Grain coprinus comatus mycelium polysaccharide with immunoregulation and anti-tumor synergistic effect and preparation method of grain coprinus comatus mycelium polysaccharide
By extracting and purifying polysaccharide CMMPS from crystalline Coprinus comatus mycelium, the problem of insufficient polysaccharide activity development in existing technologies has been solved, and high-purity polysaccharide preparation has been achieved. It has significant immunomodulatory and anti-tumor synergistic effects and is suitable for the preparation of drugs that promote the inhibition of tumor cells by immune cells.
Patent Information
- Application Number
- CN202511272977.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-08
- Publication Date
- 2026-01-20
AI Technical Summary
Existing research on the synergistic antitumor and immunomodulatory activities of polysaccharides from crystalline Coprinus comatus mycelium is lacking, and the absence of effective polysaccharide extraction and purification methods limits their application in the pharmaceutical field.
A polysaccharide, CMMPS, was extracted and purified from the mycelium of *Coprinus comatus*. High-purity polysaccharide was obtained through liquid culture, cell disruption, centrifugation, anion exchange chromatography, and gel filtration. This polysaccharide was used to activate immune factors and enhance the killing effect of immune cells on tumor cells.
The obtained polysaccharide CMMPS has good safety and low cost, can significantly promote the inhibitory effect of immune cells on tumor cells, is suitable for large-scale production, and has significant immunomodulatory and anti-tumor synergistic effects.
Smart Images
Figure CN121362265A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a Coprinus micaceus mycelium polysaccharide with synergistic effects of immunomodulation and anti-tumor and a preparation method. BACKGROUND
[0002] In recent years, with the deepening of the research on secondary metabolites of fungi, polysaccharide compounds have attracted much attention due to their significant physiological activities, especially in the field of medicine, polysaccharides have been confirmed to have a wide range of biological functions, such as anti-aging, antioxidant, antiviral, antitumor and immunomodulation. However, the research on the mycelium polysaccharide of Coprinus micaceus is still relatively scarce.
[0003] Coprinus micaceus is a wild large fungus, commonly found in most ecological zones from temperate to subtropical zones, belonging to Basidiomycota, Hymenomycetes, Agaricales, Coprinaceae and Coprinus. The genus Coprinus has significant medicinal potential, such as Coprinus atromentarius, which has the effects of regulating gastrointestinal function, promoting the clearance of respiratory tract secretions, treating sores, inhibiting the growth of sarcoma 180 and Ehrlich carcinoma cells in mice. The edible and medicinal representative species of Coprinus comatus in this genus can also induce tumor cell apoptosis and achieve growth arrest of the above two transplanted tumor models.
[0004] Existing researches have shown that fungal polysaccharides play an important role in anti-tumor therapy. For example, Ganoderma lucidum polysaccharides can directly act on tumor cells by inducing cancer cell apoptosis, blocking angiogenesis and inhibiting tumor cell migration. In addition, fungal polysaccharides have also been confirmed to be able to inhibit tumor growth by activating the host immune system. Therefore, the development of the synergistic effects of anti-tumor and immunomodulatory activity of Coprinus micaceus mycelium polysaccharide can tap the medical value of Coprinus micaceus and provide theoretical support for the development and utilization of anti-tumor drugs. SUMMARY
[0005] The present application aims to provide a Coprinus micaceus mycelium polysaccharide with synergistic effects of immunomodulation and anti-tumor, and also provides a preparation method of the polysaccharide. The present application first isolates and purifies a polysaccharide from Coprinus micaceus, which can activate the expression of immune factors and enhance the killing effect of immune cells on tumor cells.
[0006] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is:
[0007] The present application provides a kind of CMMPS (C. micaceus Mycelial polysaccharide) with immunomodulatory and anti-tumor synergistic effect, which is extracted from C. micaceus (commonly known as dog urine moss) mycelium, and CMMPS is white powder, which is composed of galactose, glucose, xylose and mannose, and the molar ratio is 0.36:95.88:1.68:2.09.
[0008] The present application provides a kind of C. micaceus mycelial polysaccharide with immunomodulatory and anti-tumor synergistic effect, which is extracted from C. micaceus (commonly known as dog urine moss) mycelium, and CMMPS is white powder, which is composed of galactose, glucose, xylose and mannose, and the molar ratio is 0.36:95.88:1.68:2.09.
[0009] (1) Extraction of C. micaceus mycelial polysaccharide
[0010] C. micaceus mycelium is inoculated in liquid PDA medium and shaken for 7-10 days, and the mycelial ball is collected. After the mycelial ball is washed with distilled water, the water is absorbed with water-absorbing paper, and the weight of the mycelial ball is measured. The mycelial ball is crushed with a cell wall breaker, distilled water is added, and the mixture is heated in a water bath with shaking. The mycelial extract is collected, centrifuged, and the supernatant is taken. The supernatant is concentrated to a certain volume using a rotary evaporator, anhydrous ethanol is added, and the mixture is left overnight to precipitate the polysaccharide. The precipitate is collected by centrifugation, and then an appropriate amount of distilled water is added to resuspend the precipitate. The resuspended polysaccharide solution is treated with the sevag method to remove protein, and the operation is repeated 7-8 times to remove as much protein as possible to obtain a crude polysaccharide extract. The crude polysaccharide extract is loaded into an 8000D dialysis bag and dialyzed overnight to remove small molecules. The dialyzed polysaccharide is freeze-dried to obtain C. micaceus mycelial polysaccharide.
[0011] (2) Anion exchange chromatography purification of C. micaceus mycelial polysaccharide
[0012] The C. micaceus mycelial polysaccharide obtained in step (1) is dissolved in buffer and separated by anion exchange chromatography column. The eluate is collected by a distribution collector, and the polysaccharide content of each tube of eluate is monitored by anthrone-sulfuric acid method. The absorbance value is plotted to obtain a curve, and the elution peak is collected and named as D0 component.
[0013] (3) Gel filtration chromatography purification of C. micaceus mycelial polysaccharide
[0014] The D0 component obtained in step (2) is dissolved in distilled water and filtered and eluted by a gel column. The eluate is collected by a distribution collector, and the polysaccharide content of each tube of eluate is monitored by anthrone-sulfuric acid method. The absorbance value is plotted to obtain a curve, and the first elution peak is collected to obtain D0S1 component.
[0015] (4) Verification of C. micaceus mycelial polysaccharide
[0016] The D0S1 component obtained in step (3) was loaded on HPLC, and the chromatographic conditions were as follows: Agilent 1260 infinity high performance liquid chromatograph, Agilent PL aquagel-OH MIXED-H gel column (7.5 mm x 300 mm, 8 μm), Agilent G1362A RID refractive index detector, column temperature 35 °C, injection volume 20 μL, mobile phase was distilled water, 0.6 mL / min, and the result showed a single retention peak, indicating that the polysaccharide was a pure polysaccharide, i.e. the crystal grain ghost mushroom mycelium polysaccharide CMMPS.
[0017] Further, the liquid PDA culture medium in step (1) was obtained by boiling and filtering 200 g of peeled potatoes, adding 20 g of glucose, and adding distilled water to 1 L.
[0018] Further, after the crystal grain ghost mushroom mycelium in step (1) was broken, distilled water was added at a solid-liquid ratio of 1:20, and the mixture was oscillated and heated in a 60-90 °C water bath for 4-6 h.
[0019] Further, the mycelium extract collected in step (1) was centrifuged at 8000 r / min for 10-20 min, and the supernatant was taken. The obtained centrifugal supernatant was concentrated by rotary evaporation, and 4 volumes of anhydrous ethanol were added to precipitate the polysaccharide.
[0020] Further, in the sevag method of step (1), the Sevag reagent was prepared according to a ratio of chloroform:n-butanol=4:1, and the Sevag reagent was added according to a ratio of crude product solution:Sevag reagent=4:1, and was oscillated vigorously for 8-10 min and then was left standing.
[0021] Further, the crude polysaccharide in step (2) was dissolved in 50 mM Tris-Hcl buffer and loaded on a DEAE-52 anion exchange chromatography column (1.8 x 35 cm) and eluted with 50 mM Tris-Hcl, 0 M Nacl solution; wherein the Tris-Hcl buffer had a pH of 7.5.
[0022] Further, the D0 component in step (3) was dissolved in distilled water and loaded on a Sephadex G-75 gel column (1.5 x 50 cm) and eluted with distilled water, and the eluate was collected with a distribution collector at 1 mL / tube / 3 min, and the first elution peak was collected.
[0023] In a third aspect, the present application provides the use of the Coprinus comatus mycelium polysaccharide with immune regulation and anti-tumor synergistic effect, which can be used for preparing a medicine for promoting the inhibition of the proliferation of the immune cell RAW264.7 on the tumor cell A549.
[0024] The present application has the advantages and beneficial effects of:
[0025] (1) The Coprinus comatus mycelium polysaccharide in the present application is a natural extract with good safety; (2) The Coprinus comatus mycelium polysaccharide CMMPS in the present application is a pure polysaccharide; (3) The Coprinus comatus mycelium polysaccharide in the present application has good immune regulation and anti-tumor synergistic effect, and can be used for preparing a medicine for promoting the inhibition of the proliferation of the immune cell RAW264.7 on the tumor cell A549; (4) The Coprinus comatus mycelium polysaccharide in the present application is simple to prepare, low in cost, and suitable for large-scale production. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 is a preparation route of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0027] Figure 2 is a DEAE-52 anion exchange chromatogram of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0028] Figure 3 is a Sephadex G75 gel chromatogram of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0029] Figure 4 is an HPLC chart of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0030] Figure 5 is an ultraviolet spectrum detection chart of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0031] Figure 6 is a monosaccharide composition analysis chart of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0032] Figure 7 is an infrared spectrum chart of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0033] Figure 8 is an immune regulation chart of the Coprinus comatus mycelium polysaccharide CMMPS in the present application.
[0034] Figure 9 is a chart of the influence of the Coprinus comatus mycelium polysaccharide CMMPS in the present application on the proliferation of immune cells.
[0035] Figure 10Figure is the influence diagram of the CMMPS of the present application on the proliferation of tumor cells. DETAILED DESCRIPTION
[0037] The present application is further described below in conjunction with specific examples.
[0038] Example 1, preparation of the CMMPS of the present application
[0039] Referring to the accompanying drawings Figure 1 , the preparation method of the present application comprises the following steps:
[0040] (1) Extraction of the crude polysaccharide of the CMMPS of the present application. The CMMPS of the present application is inoculated in a liquid PDA culture medium (200g of peeled and boiled soft potatoes, 20g of glucose, and distilled water to make up to 1L), and cultured at 26℃ with shaking at 120-180r / min for 7-10 days. The mycelium ball is collected. After the mycelium ball is washed with distilled water, the water is absorbed with a water-absorbing paper, and the weight of the mycelium ball is measured. The mycelium ball is crushed with a cell wall crusher, and distilled water is added at a ratio of 1:20. The mixture is heated in a water bath at 60-90℃ for 4-6h with shaking. The mycelium ball is collected, and the supernatant is obtained by centrifugation at 8000r / min for 10-20min. The supernatant is concentrated by rotary evaporation, and 4 times the volume of anhydrous ethanol is added to precipitate the polysaccharide overnight. The precipitate is collected by centrifugation, and then an appropriate amount of distilled water is added to resuspend the precipitate. The resuspended solution is subjected to the sevag method to remove protein, and the operation is repeated 7-8 times to remove as much protein as possible to obtain a crude polysaccharide extract. The crude polysaccharide extract is placed in a dialysis bag (8000D) for dialysis overnight to remove small molecules, and then freeze-dried to obtain the crude polysaccharide;
[0041] (2) Anion exchange chromatography purification of the CMMPS of the present application. The crude polysaccharide obtained in step (1) is dissolved in a 50mM Tris-Hcl (pH7.5) buffer, and then loaded onto a DEAE-52 anion exchange chromatography column (1.8x35cm). The column is eluted with a 50mM Tris-Hcl (pH7.5) and 0M Nacl solution, and the eluate is collected at a rate of 1mL / tube / min. The polysaccharide content of each tube of eluate is monitored by the anthrone-sulfuric acid method, and a curve is drawn according to the absorbance value. The elution peak is collected and named as DO component. Figure 2 Figure shows the DEAE-52 anion exchange chromatography of the CMMPS of the present application.
[0042] (3) Gel filtration chromatography purification of the mycelial polysaccharide of Coprinus cinereus. The DO component obtained in step (2) was dissolved in distilled water and then loaded onto a Sephadex G-75 gel column (1.5 x 50 cm) and eluted with distilled water. The eluate was collected with a distribution collector at 1 mL / tube / 3 min, and the polysaccharide content of each tube of eluate was monitored by the anthrone-sulfuric acid method. A curve was plotted according to the absorbance values, and the first elution peak was collected to obtain a DOS1 component. Figure 3 A Sephadex G75 gel chromatogram of the mycelial polysaccharide CMMPS of Coprinus cinereus of the present application is shown.
[0043] (4) The DOS1 component obtained in step (3) was loaded onto an HPLC, and the chromatographic conditions were as follows: Agilent 1260 infinity high-performance liquid chromatograph, Agilent PL aquagel-OH MIXED-H gel column (7.5 mm x 300 mm, 8 μm), Agilent G1362A RID refractive index detector, column temperature 35°C, injection volume 20 μL, and mobile phase distilled water at 0.6 mL / min. The result showed a single retention peak, indicating that the polysaccharide was a pure product, i.e., the mycelial polysaccharide CMMPS of Coprinus cinereus. Figure 4 An HPLC chromatogram of the mycelial polysaccharide CMMPS of Coprinus cinereus of the present application is shown.
[0044] Example 2, UV spectrum determination of the mycelial polysaccharide CMMPS of Coprinus cinereus of the present application
[0045] To further detect the purity of the purified Coprinus cinereus polysaccharide, the presence or absence of protein and nucleic acid impurities was determined by UV spectrum.
[0046] The presence or absence of absorption peaks at 260 nm and 280 nm was detected by UV spectrum. A CMMPS solution at 1 mg / mL was prepared, and the UV spectrum was recorded on an ultramicro spectrophotometer (Denovixs DS-11, USA) scanner.
[0047] The UV spectrum of CMMPS in the wavelength range of 200-800 nm (UV) was plotted with wavelength as the abscissa and absorbance as the ordinate, and the result is shown in Figure 2. Figure 5 The peak at 206 nm in the UV spectrum shows the presence of polysaccharide, and there are no peaks at 260 nm and 280 nm, indicating that the polysaccharide sample does not contain protein and nucleic acid impurities.
[0048] Example 3, monosaccharide composition determination of the mycelial polysaccharide CMMPS of Coprinus cinereus of the present application
[0049] Ion-exclusion liquid chromatography was adopted. An appropriate amount of CMMPS polysaccharide solution was concentrated by rotation or dried by nitrogen blowing. 1 mL of 2M TFA acid solution was added, and heated at 105°C for 6h. Nitrogen was blown, and dried. Methanol was added for washing, and dried again. Methanol washing was repeated for 2-3 times. Sterile water was added for dissolution, and transferred into a chromatography bottle for testing.
[0050] The chromatography system was a Thermo ICS5000 ion chromatography system (ICS5000, Thermo Fisher Scientific, USA), and an electrochemical detector was used for analysis and detection of monosaccharide components. Dionex CarboPac PA20 (150*3.0mm, 10μm) liquid chromatography column was used, and the injection amount was 5uL. The mobile phase A was 0.1M NaOH, the mobile phase B was 0.1M NaOH and 0.2M NaAc, the flow rate was 0.5mL / min, the column temperature was 30°C, and the elution gradient was as follows: 0min A phase / B phase (95:5V / V), 30min A phase / B phase (80:20V / V), 30.1min A phase / B phase (60:40V / V), 45min A phase / B phase (60:40V / V), 45.1min A phase / B phase (95:5V / V), and 60min A phase / B phase (95:5V / V). TM CarboPac TM PA20 (150*3.0mm, 10μm) liquid chromatography column; the injection amount was 5uL. The mobile phase A was 0.1M NaOH, the mobile phase B was 0.1M NaOH and 0.2M NaAc, the flow rate was 0.5mL / min, the column temperature was 30°C, and the elution gradient was as follows: 0min A phase / B phase (95:5V / V), 30min A phase / B phase (80:20V / V), 30.1min A phase / B phase (60:40V / V), 45min A phase / B phase (60:40V / V), 45.1min A phase / B phase (95:5V / V), and 60min A phase / B phase (95:5V / V).
[0051] The qualitative chromatography was mainly based on the retention time of the target compound on the analysis column. The quantification was mainly by using standard samples of different concentrations, plotting the concentration of the standard sample as the abscissa and the peak area of the standard sample as the ordinate, and then calculating the concentration of the corresponding compound in the unknown sample according to the peak area.
[0052] The mixture of 13 kinds of monosaccharide standard samples was analyzed by HPLC-ELSD to obtain Figure 6 -a, from left to right, the monosaccharides corresponding to each peak were fucose, rhamnose, arabinose, galactose, glucose, xylose, mannose, fructose, ribose, galacturonic acid, glucuronic acid, mannuronic acid, and guluronic acid. Figure 6 -b was the monosaccharide composition of the CMMPS of the mycelium of Coprinus comatus. The proportion of the monosaccharide composition of CMMPS was as follows: galactose (Gal, 0.36%), glucose (Glc, 95.88%), xylose (Xyl, 1.68%), and mannose (Man, 2.09%).
[0053] Example 4, infrared spectrum determination of the CMMPS of the mycelium of the Coprinus comatus of the application
[0054] The polysaccharide of the application was determined according to the general infrared spectrum analysis method of GB / T 6040-2002. Figure 7A broad and strong absorption peak appears near 3400 cm -1 , which is usually the stretching vibration peak of hydroxyl (-OH). The absorption peak at 2928.92 cm -1 corresponds to the stretching vibration of C-H, indicating the presence of saturated carbon hydrogen groups in the polysaccharides in the sample, such as methylene (-CH2-) or methyl (-CH3) on the sugar ring. The absorption peak at 1412.63 cm -1 may be the bending vibration of C-H, reflecting the vibration characteristics of the carbon hydrogen structure in the polysaccharide molecule. The absorption peaks at 1158.81 cm -1 , 1080.64 cm -1 , and 1023.71 cm -1 are related to the stretching vibration of glycosidic bond (C-O-C) and the stretching vibration of C-O on the sugar ring. Among them, the peak around 1080 cm -1 may be related to the α-glycosidic bond, and the peak near 1023 cm -1 may be related to the β-glycosidic bond, but the specific glycosidic bond type needs to be further confirmed by combining other analysis methods.
[0055] Overall, the infrared spectrum presents typical characteristic absorption peaks of polysaccharides, indicating that the sample is a polysaccharide substance.
[0056] Example 5, Effect of Crystalline Coprinus Mice Mycelium Polysaccharide CMMPS on RAW264.7 Immune Cell Proliferation
[0057] Take the RAW264.7 cells in the logarithmic growth phase to prepare a single cell suspension (1×10 3 cells / mL) and inoculate in a 96-well plate, 100 μL per well, and place in a 37℃, 5% CO2 incubator overnight. Set the concentration of CMMPS active polysaccharide to 250, 500 μg / mL, with 5 repeats for each concentration gradient, and treat the cells for 36 h. Use the MTT method to determine the proliferation rate of RAW264.7 immune cells, and get Figure 8 . The experimental results show that after the RAW264.7 immune cells are treated with 250, 500 μg / mL of CMMPS, the proliferation rates of RAW264.7 immune cells are about 95% and 96%, respectively, indicating that the polysaccharide has no toxicity to RAW264.7 immune cells.
[0058] Example 6, Determination of Immune Regulation of Crystalline Coprinus Mice Mycelium Polysaccharide CMMPS
[0059] RAW264.7 cells treated with 125 μg / mL CMMPS polysaccharide for 36 h were extracted according to the conventional Trizol method. Then the RNA was reversely transcribed into cDNA according to the cDNA kit. Finally, the qPCR kit was used for detection. The system condition was set as 95 °C for 10 min; 95 °C for 15 s; 57 °C for 30 s; 75 °C for 1 min 15 s; 40 cycles, and finally 75 °C for 5 min. The melting curve ranged from 60 °C to 95 °C. The sequences of the sense and antisense strands of the primers are shown in Table 1.
[0060] Table 1. Primer sequences
[0061] Name Sequence (5' to 3') Name Sequence (5' to 3') Gapdh-F CAACTTTGGCATTGTGGAAGG I16-R TGGAAATTGGGGTAGGAAGGAC Gapdh-R ACACATTGGGGGTAGGAACAC I110-F AACATACTGCTAACCGACTCCT I12-F CTCTGACAACACATTTGAGTGCC I110-R TTGTAGACACCTTGGTCTTGG I12-R CCATCTCCTCAGAAAGTCCACC Tnf-αF ACTGAACTTCGGGGTGATCG I14-F CATCGGCATTTTGAACGAGGT Tnf-αR CCACTTGGTGGTTTGCTACG I14-R TCTGTGGTGTTCTTCGTTGCT Inf-αF AGGTCAACAACCCACAGGTC I16-F TGGAGTACCATAGCTACCYGGA Inf-αR CAGCGACTCCTTTTCCGCTT
[0062] Figure 9 As shown in the figure, the relative expression levels of IL-2, IL-4, IL-6, IL-10, INF-α and TNF-α were 1.29, 4.82, 0.03, 1.12, 0.90 and 0.27 respectively after RAW264.7 cells were treated with 125 μg / mL CMMPS polysaccharide for 36 h, that is, CMMPS polysaccharide up-regulated the expression of IL-2, IL-4 and IL-10 genes of immune cells, and down-regulated the expression of IL-6, INF-α and TNF-α genes.
[0063] Example 7. Determination of the immune regulation and anti-tumor synergistic effect of the CMMPS polysaccharide of the present application
[0064] RAW264.7 and A549 cells in the logarithmic growth phase were taken to prepare single cell suspensions (1 × 10 5 The cell suspensions were inoculated in 96-well plates at 100 μL per well, and incubated in a 37 °C, 5% CO2 incubator overnight. CMMPS polysaccharide was set at a concentration of 125 μg / mL and 250 μg / mL, and each concentration gradient was set with 5 repeats, and RAW264.7 cells were treated for 12 h. Then the supernatant of RAW264.7 cells containing 125 μg / mL and 250 μg / mL CMMPS was added to the corresponding A549 cells, and after 36 h, the proliferation rate of A549 tumor cells was determined by the MTT method. The 125 μg / mL and 250 μg / mL CMMPS polysaccharide alone almost did not affect the proliferation of A549 tumor cells; however, the proliferation rate of A549 cells was significantly inhibited when the A549 cells were treated with the supernatant of RAW264.7 cells containing CMMPS polysaccharide, and the proliferation rate of A549 tumor cells decreased to 23% and 22% respectively, indicating that CMMPS polysaccharide played a role in inhibiting the proliferation of A549 tumor cells by activating RAW264.7 immune cells. The immune regulation and anti-tumor synergistic effect of the CMMPS polysaccharide of the present application is shown in the figure. Figure 10as shown.
[0065] Based on the above embodiments, the monosaccharide composition of the polysaccharide obtained by chromatography, the functional groups of the polysaccharide determined by Fourier transform micro infrared spectrometer, and the influence of the polysaccharide on the proliferation of immune cells RAW264.7 and tumor cells A549 determined by MTT method. The crystal grain ghost mushroom mycelium polysaccharide CMMPS extracted by the method of the present application is a white powder, the monosaccharide composition and molar ratio are: galactose (Gal, 0.36%), glucose (Glc, 95.88%), xylose (Xyl, 1.68%) and mannose (Man, 2.09%), the infrared spectrum presents the typical characteristic absorption peak of polysaccharide, the extracted crystal grain ghost mushroom mycelium polysaccharide can promote the inhibition of immune cells RAW264.7 on tumor cells A549, has the potential to treat cancer, and can be used for preparing drugs for promoting the inhibition of immune cells RAW264.7 on tumor cells A549 proliferation.
[0066] It should be further pointed out that the above embodiments are only used to understand the technical solutions of the present application, and are not used to limit the protection scope of the present application. Any obvious adjustment and modification of the technical solutions of the present application which belongs to the technical concept of the present application should also belong to the protection scope of the present application.
Claims
1. A polysaccharide from crystalline Coprinus comatus mycelium with synergistic immunomodulatory and antitumor effects, characterized in that: The polysaccharide was extracted from the mycelium of Coprinus comatus and consisted of four monosaccharides: galactose, glucose, xylose, and mannose, in a molar ratio of 0.36:95.88:1.68:2.
09.
2. A method for preparing the crystalline coprinus mycelial polysaccharide with synergistic immunomodulatory and antitumor effects as described in claim 1, characterized in that... Includes the following steps: (1) Extraction of crude polysaccharides from crystalline Coprinus comatus mycelium Inoculate the mycelium of Coprinus comatus into liquid PDA medium and culture with shaking for 7-10 days. Collect the mycelium balls. Wash the mycelium balls with distilled water, dry them with absorbent paper, and weigh the mycelium balls. Crush the mycelium balls with a cell wall breaker, add distilled water, and heat in a water bath with shaking. Collect the mycelial extract, centrifuge and take the supernatant; concentrate the supernatant to a certain volume using a rotary evaporator, add anhydrous ethanol and let stand overnight to precipitate polysaccharides; Centrifuge to collect the precipitate, then add an appropriate amount of distilled water to redissolve the precipitate; perform Sevag method to remove protein from the redissolved polysaccharide solution, repeat the operation 7-8 times to remove as much protein as possible, and obtain crude polysaccharide extract; put the crude polysaccharide extract into an 8000D dialysis bag and dialyze overnight to remove small molecules, freeze dry, and obtain crystalline coprinus mycelium crude polysaccharide. (2) Anion exchange chromatography purification of polysaccharides from crystalline Coprinus comatus mycelium The crude polysaccharide of the crystalline coprinus mycelium obtained in step (1) was dissolved in buffer solution, separated and eluted by an anion exchange chromatography column, and the eluent was collected by a distribution collector. The polysaccharide content of each tube of eluent was monitored by the anthrone-sulfuric acid method. A curve was plotted based on the absorbance value, and the elution peak was collected and named as component D0. (3) Gel filtration chromatography purification of polysaccharides from crystalline Coprinus comatus mycelium After dissolving the D0 component obtained in step (2) in distilled water, the solution was filtered and eluted through a gel column. The eluent was collected using a distribution collector. The polysaccharide content of each eluent was monitored using the anthrone-sulfuric acid method. A curve was plotted based on the absorbance value, and the first elution peak was collected to obtain the D0S1 component. (4) Verification of polysaccharides from crystalline Coprinus comatus mycelium The DOS1 component obtained in step (3) was loaded into HPLC. Chromatographic conditions: Agilent 1260 Infinity high performance liquid chromatograph, Agilent PL aquagel-OH MIXED-H gel column, Agilent G1362ARID differential refractive index detector, column temperature 35℃, injection volume 20μL, mobile phase distilled water, 0.6mL / min. The result showed a single retention peak, indicating that the polysaccharide was a pure polysaccharide, namely crystalline coprinus comatus mycelial polysaccharide CMMPS.
3. The method for preparing crystalline coprinus mycelial polysaccharide according to claim 2, characterized in that: The liquid PDA culture medium in step (1) is obtained by boiling 200g of peeled potatoes until soft, filtering, adding 20g of glucose, and distilling water to a final volume of 1L, and then culturing in the medium at 26℃ and 120-180r / min for 7-10 days with shaking.
4. The method for preparing crystalline coprinus mycelial polysaccharide according to claim 2, characterized in that: After the cell wall breaking treatment of the crystalline Coprinus comatus mycelium in step (1), distilled water was added at a material-to-liquid ratio of 1:20, and the mixture was shaken and heated in a water bath at 60-90℃ for 4-6 hours.
5. The method for preparing crystalline coprinus mycelial polysaccharide according to claim 2, characterized in that: The mycelial extract collected in step (1) was centrifuged at 8000 r / min for 10-20 min, and the supernatant was collected. The resulting centrifuged supernatant was then concentrated by rotary evaporation, and 4 times the volume of anhydrous ethanol was added to precipitate the polysaccharide.
6. The method for preparing crystalline coprinus mycelial polysaccharide according to claim 2, characterized in that: In step (1) of the Sevag method, the Sevag reagent is prepared according to the ratio of chloroform: n-butanol = 4:1, and the Sevag reagent is added according to the ratio of crude solution: Sevag reagent = 4:
1. The mixture is then shaken vigorously for 8-10 minutes and allowed to stand.
7. The method for preparing crystalline coprinus mycelial polysaccharide according to claim 2, characterized in that: The crude polysaccharide described in step (2) was dissolved in 50 mM Tris-HCl buffer and loaded into a DEAE-52 anion exchange chromatography column, and eluted with 50 mM Tris-HCl and 0 M NaCl solution; wherein the pH of the Tris-HCl buffer was 7.
5.
8. The method for preparing crystalline coprinus mycelial polysaccharide according to claim 2, characterized in that: The D0 component described in step (3) was dissolved in distilled water and loaded onto a Sephadex G-75 gel column. It was then eluted with distilled water, and the eluent was collected using a distribution collector at a rate of 1 mL / tube / 3 min. The first elution peak was collected.
9. The use of the crystalline coprinus mycelial polysaccharide with synergistic immunomodulatory and antitumor effects as described in claim 1, characterized in that: This drug is used to prepare a drug that promotes the inhibitory effect of RAW264.7 immune cells on the proliferation of A549 tumor cells.