin-5-yl)- [l,2,4]triazolo[l,5-a]pyrimidin-4(7H)-yl)acetamide (540 mg, 0.9 mmol, 92.8% yield). MS (ESI, m / z) = 600.2 [M+H] +

[0808] The following intermediates were synthesized using the same procedure as for the synthesis of Intermediate 45:

[0809]

[0810]

[0811] Synthesis of Intermediate 59: 4-Fluoro-3-hydroxypyridine carboxylic acid

[0812]

[0813] Step 1: A mixture of 2-chloro-4-fluoropyridin-3-ol (600 mg, 4.07 mmol) and potassium carbonate (843 mg, 6.11 mmol) in DMF (10 mL). The reaction mixture was flushed with N2, then 4-methoxybenzyl chloride (701 mg, 4.48 mmol) was added. The mixture was stirred at 60 °C for 4 hours. Ethyl acetate (10 mL) was added, washed with water (2*10 mL) and brine (10 ml), dried over anhydrous sodium sulfate, filtered and evaporated. The crude product was purified by column chromatography (PE / EA = 5: 1). The product containing fractions were combined and concentrated under reduced pressure to give 2-chloro-4-fluoro-3-[(4-methoxyphenyl)methoxy]pyridine (800 mg, 3.0 mmol, 73.5% yield). MS (ESI, m / z): [M+H] + = 268.0

[0814] Step 2: To a solution of 2-chloro-4-fluoro-3-[(4-methoxyphenyl)methoxy]pyridine (1200 mg, 4.48 mmol) in TEA (1360 mg, 13.44 mmol) and methanol (10 mL) was added [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II), complex with dichloromethane (365 mg, 0.45 mmol). The mixture was stirred at 80 °C for 16 hours under 10 megaPascal of CO. The reaction mixture was filtered through celite and concentrated under reduced pressure. The crude product was purified by column chromatography (PE / EA = 1:1) to give methyl 4-fluoro-3-((4-methoxybenzyl)oxy)pyridinecarboxylate (460 mg, 1.58 mmol, 35.2% yield). MS (ESI, m / z): [M+H] + = 292.1

[0815] Step 3: To a solution of methyl 4-fluoro-3-((4-methoxybenzyl)oxy)pyridinecarboxylate (200 mg, 0.69 mmol) in DCM (4 mL) was added trifluoroacetic acid (786 mg, 6.90 mmol) at room temperature. The solution was stirred at room temperature for 1 hour. The resulting mixture was concentrated under vacuum to give methyl 4-fluoro-3-hydroxypyridinecarboxylate (277 mg, 1.62 mmol, 235.7%). MS (ESI, m / z): [M+H] + = 171.9

[0816] Step 4: To a solution of methyl 4-fluoro-3-hydroxypyridine-2-carboxylate (200 mg, 1.17 mmol) in THF: pure water (2:1) was added lithium hydroxide (140 mg, 5.85 mmol) at 0 °C. The solution was stirred at room temperature for 2 hours. The residue was purified by C18 column chromatography eluted with 0.1% FA in MeCN in water to give 4-fluoro-3-hydroxypyridinecarboxylic acid (120 mg, 0.76 mmol, 65.4%). MS (ESI, m / z): [M+H] + = 158.

[0817] Cell proliferation assay method:

[0818] CellTiter 2.0 Assay provides a uniform method to quantify the number of viable cells in culture by measuring the metabolic product ATP. SW-48 is the human colon carcinoma cell line used in this study with microsatellite instability-high (MSI-H) phenotype, obtained from Roche. SW-48 cells were cultured in 1640 Basal Media (L210KJ) supplemented with 10% fetal bovine serum (Gibco, 10091-148) and 1% penicillin-streptomycin (Solarbio, P1400) in a 37°C, 5% CO2 incubator.

[0819] Experimental procedure:

[0820] Cells were detached for a few minutes using 0.25% trypsin-EDTA (Solarbio, T1300) and neutralized with culture medium. After centrifugation at 300g for 5 minutes, the supernatant was discarded and the cells were resuspended in culture medium and counted using CountStar (IC1000). SW-48 cells were diluted in culture medium to the desired density and 40 pL of cell suspension (final density of 1500 cells / well) was added to black 384-well plates (Corning, 3764). An additional plate was prepared and labeled as Day 0 to quantify the baseline level of viable cells before adding compounds. The 384-well plates were then incubated overnight in a 37°C, 5% CO2 incubator. After overnight incubation, compounds were added to the 384-well plates in triplicates, diluted 3-fold, 10 points, final DMSO concentration of 0.1% using Echo 650 (Beckman, Echo 650). Each compound was treated twice and on the day of dosing, the Day 0 plate was also measured using CTG (Promega, G9243). After 96 hours of compound treatment, 30 pL of CTG reagent was added to each well, incubated for 30 minutes at room temperature and then measured using an enzyme reader (TECAN, Spark) for a read time of 300 ms.

[0821] Data analysis:

[0822] The Z’ factor was used to measure the success of the experiment, with values greater than 0.7 indicating that the results of the experiment are reliable.

[0823] Z’ = 1 - 3*(High_SD + Low_SD) / (High - Low)

[0824] Data was analyzed according to GI 50 Values:

[0825] Curve fitting was performed according to sample concentration and percent growth (%G), calculated using the following formula

[0826] When Sample < Day 0, %G = (Sample - Day 0) / Day 0*100; When Sample > Day 0, %G = (Sample - Day 0) / (High - Day 0)*100. Here, Day 0 represents the initial cell survival level at the time of compound addition, High and Sample represent the cell survival of the solvent control group (0.1% DMSO) and the compound treatment group at the end of the compound incubation period, respectively, and Low represents the no cell PBS group. The percentages of 100%, 0%, and -100% represent no growth inhibition, growth arrest, and complete cell killing, respectively.

[0827] In this study, a four-parameter curve fitting method (XLfit, equation 201) was used. The biological data is shown in the table below:

[0828] Table 1: Biological data

[0829]

[0830] A: <0.5 uM; B: 0.5 uM - 1 uM; C: 1 uM < C < 5 uM; D: > 5 uM.

[0831] Table 1-1: Biological data

[0832]

[0833]

[0834] A: <0.5 uM; B: 0.5 uM - 1 uM; C: 1 uM < C < 5 uM; D: > 5 uM.

[0835] Table 1-2: Biological data

[0836]

[0837] ADP-Glo assay for WRN ATPase activity:

[0838] WRN-dependent ATP-dependent helicase in the process of unwinding, it can bind and hydrolyze ATP to produce ADP, which provides energy for the unwinding of double-stranded DNA. Therefore, we can use the ADP-Glo method to determine the inhibitory effect of compounds on WRN helicase by detecting the amount of ADP produced.

[0839] WRN (500-946) protein was purchased from ICE (S2201T-H03H). Double-stranded DNA substrate was obtained by annealing equal amounts of primers SEQ ID No: 1 (TTTTTTTTTTCTTTTTTTTCGTACGGGTGTTCGTTC) and SEQ ID No: 2 (GAACGAACACATCGGGTACG-TTTTTTTTPTTTTTTATTTTTTTTttTTTTTT-TTTTTTTTTL) in 2X Phanta Max buffer (Vazyme, P505-d1-AB) (5 min at 95 °C, 30 s at 55 °C). The amount of ADP production was measured using ADP-Glo assay kit (Promega, V9101).

[0840] A preliminary experiment was performed to determine the optimal enzyme assay conditions (including buffer, reaction time, and concentrations of protein, ATP, and DNA substrate) before the formal experiment. The final reaction system consisted of 10 nM WRN protein, 0.2 nM DNA substrate, and 300 mM ATP. The buffer of the reaction system was prepared with deionized water to a final concentration of 30 mM Tris (pH 7.5), 2 mM MgCl2, 0.02% BSA, 50 mM NaCl, and 0.10% Pluronic F-68.

[0841] To determine the inhibitory effect of the compounds, the compounds were first gradient-diluted (10-point 3-fold dilution) using DMSO. The diluted compounds (starting concentration of 10 mM) were transferred to 5 nL of a 384-well plate (PerkinElmer, 6007290) using an Echo (Beckman, Echo 650). Each compound was tested twice, and 2.5 pL of buffer containing 2X ATP (600 mM) and 2X WRN (20 nM) was added, followed by a 3-hour pre-incubation at room temperature. The positive control (high control) was the DMSO group without compound treatment but containing WRN (no inhibitory effect), and the negative control (low control) did not contain WRN (maximum inhibitory effect). Subsequently, 2.5 pL of buffer containing 2X DNA (0.4 nM) was added to start the reaction, followed by a 30-minute incubation at room temperature. Then, 5 pL of ADP-Glo reagent was added, and incubated at room temperature for 40 minutes to terminate the enzyme reaction and consume excess ATP. Finally, 10 pL of ATP detection reagent was added to convert ADP to ATP, and the newly formed ATP was detected by luciferase reaction using a plate reader (TECAN, Spark) with a detection time of 300 ms.

[0842] Data analysis:

[0843] The Z' factor was used to measure the success of the experiment, with values greater than 0.6 indicating that the experimental results were reliable.

[0844] Z' = 1 - 3 * (HC_SD + LC_SD) / (HC - LC)

[0845] IC 50 Calculation:

[0846] Curve fitting was performed based on sample concentration and percentage inhibition (% inhibition) using the following equation:

[0847] % Inhibition = 100 x (Readout_HC - Readout_Sample) / (Readout_HC - Readout_LC)

[0848] Here, HC represents the positive control (high control), which is the DMSO group without compound treatment but containing WRN (no inhibition); LC represents the negative control (low control), which is the DMSO group without WRN (maximum inhibition).

[0849] In this study, the absolute IC50 (AbIC50), the concentration point at which the inhibition rate is 50%, was calculated using a four-parameter curve fitting method (XLfit, equation 205), and the biological data is shown in Table 2 below:

[0850] Table 2: Biological data

[0851] compound no. ATPase activity IC 50 (μM)]]> compound no. ATPase activity IC 50 (μM)]]> Example 1 A Example 6 A Example 7 A Example 8 A Example 9 A Example 10 A Example 11 A Example 12 A Example 14 A Example 25 A Example 26 A Example 34 A Example 41 A Example 76 A Example 79 A Example 89 A

[0852] A: <0.5 uM; B: 0.5 uM - 1 uM; C: 1 μM < C ≤ 5 μM; D: > 5 μM.

[0853] Table 2-1: Biological data

[0854]

[0855]

[0856] A: <0.5 uM; B: 0.5 uM - 1 uM; C: 1 μM < C ≤ 5 μM; D: > 5 μM.

[0857] Table 2-2: Biological data

[0858]

[0859]

[0860] Measurement of WRN's helicase activity

[0861] Fluorescence quantification was used to measure the activity of the helicase WRN, where a DNA single strand was labeled with a fluorescent and a quenched group, treated, then unwound at a specific site by WRN, exposing the labeled fluorescent group and generating fluorescence. The fluorescence intensity after treatment with different compounds was measured to determine their inhibitory effect on WRN helicase. WRN (500-946) protein was purchased from ICE (S2201T-H03H). The fluorescently labeled double-stranded DNA substrate was treated with equal amounts of BHQ2 and TAMRA in 2x Phanta Max buffer, which was synthesized by Xiagong Bio. Preliminary experiments were performed to determine the optimal enzyme assay conditions, including buffer, reaction time, and protein, ATP, and DNA substrate concentrations. The final reaction system included 20 nM WRN protein, 200 nM DNA substrate, and 1 mM ATP, and the buffer consisted of 25 mM Tris (pH 7.5), 2 mM MgCl2, 1 mM DTT, 50 mM NaCl, and 0.01% Tween-20. To determine the inhibitory effect of the compounds, the compounds were first diluted with a DMSO gradient (3-fold dilution, 10 points). The diluted compounds (initial concentration point 10 mM) were transferred to a 384-well plate (Greiner, 781090) at a speed of 50 nL per well using an Echo liquid handler (Beckman, Echo 650). Each compound was treated twice, the high control was treated with WRN-coupled DMSO without any inhibitor, and the low control was treated with DMSO without WRN (maximum inhibitory effect). After adding 22.5 μL of buffer containing the DNA double-stranded substrate and WRN, the plate was incubated at room temperature for 15 minutes. Then, after adding 2.5 μL of buffer containing 10X ATP (10 mM), the plate was incubated at room temperature for 1 hour. Finally, the fluorescence intensity was measured using a plate reader (TECAN, Spark) with an excitation filter of 535 ± 25 nm and an emission filter of 595 ± 35 nm.

[0862] Data analysis:

[0863] The Z' factor was used to measure whether the experiment was successful. If Z' > 0.7, the experimental results were considered reliable. The Z' coefficient was calculated as follows:

[0864] Z' = 1 - 3 * (HC_SD + LC_SD) / (HC - LC)

[0865] where HC represents the high control, i.e., WRN-coupled DMSO without any inhibitor, and LC represents the low control, i.e., DMSO without WRN (maximum inhibitory effect).

[0866] IC 50 Calculation:

[0867] To obtain the IC 50Values, using a curve fitting equation to fit the sample concentration to the percent inhibition of the compound. The percent inhibition was calculated using the following equation:

[0868] Inhibition = 100 x (Readout_HC - Readout_Sample) / (Readout_HC - Readout_LC)

[0869] where Readout_HC is the fluorescence intensity of the high control, Readout_Sample is the fluorescence intensity of the sample well, and Readout_LC is the fluorescence intensity of the low control. The absolute half maximal inhibitory concentration (Ab IC 50 ), i.e. the concentration at which the inhibition rate reaches 50%, was calculated using a four parameter curve fitting method (XLfit, equation 205). The biological data is shown in Table 3 below:

[0870] Table 3: Biological data

[0871]

[0872] A: < 0.5 uM; B: 0.5 uM - 1 uM; C: 1 uM < C < 5 uM; D: > 5 uM.

Claims

1. A compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof: in A is a linking group selected from -C(O)-, -S(O)-, -S(O)2-, and Y is N, C, or CH; y is 0, 1, 2, 3, 4; Y means that Y is attached to the adjacent carbon atom by a single bond when Y is CH, or Y is attached to the adjacent carbon atom by a double bond when Y is C, and when Y is a single bond, Y is an unsubstituted carbon atom or a substituted carbon atom, the substituent being OH or F; when Y is N, Y is a single bond; J is either N or CH; when J is N, and A is a linking group selected from -C(O)-, -S(O)-, -S(O)2-, and when J is CH, and A is a linking group selected from -S(O)-, -S(O)2-, and R5 is selected independently from: ·H, ·-(C1-C4)alkyl, ·-(C3-C5)cycloalkyl, • Two R5 substituents may be attached together with the carbon atom to form a (C3-C4) cycloalkyl spirocyclic ring or a 3- or 4-membered heterocyclic spirocyclic ring, wherein the heterocyclic spirocyclic ring contains a cyclic carbocyclic atom and a cyclic heteroatom selected from O, N, and S. When J is N, an R5 substituent forms a ring C: wherein, The ring C is a fused (C3-C6) cycloalkyl ring, a fused (C3-C6) heterocycle, or a fused benzene ring, wherein the fused (C3-C6) heterocycle comprises a cyclic carbon atom and a cyclic heteroatom selected from O, N, and S. • when J is CH, Y is N, is a single bond, and A is a linking group selected from -S(O)-, -S(O)2-, and one R5substituent forms a ring C: • When J is N, the two R5 substituents can be linked to form a (C1-C3) alkylene bridge or a heteroalkylene bridge, wherein the heteroalkylene bond is a heteroatom selected from N and O, or -CH2-O-CH2-; And one or more hydrogen atoms on the ring: It can be replaced by deuterium; R1 is selected from: (C3-C4)cycloalkyl (C3-C4)cycloalkyl is unsubstituted or substituted by one or two R 33 substituted, wherein R 33 is halogen, and wherein said (C3-C4)cycloalkyl or halogen substituted (C3-C4)cycloalkyl is substituted by 0-2 R 15 substituted by one or two R (C3-C4)cycloalkyl has 2 substituents on the same ring carbon atom which are joined to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl spiro ring contains ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 , (C3-C4)cycloalkyl is fused with a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl ring contains ring carbon atoms and 1-4 ring heteroatoms selected from O, N, and S, wherein said cycloalkyl or heterocyclyl is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ​ For C4cycloalkyl it can be bridged by 1 or 2 carbon atoms and wherein said bridged C4cycloalkyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ; or cycloalkenyl • a partially unsaturated monocyclic ring containing 5 or 6 ring carbon atoms, containing 0-2 R 33 wherein R 33 is halogen; and: containing one =CF2substituent and 0-2 R 15 substituents, contains one substituent, taken from =CCI2, -S(O)C 1-4 alkyl, -S(O)2(C 1-4 alkyl), CN, and contains 0-2 R 15 substituents, R 15 cannot be =CCI2, -S(O)C 1-4 alkyl, -S(O)2(C 1-4 alkyl), CN, having 2 substituents on the same ring carbon atom which are joined together to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl spiro ring containing ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 , fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl ring containing ring carbon atoms and 1-4 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 , bridged ring, and the bridge contains 1 or 2 carbon atoms, and is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; • a partially unsaturated monocyclic ring containing 7 ring carbon atoms is substituted with 0-2 R 15 substituted with 0-2 R 0 or 1 =CF2substituent, having 2 substituents on the same ring carbon atom which join to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 , fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl ring comprising ring carbon atoms and 1-4 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; or heterocyclic group • heterocyclyl is a 4 or 7 membered fully saturated or partially unsaturated ring containing ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O and S, wherein said heterocyclyl is unsubstituted or substituted with 1-4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, The heterocyclic group or halogen-substituted heterocyclic group mentioned herein: comprising 0-2 R 15 substituents and 0 or 1 =CF2 substituent, one substituent selected from the group consisting of CN, -S(O)C 1-4 alkyl and -S(O)2C 1-4 alkyl, and 0-2 substituents selected from the group consisting of halo, C 1-4 alkyl, C 1-4 haloalkyl and C 3-4 cycloalkyl, having 2 substituents on the same ring carbon atom which join to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 , fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl ring comprising ring carbon atoms and 1-4 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; fused with a phenyl group, wherein the phenyl group is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; • heterocyclyl is a 5 or 6 membered fully saturated or partially unsaturated ring containing ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O and S, wherein said heterocyclyl is unsubstituted or substituted with 1 to 4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, wherein said heterocyclyl or halogen substituted heterocyclyl is: containing one =CF2substituent and 0-2 R 15 substituents, contains one substituent selected from =CCI2, CN, -S(O)2C 1-4 alkyl and 0-2 R 15 substituent, which substituent R 15 cannot be =CCI2, CN, -S(O)2C 1-4 alkyl, having 2 substituents on the same ring carbon atom which join to form a (C4-C7)cycloalkyl spiro ring, or a 4-, 5-, 6- or 7-membered heterocyclyl spiro ring containing ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 , fused to a (C4-C6)cycloalkyl ring, or a 4,5,6 membered heterocyclyl ring contains ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or a 5-6 membered heteroaromatic ring contains ring carbon atoms and 1-3 ring heteroatoms taken from N and S, or 1 ring O atom and 1 or 2 ring heteroatoms selected from N and S; and wherein said cycloalkyl, heterocyclyl or heteroaromatic is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ; fused with a phenyl group, wherein the phenyl group is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; Or heteroaryl • wherein said heteroaryl is a 5 or 6 membered fully unsaturated monocyclic radical comprising ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms does not exceed 1 and the total number of ring O atoms does not exceed 1, said heteroaryl being substituted by one or more substituents selected from the group consisting of CN, -S(O)2C1-4alkyl, -S(O)2NR 1-4 alkyl, -S(O)C1-4alkyl, -S(O)2C1-4alkyl, -S(O)2NR 1-4 alkyl, -S(O)C1-4alkyl, -S(O)2C1-4alkyl, -S(O)2NR 25 (R 24 )N-, C 1-4 alkyl, -S(O)C1-4alkyl, -S(O)2C1-4alkyl, -S(O)2NR 15 substituents R 15 are not CN, -S(O)2C1-4alkyl, -S(O)2NR 1-4 alkyl, -S(O)C1-4alkyl, -S(O)2C1-4alkyl, -S(O)2NR 1-4 alkyl, -S(O)C1-4alkyl, -S(O)2C1-4alkyl, -S(O)2NR 25 (R 24 )N-, C 1-4 alkyl, -S(O)C1-4alkyl, -S(O)2C1-4alkyl, -S(O)2NR • or wherein the heteroaryl is a 5- or 6-membered fully unsaturated monocyclic group comprising ring carbon atoms and 1, 2, 3, or 4 ring heteroatoms independently selected from N, O, and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms is not more than 1, and the total number of ring O atoms is not more than 1; said heteroaryl containing 0, 1, or 2 R 15 substituents and being fused to a 4-, 5-, or 6-membered heterocyclyl or 5-6 membered heteroaryl, wherein the heterocyclyl ring contains ring carbon atoms and 1-4 ring heteroatoms selected from N, O, and S, and the heteroaryl ring contains ring carbon atoms and 1, 2, 3, or 4 heteroatoms independently selected from N, O, and S, and wherein the heterocyclyl and heteroaryl are substituted with 0, 1, 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; or phenyl • wherein said phenyl is unsubstituted or substituted by 1 to 4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, and wherein said phenyl or halogen substituted phenyl contains 1 or 2 substituents selected from the group consisting of CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, -S(O)C 1-4 haloalkyl, -S(O)2C 1-4 haloalkyl, -S(O)C 3-6 cycloalkyl, -PO(C 1-4 alkyl)2, • wherein said phenyl is unsubstituted or substituted with 1-4 R 15 substituted, and fused with a 4-, 5-, or 6-membered monocyclic ring or a 6-, 7-, 8-, 9-, or 10-membered bicyclic ring, wherein said 4-, 5-, 6-membered monocyclic ring or 6-, 8-, 8-, or 10-membered bicyclic ring contains ring carbon atoms and 0-3 ring heteroatoms selected from N, O, and S, and is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; wherein said 4-, 5-, or 6-membered ring or 6-, 7-, 8-, 9-, or 10-membered bicyclic ring is a saturated, partially saturated, or unsaturated heterocycle or carbocycle, each R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 is independently selected from: ·halogen, ·CN, • -S(O)2C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen, • -PO(C 1-4 alkyl)2, • (C1-C4)alkyl-O-, unsubstituted or substituted with 1-3 halogens, • (C1-C4)alkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, substituted with 1-3 halogens • (C3-C4)cycloalkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, substituted with 1-3 halogens • HOC(O)-(CH2) n -, ·H3C-C(O)(CH2) n -, • (C1-C4)alkyl-O-C(O)(CH2) n , ·＝O, • Azahexacyclic butyl or pyrrolidinyl, wherein the azahexacyclic butyl or pyrrolidinyl is attached to the remainder of the molecule by an N atom and is either unsubstituted or substituted with one or two fluorine atoms. • R 25 (R 24 )N-, wherein R 24 is hydrogen or (C1-C4)alkyl unsubstituted or substituted by 1-3 halogen, R 25 is hydrogen or (C1-C4)alkyl unsubstituted or substituted by 1-3 halogen, · = CF2, ·=CCl2, • -S(O)C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen, • -S(O)C 3-6 cycloalkyl, • -S(O)2C 3-6 cycloalkyl, Where n is 0, 1, 2, R 26 is CH3, H, halogen or deuterium; R 27 is CH3, H, halogen or deuterium; or R 26 and R 27 together with the carbon atom to which they are attached form a cyclopropyl ring; R2 is selected from the following: R6 is selected from: ·H, ·halogen, • (C1-C4)alkyl, unsubstituted or substituted with 1-3 halogens, • (C3-C5) cycloalkyl, unsubstituted or substituted with 1-3 halogens, •-O-(C1-C4)alkyl, unsubstituted or substituted with 1-3 halogens, ·OH, ·CN; R8 is selected from H, halogen, (C1-C4) alkyl, unsubstituted or substituted with 1-3 halogens; R9 is selected from H, O-CH3, OH, CN, CH3, and halogens; R 28 selected from the group consisting of: • SF 5， · deuterium, ·H, ·-C(O)H, ·halogen, • (C1-C4)alkyl, unsubstituted or substituted with 1-3 halogens or deuterium, (C2-C4) alkenyl, ·(C2-C4) ynyl group, • (C3-C5) cycloalkyl, unsubstituted or substituted with 1-3 halogens or deuterium, OCF3; X is selected from C-R7and N, wherein R7is hydrogen or halogen, or R7may be taken together with R 28 or R6and the atoms to which they are attached join to form a fused (C4-C6)cycloalkyl ring, wherein the fused (C4-C6)cycloalkyl ring is unsubstituted or substituted with 1-3 halogen, or R2 is selected from: in R 31 selected from hydrogen, halogen, CH3, R 32 selected from hydrogen, halogen, CH3, R3 is selected from: ·O-CH3, ·N(CH3)2, ·S-CH3, • (C1-C4)alkyl, unsubstituted or substituted with 1-3 halogens or hydroxyl groups; R4 is taken from: R 10 ,R 11 ,R 12 ,R 13 ,R 14 each taken from: ·H， · deuterium, ·halogen, • (C1-C4)alkyl, unsubstituted or substituted with 1-3 halogen or deuterium • (C1-C2)alkyl, substituted with -O-(C1-C2)alkyl or OH, • -S-(C1-C3)alkyl, • -O-(C1-C4)alkyl, unsubstituted or substituted with 1-3 halogen or deuterium, • OH, • (C3-C5)cycloalkyl, wherein (C3-C5)cycloalkyl is unsubstituted or substituted with 1-2 halogen or deuterium, • -O-(C3-C5)cycloalkyl, • -NR 34 R 35 , wherein R 34 , R 35 each is taken from the group consisting of: H, deuterium, (C1-C4)alkyl, unsubstituted or substituted by hydroxyl or -0(C1-C2)alkyl, or R 34 and R 35 may be taken together with the atom to which they are attached to form an azetidinyl, pyrrolidinyl or piperidinyl ring, wherein the azetidinyl, pyrrolidinyl and piperidinyl are unsubstituted or substituted with methyl; • CN, • -(C2-C4)alkenyl, • -(C2-C4)alkynyl, • -C(O)H, • -C(O)(C1-C4)alkyl; and * denotes the point of attachment.

2. The compound of claim 1, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product or tautomer thereof, wherein R1is wherein, Ring E is (C3-C4)cycloalkyl, containing 0-2 R 15 substituents; or E is a 5-6-membered cycloalkenyl or substituted 5-6-membered heterocyclyl group substituted by 1 or 2 substituents selected from =CF2, CN, -S(O)2C 1-4 alkyl, =CCl2. The substituted 5-6-membered cycloalkenyl or substituted 5-6-membered heterocyclyl group is substituted by 0-2 R 15 substituents, R 15 is not =CF2, CN, -S(O)2C 1-4 alkyl, =CCl2; or E is phenyl, which carries 1 or 2 substituents selected from the group consisting of CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, -S(O)C 3-6 cycloalkyl, -S(O)C 1-4 haloalkane, -S(O)2C 1-4 haloalkane, -PO(C 1-4 alkane)2. The phenyl is substituted by 0-2 R 15 substituents, R 15 cannot be CN, -S(O)2C 1-4 alkane, -S(O)C 1-4 alkane, -S(O)C 3-6 cycloalkane, -S(O)C 1-4 haloalkane, -S(O)2C 1-4 haloalkane, -PO(C 1-4 alkane)2; or E is 5-6 membered heteroaryl having 1 or 2 substituents selected from the group consisting of -CN, R 25 (R 24 )N-OC 1-4 alkyl; the 5-6 membered heteroaryl is substituted with 0-2 R 15 substituents, R 15 cannot be -CN, R 25 (R 24 )N-OC 1-4 alkyl; Ring E' is selected from partially unsaturated monocyclic C5-C7cycloalkenyl; Ring E 1' independently selected from partially unsaturated monocyclic C7cycloalkenyl; Ring E" is independently selected from 4- or 7-membered fully saturated or partially unsaturated heterocyclyl comprising ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O and S; Ring E'" is independently selected from 5- or 6-membered fully saturated or partially unsaturated heterocyclyl; Ring E"" is independently selected from 5-6 membered heteroaryl comprising ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms does not exceed 1 and the total number of ring O atoms does not exceed 1; Ring E""' is independently selected from phenyl ring; Ring F is independently selected from (C3-C6)cycloalkyl, or 3, 4, 5 or 6 membered heterocyclyl comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S; Ring F' is independently selected from (C4-C5)cycloalkyl, or 4, 5, 6 or 7 membered heterocyclyl comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S; Ring G is independently selected from (C3-C6)cycloalkyl, or 3, 4, 5 or 6 membered heterocyclyl comprising ring carbon atoms and 1-4 ring heteroatoms selected from O, N and S; Ring G' is independently selected from (C4-C6)cycloalkyl, or 4, 5 or 6 membered heterocyclyl comprising ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or 5-6 membered heteroaryl comprising ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or 1 ring O atom and 1 or 2 ring heteroatoms selected from N and S; Ring G" is independently selected from 4, 5 or 6 membered heterocyclyl or 5-6 membered heteroaryl, wherein said heterocyclyl ring contains ring carbon atoms and 1-4 ring heteroatoms selected from N, O and S, and said heteroaryl ring contains ring carbon atoms and 1, 2, 3 or 4 ring heteroatoms independently selected from N, O and S; Ring G'" is independently selected from 4, 5 or 6 membered ring comprising ring carbon atoms and 0-3 ring heteroatoms selected from N, O and S; preferably G'" is independently selected from (C4-C6)cycloalkyl, 4, 5 or 6 membered heterocyclyl comprising ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or 1 ring O atom and 1 or 2 ring heteroatoms selected from N and S, or 5-6 membered heteroaryl comprising ring carbon atoms and 1-3 ring atoms selected from N or S; R 33 is halogen; R 15 and R 16 are independently selected from: • halogen, • CN, • -S(O)2C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen, • -PO(C 1-4 alkyl)2, • (C1-C4)alkyl-O-, unsubstituted or substituted with 1-3 halogen, • (C1-C4)alkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogens, • HOC(O)-(CH2) n -, ·H3C-C(O)(CH2) n -, • (C1-C4)alkyl-O-C(O)(CH2) n , ·＝O, • azetidinyl or pyrrolidinyl, wherein said azetidinyl and pyrrolidinyl are attached to the rest of the molecule through the N atom, and each is unsubstituted or substituted with 1 or 2 fluorines, • R 25 (R 24 )N-, wherein R 24 is hydrogen or (C1-C4)alkyl, which is unsubstituted or substituted by 1, 2 or 3 halogen, R 25 is hydrogen or (C1-C4)alkyl, which is unsubstituted or substituted by 1 to 3 halogen, • =CF2, • =CCl2, • -S(O)C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen, • -S(O)C 3-6 cycloalkyl, • -S(O)2C 3-6 cycloalkyl, • wherein n is 0, 1, 2, f1 is 0, 1, 2, f2 is 0, 1, 2, f3 is 0, 1, 2.

3. The compound of claim 1 or claim 2, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, wherein R1 is: cycloalkenyl • a partially unsaturated monocyclic ring containing 5 or 6 ring carbon atoms, substituted with 0-2 R 33 wherein R is halo, and the cycloalkenyl group: 33 is: containing one =CF2substituent and 0-2 R 15 substituents, contains one substituent, taken from =CCI2, -S(O)C 1-4 alkyl, -S(O)2(C 1-4 alkyl), -CN, and contains 0-2 R 15 substituents, but R 15 cannot be =CCI2, -S(O)C 1-4 alkyl, -S(O)2(C 1-4 alkyl), -CN, having 2 substituents on the same ring carbon atom which are joined together to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl spiro ring containing ring carbon atoms and one or two ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 , fused to a (C3-C6)cycloalkyl ring, or a 3, 4, 5, or 6 membered heterocyclyl ring containing ring carbon atoms and 1-4 ring heteroatoms selected from the group consisting of O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0-2 substituents independently selected from the group consisting of R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 , bridged ring, and the bridge contains 1 or 2 carbon atoms, and is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; • a partially unsaturated monocyclic ring containing 7 ring carbon atoms, substituted with 0-2 R 15 substituents, and which 7-membered ring: 0 or 1 =CF2substituent, having 2 substituents on the same ring carbon atom which join to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5- or 6-membered heterocyclyl spiro ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1 or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 , fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl ring comprising ring carbon atoms and 1-4 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0, 1, or 2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; or heterocyclyl • heterocyclyl is a 4- or 7-membered fully saturated or partially unsaturated ring containing ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O, and S, wherein the heterocyclyl is unsubstituted or substituted with 1-4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, wherein said heterocyclyl or halogen substituted heterocyclyl: comprising 0-2 R 15 substituents and 0-1 =CF2 substituents, one substituent selected from the group consisting of -CN, -S(O)c 1-4 alkyl and -S(O)2C 1-4 alkyl, and 0-2 substituents selected from the group consisting of halo, C 1-4 alkyl, C 1-4 haloalkyl and C 3-4 cycloalkyl, having 2 substituents on the same ring carbon atom which join to form a (C3-C6)cycloalkyl spiro ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl spiro ring comprising ring carbon atoms and 1 or 2 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ​ fused to a (C3-C6)cycloalkyl ring, or a 3-, 4-, 5-, or 6-membered heterocyclyl ring comprising ring carbon atoms and 1-4 ring heteroatoms selected from O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; fused with a phenyl group, wherein the phenyl group is substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; • heterocyclyl is a 5 or 6 membered fully saturated or partially unsaturated ring containing ring carbon atoms and 1 or 2 ring heteroatoms independently selected from N, O and S, wherein said heterocyclyl is unsubstituted or substituted with 1 to 4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, wherein said heterocyclyl or halogen substituted heterocyclyl is: containing one =CF2substituent and 0-2 R 15 substituents, one substituent selected from the group consisting of =CCI2, -CN, -S(O)2C 1-4 alkyl and 0-2 R 15 substituent, which substituent R 15 cannot be =CCI2, -CN, -S(O)2C 1-4 alkyl, two substituents on the same ring carbon atom which are joined to form a (C4-C7)cycloalkyl spiro ring, or a 4-, 5-, 6-, or 7-membered heterocyclyl spiro ring containing ring carbon atoms and one or two ring heteroatoms selected from the group consisting of O, N, and S, and wherein said cycloalkyl or heterocyclyl is substituted with zero to 2 substituents independently selected from the group consisting of R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 , fused to a (C4-C6)cycloalkyl ring, or a 4,5,6 membered heterocyclyl ring contains ring carbon atoms and 1-3 ring heteroatoms selected from N and S. Or a 5-6 membered heteroaromatic ring contains ring carbon atoms and 1-3 ring heteroatoms selected from N and S, or 1 ring O atom and 1 or 2 ring heteroatoms selected from N and S; and wherein said cycloalkyl, heterocyclyl or heteroaromatic is substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; fused with a phenyl group, wherein the phenyl group is substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 ; or heteroaryl The heteroaryl group is a 5- or 6-membered fully unsaturated monocyclic group comprising a cyclic carbon atom and 1, 2, 3, or 4 independently selected cyclic heteroatoms from N, O, and S, preferably 1 or 2 cyclic heteroatoms, wherein the total number of cyclic S atoms does not exceed 1, and the total number of cyclic O atoms also does not exceed 1. The heteroaryl group is separated by one or more atoms selected from -CN, -S(O)2C. 1-4 Alkyl, -S(O)C 1-4 Alkyl, R 25 (R 24 N-, C 1-4 Alkoxy groups and those containing 0-2 R groups 15 Substituents, but R 15 It cannot be -CN, -S(O)2C 1-4 Alkyl, -S(O)C 1-4 Alkyl, R 25 (R 24 N-, C 1-4 Alkoxy; • or wherein the heteroaryl is a 5 or 6 membered fully unsaturated monocyclic radical comprising ring carbon atoms and 1-4 ring heteroatoms independently selected from N, O, and S, preferably 1 or 2 ring heteroatoms, wherein the total number of ring S atoms is not more than 1 and the total number of ring O atoms is not more than 1; said heteroaryl containing 0-2 R 15 substituents and being fused to a 4, 5, or 6 membered heterocyclyl or 5-6 membered heteroaryl, wherein the heterocyclyl ring contains ring carbon atoms and 1-4 ring heteroatoms selected from N, O, and S, and the heteroaryl ring contains ring carbon atoms and 1-4 heteroatoms independently selected from N, O, and S, and wherein the heterocyclyl and heteroaryl are substituted with 0-2 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; or phenyl, • wherein said phenyl is unsubstituted or substituted by 1-4, preferably 1 or 2 R 33 substituents, wherein R 33 is halogen, and wherein said phenyl or halogen substituted phenyl contains 1 or 2 substituents selected from the group consisting of -CN, -S(O)2C 1-4 alkyl, -S(O)C 1-4 alkyl, -S(O)C 1-4 haloalkyl, -S(O)2C 1-4 haloalkyl, -S(O)C 3-6 cycloalkyl, -PO(C 1-4 alkyl)2, • or wherein said phenyl is unsubstituted or substituted with 1-4 R 15 substituents independently selected from R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , and R 23 ; wherein said 4-, 5-, or 6-membered ring or 6-, 7-, 8-, 9-, or 10-membered bicyclic ring is a saturated, partially saturated, or unsaturated heterocycle or carbocycle. each R is independently selected from the group consisting of: 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 22 and R 23 are independently selected from the group consisting of: • halogen, • CN, • -S(O)2C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen, • -PO(C 1-4 alkyl)2, • (C1-C4)alkyl-O-, unsubstituted or substituted with 1-3 halogens, • (C1-C4)alkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogens, • (C3-C4)cycloalkyl, unsubstituted or substituted with deuterium, OH, -O-(C1-C2)alkyl, 1-3 halogens, • HOC(O)-(CH2) n -, ·H3C-C(O)(CH2) n -, • (C1-C4)alkyl-O-C(O)(CH2) n , ·＝O, • azetidinyl or pyrrolidinyl, wherein said azetidinyl and pyrrolidinyl are attached to the rest of the molecule through the N atom, and each is unsubstituted or substituted with 1 or 2 fluorines, • R 25 (R 24 )N-, wherein R 24 is hydrogen or (C1-C4)alkyl unsubstituted or substituted by 1-3 halogen, R 25 is hydrogen or (C1-C4)alkyl unsubstituted or substituted by 1-3 halogen, • =CF2, • =CCl2, • -S(O)C 1-4 alkyl, unsubstituted or substituted with 1-3 halogen, • -S(O)C 3-6 cycloalkyl, • -S(O)2C 3-6 cycloalkyl, • wherein n is 0, 1, 2.

4. The compound according to any one of claims 1-3, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, wherein R2 is selected from: X is selected from N or CH; R6 is selected from: ·H, • halogen, • (C1-C4)alkyl, unsubstituted or substituted with 1-3 halogens, • (C3-C5)cycloalkyl, unsubstituted or substituted with 1-3 halogens, • -O-(C1-C4)alkyl, unsubstituted or substituted with 1-3 halogens, • OH, • CN; R8 is selected from H, halogen, (C1-C4)alkyl unsubstituted or substituted with 1-3 halogens; R9 is selected from H, OCH3, OH, CN, CH3, and halogen; R 28 selected from the group consisting of: • SF5, · deuterium, ·H, • -C(O)H, • halogen, • (C1-C4)alkyl, which alkyl is unsubstituted or substituted with 1-3 halogens or deuterium, • (C2-C4)alkenyl, • (C2-C4)alkynyl, • (C3-C5)cycloalkyl, which is optionally substituted with hydrogen, deuterium, or 1 or more halogens, • OCF3.

5. The compound of any one of claims 1-4, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, wherein the compound has the structure of Formula (II) wherein, R1, R2, R3, R4, R5, and y are as defined in claim 1.

6. The compound of any one of claims 1-5, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, wherein the compound has the structure of Formula (III): wherein M is N or CH; Rfis selected from the group consisting of H, halogen, C 1-6 alkyl, haloC 1-6 alkyl; preferably Rfis hydrogen; Rg is selected from H, halo, C 1-6 alkyl, haloC 1-6 alkyl; and R1, R3, R5, and y are as previously defined.

7. The compound of any one of claims 1-6, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, wherein R1is independently selected from:

8. The compound of any one of claims 1-7, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, wherein the compound is selected from:

9. A pharmaceutical composition comprising a compound of any one of claims 1-8, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, and one or more pharmaceutically acceptable excipients or adjuvants.

10. Use of a compound of any one of claims 1-8, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, deuterated product, or tautomer thereof, for the manufacture of a medicament for the treatment of a disease or disorder treatable by inhibition of WRN.

Images